MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-243K14
Chromosome	17 (Build37)
Map Location	45,769,363 - 45,966,213
singlet/doublet	doublet
Overlap gene	Capn11, Tmem63b, Mrpl14, LOC100043363
Upstream gene	Runx2, Supt3h, 4930564C03Rik, EG210562, EG668314, Cdc5l, Spats1, EG668319, Aars2, Tcte1, Gm323, Nfkbie, Slc35b2, Hsp90ab1, Slc29a1, EG653016
Downstream gene	Vegfa, Mrps18a, 1700027N10Rik, Mad2l1bp, Gtpbp2, Polh, Xpo5, Rpo1-1, Yipf3, Gm88, Tjap1, Egfl9, Abcc10, BC040756, Zfp318, LOC677168, Crip3, Slc22a7, EG328825, Ttbk1, BC048355, Parc, Srf, Ptk7, Klc4, Mrpl2, Cul7, BC011248, Klhdc3, Mea1, Ppp2r5d, Pex6, Gnmt, Tnrc5, Ptcra, 2310039H08Rik, Rpl7l1, BC032203
Link	Open Mouse BAC browser

Click to get alignment info.

name	Runx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12393 MGI:99829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supt3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109115 MGI:1923723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930564C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75341 MGI:1922591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG210562 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210562 MGI:3649016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 4 Proteins

name	EG668314 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668314 MGI:3645356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cdc5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71702 MGI:1918952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spats1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71020 MGI:1918270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668319 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668319 MGI:3645365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1076 ESTs, 10 Proteins

name	Aars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224805 MGI:2681839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcte1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21645 MGI:98640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm323 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210573 MGI:2685169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfkbie (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18037 MGI:1194908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73836 MGI:1921086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsp90ab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15516 MGI:96247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc29a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63959 MGI:1927073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG653016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:653016 MGI:3649059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein

name	Capn11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268958 MGI:1352490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem63b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224807 MGI:2387609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68463 MGI:1333864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Vegfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22339 MGI:103178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Mrps18a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68565 MGI:1915815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75564 MGI:1922814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mad2l1bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66591 MGI:1913841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtpbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56055 MGI:1860138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80905 MGI:1891457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpo5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72322 MGI:1913789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpo1-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20016 MGI:103288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yipf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28064 MGI:106280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224813 MGI:2684934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 3 Proteins

name	Tjap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74094 MGI:1921344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egfl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106565 MGI:2146838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224814 MGI:2386976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC040756 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414073 MGI:3041251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Zfp318 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57908 MGI:1889348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC677168 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs pseudo : _no_value

name	Crip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114570 MGI:2152434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc22a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108114 MGI:1859559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG328825 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328825 MGI:3644404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 550 ESTs, 7 Proteins

name	Ttbk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106763 MGI:2147036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs, 7 Proteins

name	BC048355 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381101 MGI:3039376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78309 MGI:1925559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20807 MGI:106658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71461 MGI:1918711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74764 MGI:1922014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27398 MGI:1351622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cul7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66515 MGI:1913765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC011248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224823 MGI:2385053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71765 MGI:2651568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mea1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17256 MGI:96957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r5d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21770 MGI:2388481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224824 MGI:2385054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14711 MGI:1202304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72029 MGI:1919279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptcra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19208 MGI:104857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310039H08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67101 MGI:1914351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl7l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66229 MGI:1913479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC032203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210982 MGI:2673855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 103 ESTs, 2 Proteins

name	Runx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909357 GeneID:12393 MGI:99829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : runt related transcription factor 2 transcript_id : NM_009820.2

name	Supt3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803014 GeneID:109115 MGI:1923723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of Ty 3 homolog (S. cerevisiae) transcript_id : NM_178652.2

name	4930564C03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401995 GeneID:75341 MGI:1922591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930564C03 gene transcript_id : XM_484637.3

name	EG210562 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401997 GeneID:210562 MGI:3649016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 4 Proteins product : predicted gene, EG210562 transcript_id : XM_140033.6

name	Cdc5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892345 GeneID:71702 MGI:1918952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 5-like (S. pombe) transcript_id : NM_152810.2

name	Spats1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368476 GeneID:71020 MGI:1918270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated, serine-rich 1 transcript_id : NM_027649.2

name	EG668319 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268855 GeneID:668319 MGI:3645365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1076 ESTs, 10 Proteins product : predicted gene, EG668319 transcript_id : XM_001004126.2

name	Aars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52630310 GeneID:224805 MGI:2681839
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alanyl-tRNA synthetase 2, mitochondrial (putative) transcript_id : NM_198608.2

name	Tcte1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430563 GeneID:21645 MGI:98640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex-associated testis expressed 1 transcript_id : NM_013688.2

name	Gm323 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701443 GeneID:210573 MGI:2685169
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 323, (NCBI) transcript_id : NM_001013749.1

name	Nfkbie (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130686 GeneID:18037 MGI:1194908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon transcript_id : NM_008690.3

name	Slc35b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802496 GeneID:73836 MGI:1921086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member B2 transcript_id : NM_028662.2

name	Hsp90ab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130847 GeneID:15516 MGI:96247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 90kDa alpha (cytosolic), class B member 1 transcript_id : NM_008302.3

name	Slc29a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892630 GeneID:63959 MGI:1927073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 29 (nucleoside transporters), member 1 transcript_id : NM_022880.2

name	EG653016 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94402004 GeneID:653016 MGI:3649059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 1 Protein product : predicted gene, EG653016 transcript_id : XM_001000918.1

name	Capn11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131210 GeneID:268958 MGI:1352490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 11 transcript_id : NM_001013767.2

name	Tmem63b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376394 GeneID:224807 MGI:2387609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 63b transcript_id : NM_198167.2

name	Mrpl14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980860 GeneID:68463 MGI:1333864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L14 transcript_id : NM_026732.2

name	Vegfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131120 GeneID:22339 MGI:103178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vascular endothelial growth factor A transcript_id : NM_001025257.2

name	Vegfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130279 GeneID:22339 MGI:103178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vascular endothelial growth factor A transcript_id : NM_009505.3

name	Vegfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131137 GeneID:22339 MGI:103178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vascular endothelial growth factor A transcript_id : NM_001025250.2

name	Mrps18a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359013 GeneID:68565 MGI:1915815
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S18A transcript_id : NM_026768.2

name	1700027N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357778 GeneID:75564 MGI:1922814
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700027N10 gene transcript_id : NM_029338.2

name	Mad2l1bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352597 GeneID:66591 MGI:1913841
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAD2L1 binding protein transcript_id : NM_025649.2

name	Gtpbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980943 GeneID:56055 MGI:1860138
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 2 transcript_id : NM_019581.2

name	Polh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378119 GeneID:80905 MGI:1891457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), eta (RAD 30 related) transcript_id : NM_030715.3

name	Xpo5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130447 GeneID:72322 MGI:1913789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exportin 5 transcript_id : NM_028198.2

name	Rpo1-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226250 GeneID:20016 MGI:103288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-1 transcript_id : NM_009085.2

name	Yipf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703703 GeneID:28064 MGI:106280
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yip1 domain family, member 3 transcript_id : NM_145353.1

name	Gm88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268856 GeneID:224813 MGI:2684934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 3 Proteins product : gene model 88, (NCBI) transcript_id : XM_001481057.1

name	Tjap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27229172 GeneID:74094 MGI:1921344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tight junction associated protein 1 transcript_id : NM_028751.2

name	Egfl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:102468233 GeneID:106565 MGI:2146838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like-domain, multiple 9 transcript_id : NM_207666.2

name	Abcc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:102467836 GeneID:224814 MGI:2386976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 10 transcript_id : NM_170680.2

name	Abcc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:102467835 GeneID:224814 MGI:2386976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 10 transcript_id : NM_145140.2

name	BC040756 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268721 GeneID:414073 MGI:3041251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : cDNA sequence BC040756 transcript_id : XM_001480054.1

name	Zfp318 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946663 GeneID:57908 MGI:1889348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 318 transcript_id : NM_021346.1

name	Zfp318 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849777 GeneID:57908 MGI:1889348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 318 transcript_id : NM_207671.2

name	Crip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891750 GeneID:114570 MGI:2152434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich protein 3 transcript_id : NM_053250.2

name	Crip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892348 GeneID:114570 MGI:2152434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich protein 3 transcript_id : NM_181664.2

name	Slc22a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450072 GeneID:108114 MGI:1859559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion transporter), member 7 transcript_id : NM_144856.1

name	EG328825 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94402013 GeneID:328825 MGI:3644404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 550 ESTs, 7 Proteins product : predicted gene, EG328825 transcript_id : XM_286185.6

name	Ttbk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268724 GeneID:106763 MGI:2147036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs, 7 Proteins product : tau tubulin kinase 1 transcript_id : XM_001480065.1

name	BC048355 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802674 GeneID:381101 MGI:3039376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048355 transcript_id : NM_207161.3

name	Parc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486736 GeneID:78309 MGI:1925559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : p53-associated parkin-like cytoplasmic protein transcript_id : NM_001081335.1

name	Srf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892959 GeneID:20807 MGI:106658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum response factor transcript_id : NM_020493.2

name	Ptk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351040 GeneID:71461 MGI:1918711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PTK7 protein tyrosine kinase 7 transcript_id : NM_175168.3

name	Klc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366781 GeneID:74764 MGI:1922014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin light chain 4 transcript_id : NM_029091.2

name	Mrpl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130368 GeneID:27398 MGI:1351622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L2 transcript_id : NM_025302.3

name	Cul7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58761521 GeneID:66515 MGI:1913765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cullin 7 transcript_id : NM_025611.5

name	BC011248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450074 GeneID:224823 MGI:2385053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC011248 transcript_id : NM_144857.1

name	Klhdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801739 GeneID:71765 MGI:2651568
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 3 transcript_id : NM_027910.2

name	Mea1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754673 GeneID:17256 MGI:96957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : male enhanced antigen 1 transcript_id : NM_010787.1

name	Ppp2r5d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942058 GeneID:21770 MGI:2388481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), delta isoform transcript_id : NM_009358.2

name	Pex6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703961 GeneID:224824 MGI:2385054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 6 transcript_id : NM_145488.1

name	Gnmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754025 GeneID:14711 MGI:1202304
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine N-methyltransferase transcript_id : NM_010321.1

name	Tnrc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982623 GeneID:72029 MGI:1919279
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 5 transcript_id : NM_028065.2

name	Ptcra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755215 GeneID:19208 MGI:104857
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre T-cell antigen receptor alpha transcript_id : NM_011195.1

name	2310039H08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286871 GeneID:67101 MGI:1914351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310039H08 gene transcript_id : NM_025966.3

name	Rpl7l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130326 GeneID:66229 MGI:1913479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L7-like 1 transcript_id : NM_025433.3

name	BC032203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268859 GeneID:210982 MGI:2673855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 2 Proteins product : cDNA sequence BC032203 transcript_id : XM_001001238.2

name	Runx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20806530 GeneID:12393 MGI:99829
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0048469 - cell maturation [Evidence IMP] [Evidence IGI]; GO:0002062 - chondrocyte differentiation [Evidence IGI]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0001649 - osteoblast differentiation [Evidence IGI] [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA]; GO:0040036 - regulation of fibroblast growth factor receptor signaling pathway [Evidence IMP]; GO:0042487 - regulation of odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : AKV core binding factor; polyomavirus enhancer binding factor 2 (PEBP2); core binding factor alpha 1; testicular RUNX2 isoform; PEBP2 alpha A; SL3-3 enhancer factor 1; runt domain, alpha subunit 1 product : runt related transcription factor 2 protein_id : NP_033950.1

name	Supt3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520009 GeneID:109115 MGI:1923723
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : suppressor of Ty 3 homolog protein_id : NP_848767.1

name	4930564C03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770289 GeneID:75341 MGI:1922591
definition	codon_start : 1 product : hypothetical protein LOC75341 protein_id : XP_484637.1

name	EG210562 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38082562 GeneID:210562 MGI:3649016
definition	codon_start : 1 product : hypothetical protein protein_id : XP_140033.3

name	Cdc5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779899 GeneID:71702 MGI:1918952
definition	GO_component : GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cell division cycle 5-like protein_id : NP_690023.1

name	Spats1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789205 GeneID:71020 MGI:1918270
definition	codon_start : 1 exception : mismatches in translation note : Dvl2-DEP domain interacting protein product : spermatogenesis associated, serine-rich 1 protein_id : NP_081925.1

name	EG668319 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94402002 GeneID:668319 MGI:3645365
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004126.1

name	Aars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52630311 CCDS:CCDS28809.1 GeneID:224805 MGI:2681839
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : alanyl-tRNA synthetase like protein_id : NP_941010.2

name	Tcte1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430564 GeneID:21645 MGI:98640
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : t-complex-associated testis expressed 1 protein_id : NP_038716.2

name	Gm323 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701444 CCDS:CCDS28810.1 GeneID:210573 MGI:2685169
definition	codon_start : 1 product : hypothetical protein LOC210573 protein_id : NP_001013771.1

name	Nfkbie (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543321 CCDS:CCDS28811.1 GeneID:18037 MGI:1194908
definition	codon_start : 1 product : nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon protein_id : NP_032716.2

name	Slc35b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625963 GeneID:73836 MGI:1921086
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 35, member B1 product : solute carrier family 35, member B2 protein_id : NP_082938.1

name	Hsp90ab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556608 CCDS:CCDS28812.1 GeneID:15516 MGI:96247
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0030235 - nitric-oxide synthase regulator activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030911 - TPR domain binding [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0045429 - positive regulation of nitric oxide biosynthesis [Evidence ISS]; GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] [Evidence ISS] codon_start : 1 note : heat shock protein, 84 kDa 1; heat shock 90kDa protein 1, beta product : heat shock protein 1, beta protein_id : NP_032328.2

name	Slc29a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12584968 CCDS:CCDS28813.1 GeneID:63959 MGI:1927073
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005337 - nucleoside transporter activity [Evidence IDA] GO_process : GO:0015858 - nucleoside transport [Evidence IDA] codon_start : 1 note : NBMPR-sensitive equilibrative nucleoside transporter product : equilibrative nucleoside transporter 1 protein_id : NP_075018.1

name	EG653016 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94402005 GeneID:653016 MGI:3649059
definition	codon_start : 1 product : similar to embryonic stem cell- and germ cell-specific protein ESGP protein_id : XP_001000918.1

name	Capn11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000644 GeneID:268958 MGI:1352490
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : calcium-dependent thiol protease product : calpain 11 protein_id : NP_001013789.1

name	Tmem63b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718987 CCDS:CCDS28814.1 GeneID:224807 MGI:2387609
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transmembrane protein 63b protein_id : NP_937810.1

name	Mrpl14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312028 CCDS:CCDS28815.1 GeneID:68463 MGI:1333864
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : mitochondrial ribosomal protein L32 product : mitochondrial ribosomal protein L14 protein_id : NP_081008.1

name	Vegfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608153 CCDS:CCDS28817.1 GeneID:22339 MGI:103178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI] [Evidence IDA] [Evidence IMP]; GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016477 - cell migration [Evidence IDA] [Evidence IGI]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; vascular permeability factor product : vascular endothelial growth factor A isoform 3 protein_id : NP_001020428.1

name	Vegfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254603 CCDS:CCDS28818.1 GeneID:22339 MGI:103178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI] [Evidence IDA] [Evidence IMP]; GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016477 - cell migration [Evidence IDA] [Evidence IGI]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; vascular permeability factor product : vascular endothelial growth factor A isoform 2 protein_id : NP_033531.2

name	Vegfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608149 CCDS:CCDS28816.1 GeneID:22339 MGI:103178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI] [Evidence IDA] [Evidence IMP]; GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016477 - cell migration [Evidence IDA] [Evidence IGI]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; vascular permeability factor product : vascular endothelial growth factor A isoform 1 protein_id : NP_001020421.1

name	Mrps18a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17505206 CCDS:CCDS28819.1 GeneID:68565 MGI:1915815
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S18A protein_id : NP_081044.1

name	1700027N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312974 CCDS:CCDS28820.1 GeneID:75564 MGI:1922814
definition	codon_start : 1 product : hypothetical protein LOC75564 protein_id : NP_083614.1

name	Mad2l1bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385110 CCDS:CCDS28821.1 GeneID:66591 MGI:1913841
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0007094 - mitotic spindle checkpoint [Evidence ISS]; GO:0007096 - regulation of exit from mitosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MAD2L1 binding protein protein_id : NP_079925.1

name	Gtpbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9624994 GeneID:56055 MGI:1860138
definition	GO_function : GO:0005525 - GTP binding [Evidence ISS] [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : GTP binding protein 2 protein_id : NP_062527.1

name	Polh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17105328 CCDS:CCDS28822.1 GeneID:80905 MGI:1891457
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016451 - nu DNA polymerase activity [Evidence IDA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006301 - postreplication repair [Evidence IDA]; GO:0006290 - pyrimidine dimer repair [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNA polymerase eta product : polymerase (DNA directed), eta (RAD 30 related) protein_id : NP_109640.1

name	Xpo5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24429570 GeneID:72322 MGI:1913789
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IDA] GO_process : GO:0006611 - protein export from nucleus [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : exportin 5 protein_id : NP_082474.1

name	Rpo1-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226251 GeneID:20016 MGI:103288
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : RNA polymerase 1-1 (40 kDa subunit) product : RNA polymerase 1-1 protein_id : NP_033111.2

name	Yipf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703704 CCDS:CCDS28823.1 GeneID:28064 MGI:106280
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : natural killer cell-specific antigen KLIP1 protein_id : NP_663328.1

name	Gm88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268857 GeneID:224813 MGI:2684934
definition	codon_start : 1 product : similar to OTTHUMP00000016460 protein_id : XP_001481107.1

name	Tjap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311861 CCDS:CCDS28824.1 GeneID:74094 MGI:1921344
definition	GO_component : GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : hdlg-binding protein Pilt product : tight junction protein 4 (peripheral) protein_id : NP_083027.1

name	Egfl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:102468234 GeneID:106565 MGI:2146838
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : EGF-like-domain, multiple 9 protein_id : NP_997549.2

name	Abcc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24850123 GeneID:224814 MGI:2386976
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA] codon_start : 1 note : isoform mrp7B is encoded by transcript variant mrp7B; multidrug resistance-associated protein 7 product : ATP-binding cassette, sub-family C, member 10 isoform mrp7B protein_id : NP_733780.1

name	Abcc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553091 CCDS:CCDS28825.1 GeneID:224814 MGI:2386976
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA] codon_start : 1 note : isoform mrp7A is encoded by transcript variant mrp7A; multidrug resistance-associated protein 7 product : ATP-binding cassette, sub-family C, member 10 isoform mrp7A protein_id : NP_660122.1

name	BC040756 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268722 GeneID:414073 MGI:3041251
definition	codon_start : 1 product : similar to BC040756 protein protein_id : XP_001480104.1

name	Zfp318 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946664 CCDS:CCDS28826.1 GeneID:57908 MGI:1889348
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 318 isoform 2 protein_id : NP_067321.1

name	Zfp318 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575920 CCDS:CCDS28827.1 GeneID:57908 MGI:1889348
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 318 isoform 1 protein_id : NP_997554.1

name	Crip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982457 CCDS:CCDS28828.1 GeneID:114570 MGI:2152434
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 note : isoform TLP-A is encoded by transcript variant TLP-A; thymus LIM protein product : cysteine-rich protein 3 isoform TLP-A protein_id : NP_858050.1

name	Crip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716577 GeneID:114570 MGI:2152434
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 note : isoform TLP-B is encoded by transcript variant TLP-B; thymus LIM protein product : cysteine-rich protein 3 isoform TLP-B protein_id : NP_444480.1

name	Slc22a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450073 CCDS:CCDS28829.1 GeneID:108114 MGI:1859559
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008514 - organic anion transporter activity [Evidence TAS] [Evidence IDA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence TAS]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 22 member 7 protein_id : NP_659105.1

name	EG328825 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38082564 GeneID:328825 MGI:3644404
definition	codon_start : 1 product : similar to ribosomal protein L11 protein_id : XP_286185.2

name	Ttbk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268725 GeneID:106763 MGI:2147036
definition	codon_start : 1 product : tau tubulin kinase 1 protein_id : XP_001480115.1

name	BC048355 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625744 CCDS:CCDS28830.1 GeneID:381101 MGI:3039376
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : c-Myc-responsive product : putative c-Myc-responsive protein_id : NP_997044.2

name	Parc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486737 GeneID:78309 MGI:1925559
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : p53-associated parkin-like cytoplasmic protein protein_id : NP_001074804.1

name	Srf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048414 CCDS:CCDS28831.1 GeneID:20807 MGI:106658
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0001947 - heart looping [Evidence IMP]; GO:0046716 - muscle maintenance [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : serum response factor protein_id : NP_065239.1

name	Ptk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425042 GeneID:71461 MGI:1918711
definition	GO_function : GO:0005524 - ATP binding [Evidence IC]; GO:0016301 - kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IDA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0045198 - establishment of epithelial cell polarity [Evidence IMP]; GO:0001843 - neural tube closure [Evidence IGI] [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : receptor tyrosine kinase-like protein product : PTK7 protein tyrosine kinase 7 protein_id : NP_780377.1

name	Klc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386370 CCDS:CCDS28832.1 GeneID:74764 MGI:1922014
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] codon_start : 1 product : kinesin-like 8 protein_id : NP_083367.1

name	Mrpl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384660 GeneID:27398 MGI:1351622
definition	GO_component : GO:0005762 - mitochondrial large ribosomal subunit [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, L14 product : mitochondrial ribosomal protein L2 protein_id : NP_079578.1

name	Cul7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57013279 CCDS:CCDS28833.1 GeneID:66515 MGI:1913765
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : cullin 7 protein_id : NP_079887.3

name	BC011248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450075 GeneID:224823 MGI:2385053
definition	codon_start : 1 product : hypothetical protein LOC224823 protein_id : NP_659106.1

name	Klhdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17017965 CCDS:CCDS28834.1 GeneID:71765 MGI:2651568
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0000790 - nuclear chromatin [Evidence IDA] [Evidence ISS] GO_function : GO:0003682 - chromatin binding [Evidence ISS] GO_process : GO:0007126 - meiosis [Evidence IEA]; GO:0007131 - meiotic recombination [Evidence ISS] codon_start : 1 exception : mismatches in translation note : testis intracellular mediator protein product : kelch domain containing 3 protein_id : NP_082186.1

name	Mea1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754674 CCDS:CCDS28835.1 GeneID:17256 MGI:96957
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : male-enhanced antigen-1 product : male enhanced antigen 1 protein_id : NP_034917.1

name	Ppp2r5d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942059 CCDS:CCDS28836.1 GeneID:21770 MGI:2388481
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : testis expressed gene 271 product : delta isoform of regulatory subunit B56, protein phosphatase 2A protein_id : NP_033384.2

name	Pex6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703962 CCDS:CCDS28837.1 GeneID:224824 MGI:2385054
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : peroxisomal biogenesis factor 6 protein_id : NP_663463.1

name	Gnmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754026 CCDS:CCDS28838.1 GeneID:14711 MGI:1202304
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : glycine N methyl transferase product : glycine N-methyltransferase protein_id : NP_034451.1

name	Tnrc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312510 CCDS:CCDS28839.1 GeneID:72029 MGI:1919279
definition	codon_start : 1 product : trinucleotide repeat containing 5 protein_id : NP_082341.1

name	Ptcra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755216 CCDS:CCDS28840.1 GeneID:19208 MGI:104857
definition	codon_start : 1 product : pre T-cell antigen receptor alpha protein_id : NP_035325.1

name	2310039H08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385462 CCDS:CCDS28841.1 GeneID:67101 MGI:1914351
definition	codon_start : 1 product : hypothetical protein LOC67101 protein_id : NP_080242.1

name	Rpl7l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754134 CCDS:CCDS28842.1 GeneID:66229 MGI:1913479
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L7-like 1 protein_id : NP_079709.2

name	BC032203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268860 GeneID:210982 MGI:2673855
definition	codon_start : 1 product : similar to Uncharacterized protein KIAA0240 protein_id : XP_001001238.2

name	EG668314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668314
definition	number : 1 pseudo : _no_value

name	EG668314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668314
definition	number : 2 pseudo : _no_value

name	EG668314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668314
definition	number : 3 pseudo : _no_value

name	EG668314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668314
definition	number : 4 pseudo : _no_value

name	LOC100043363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043363
definition	number : 1 pseudo : _no_value

name	LOC677168 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268858 GeneID:677168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs product : similar to ISG15 ubiquitin-like modifier pseudo : _no_value transcript_id : XR_034969.1

clone name	MSMg01-296H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119F16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-147I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418L16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472B01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-315E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106C18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-243K14.b	B6Ng01-243K14.g
ACC	GA052984	GA052985
length	1,103	381
definition	B6Ng01-243K14.b	B6Ng01-243K14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(45,965,115 - 45,966,213)	(45,769,363 - 45,769,749)
sequence	gaattccataaaattaagatttcctactcggggatttttcattttactta agagtgtcatgcagcaagccgtctcttgggacctttctgtcttggattcc tattgcctggttccatcacactgtggcatgttaggctaggctggtcgttt ttcttgaccgctgtctaacgtttcaccatgtgaccgcgtggccgcactca ttcacccactctgatgcttatggccacaggggcaggccccagatttttct cccgtgagccatgctgctctgaacattctcactctggtctcctgcttcag cagatgatgtcacagagtcaagtctgcttaaataaaccaaggcgggaggg ttgtatatcttcaacagaaaagaagcaagctcttaaagaaacttcccagc agggccccccactctcgactgtgctcaccgaacaatggatccacaaagag gcttccaaggctagtgaccaacccagcactgtggaacaaggacatcttga acaactctcctaccacgagagcgttttgacatcccagagtggcggtaagg aagcgggtaaccacaggggctgctcactgagctgtgtgcagggctgtagc cccaacgtgtctcgctgtacacttgggatgcaccaccccagatagcaacc ccaactcccatgccagaccacagtgggcatgcactgtcggtgactacagc tggcaagtgttccaaatgggaaatgaatcgcagccccaggcctgcccctg ccctgctgggttcctctggggaccctggttgaatcaccaacctttgtgag actggagtggccttacttgagccccagggaggtgcacacccagtgagata agaggtctaacatccttttggatgggagagaatgttcgagagggtggaga acctgagtgtagagccaggtaagagaggaggcttctcttgcccagctcaa attacacttgttcactgtcaactcagggaatatggatagctctctcaggc aaaaaatattggtatcaagggccctctcttacactaccatggggagtgga ccatactactggactaggatggcataccaggccttgcataaggacaagga aat	atgaagctccagcttgccagaaccatctttctagggagattagtcaagga taagaggaaagagggcattctggggaagaggaaacaaaaggtgtccacag tctacacaggcttggggttcctcaatgctaacagccagaactgggagctc cagctacgccacccccctccccccagatctcttccctatcacagggaaag ggcactgatgctggagggagagatggcagggagaagatgggaaacacccc agtaggctagccacagggcagaaagatacatccaggaggttgatcatccg gcgacagacttccaagctaaagcccttcgtcttgaagttccttactgtga aggaggggtggggtgggaagaagaggtgggt
quality values	Open. Hide. 58 22 34 32 52 47 38 14 52 46 62 62 54 54 62 56 49 62 47 37 62 62 62 62 62 62 49 62 62 56 56 56 37 15 20 46 59 62 62 59 43 62 62 62 59 62 46 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 49 49 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 59 59 59 62 62 62 62 62 62 62 62 59 59 62 59 62 54 54 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 59 62 62 56 59 46 54 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 59 59 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 45 62 56 62 62 62 62 62 51 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 56 56 54 56 56 62 62 62 62 62 62 62 56 54 62 56 62 56 62 56 62 62 62 62 62 62 62 62 62 62 54 54 62 56 62 50 56 56 38 62 62 62 62 47 47 56 62 62 62 62 51 56 51 54 62 47 56 62 62 62 62 62 62 62 56 56 31 38 56 56 62 62 62 62 62 62 56 56 56 56 62 56 62 56 62 56 56 47 62 56 62 56 62 62 62 56 62 62 62 62 62 62 62 54 62 42 62 54 52 62 52 46 62 52 54 62 47 54 54 62 54 31 35 25 31 40 38 38 62 62 62 62 47 48 54 39 44 52 52 52 33 52 52 52 48 54 54 58 52 42 42 40 40 39 45 52 54 58 58 52 58 54 52 52 50 52 54 54 47 54 54 39 41 35 42 52 52 58 52 52 54 46 42 54 54 54 54 58 54 54 58 58 41 47 52 52 51 54 48 58 58 52 54 24 42 54 50 50 52 41 41 58 58 54 39 19 36 37 53 52 46 47 46 44 47 47 51 33 37 46 50 42 47 35 35 49 45 58 50 46 39 58 34 48 40 51 51 26 34 49 58 58 37 42 50 58 50 51 42 26 51 53 42 27 51 50 49 36 21 50 34 41 32 40 52 51 50 58 46 54 22 30 49 50 58 41 53 53 28 50 44 32 44 44 43 51 50 39 33 41 40 51 47 29 39 50 50 31 37 50 40 16 29 33 49 44 44 35 51 26 44 50 51 37 58 50 26 25 33 43 37 52 53 51 51 53 39 28 20 35 40 24 34 54 54 40 21 13 44 23 31 35 40 35 41 38 22 18 15 32 32 39 54 23 54 34 49 54 35 29 25 13 20 33 11 27 24 37 52 51 42 31 31 37 21 21 27 33 47 24 26 7 7 21 44 26 47 47 47 29 29 30 37 16 26 6 20 29 45 32 27 26 26 19 36 33 31 30 31 34 17 9 11 7 29 31 34 37 26 38 27 30 27 8 31 32 25 30 35 30 13 45 51 13 9 14 26 32 9 40 12 45 16 36 16 27 26 31 36 17 24 19 6 20 10 42 28 46 31 34 34 29 20 18 46 33 23 17 25 28 41 13 21 31 34 30 20 41 18 16 27 8 23 19 6 17 22 11 33 5 19 11 25 44 18 10 39 11 13 10 15 15 18 20 31 26 32 27 16 14 21 24 19 13 46 30 18 17 29 16 11 18 13 9 26 16 10 9 11 23 24 15 21 17 11 38 31 16 21 12 6 21 25 28 41 13 11 9 6 6 26 6 8 10 25 26 44 10 12 18 21 17 11 19 19 26 34 48 43 30 5 4 6 26 21 6 4 5 7 20 10 8 7 16 34 6 8 4 9 11 5 6 7 11 14 12 19 9 32 28 24 20 13 3 4 27 34 34 7 8 6 13 15 16 13 5 10 6 11 11 16 27 7 6 5 15 7 8 5 4 13 21 15 7 11 15 16 6 6 6 5 5 6 17 11 6 3 3 3 7 13 11 5 15 10 13 7 7 17 8 5 11 17 9 16 27 24 7	Open. Hide. 43 59 62 59 62 18 34 28 28 24 16 23 27 28 48 62 62 59 49 59 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 59 59 59 56 34 54 54 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 46 12 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_45965115_45966213
seq2: B6Ng01-243K14.b_47_1149 (reverse)

seq1  ATTTCCTTGTCCTTATGCAGGGCCTTGTATGCCATCCTGCTCCTGTAAGT  50
      ||||||||||||||||||| ||||| ||||||||||||  ||| || |||
seq2  ATTTCCTTGTCCTTATGCAAGGCCTGGTATGCCATCCTAGTCCAGT-AGT  49

seq1  ATGGTCCACTCCCATTGGTAGTGTAAGAGAGGGGCCCTGATA-CAATA-T  98
      |||||||||||||  |||||||||||||||||| || ||||| ||||| |
seq2  ATGGTCCACTCCCCATGGTAGTGTAAGAGAGGGCCCTTGATACCAATATT  99

seq1  TTTTGCCTGGAGAGGAGCTAT-CATATTCCCTGAGTTGACAGTGA--CAG  145
      |||||||| |||| ||||||| |||||||||||||||||||||||   ||
seq2  TTTTGCCT-GAGA-GAGCTATCCATATTCCCTGAGTTGACAGTGAACAAG  147

seq1  TGTAATTTGGAGCTGGGCAAGAGAGGCCTCCTCTCTT-CCTGGCTCTACA  194
      |||||||| ||||||||||||||| |||||||||||| ||||||||||||
seq2  TGTAATTT-GAGCTGGGCAAGAGAAGCCTCCTCTCTTACCTGGCTCTACA  196

seq1  CTCAGGTTCTCCACCCTCTCGAACATTCTCTCCAATCC-AAAGGATGTTA  243
      ||||||||||||||||||||||||||||||||| |||| |||||||||||
seq2  CTCAGGTTCTCCACCCTCTCGAACATTCTCTCCCATCCAAAAGGATGTTA  246

seq1  GACCTCTTATCTCACTGGGTGTGCACCTCCCTGGGGCTC-AGTAAGGCCA  292
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  GACCTCTTATCTCACTGGGTGTGCACCTCCCTGGGGCTCAAGTAAGGCCA  296

seq1  CTCCAGTCTCACAAAGGTTGGTGATTCAACCAGGGTCCCCAGAGGAACCC  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAGTCTCACAAAGGTTGGTGATTCAACCAGGGTCCCCAGAGGAACCC  346

seq1  AGCAGGGCAGGGGCAGGCCTGGGGCTGCGATTCATTTCCCATTTGGAACA  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGGCAGGGGCAGGCCTGGGGCTGCGATTCATTTCCCATTTGGAACA  396

seq1  CTTGCCAGCTGTAGTCACCGACAGTGCATGCCCACTGTGGTCTGGCATGG  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCAGCTGTAGTCACCGACAGTGCATGCCCACTGTGGTCTGGCATGG  446

seq1  GAGTTGGGGTTGCTATCTGGGGTGGTGCATCCCAAGTGTACAGCGAGACA  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTGGGGTTGCTATCTGGGGTGGTGCATCCCAAGTGTACAGCGAGACA  496

seq1  CGTTGGGGCTACAGCCCTGCACACAGCTCAGTGAGCAGCCCCTGTGGTTA  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTGGGGCTACAGCCCTGCACACAGCTCAGTGAGCAGCCCCTGTGGTTA  546

seq1  CCCGCTTCCTTACCGCCACTCTGGGATGTCAAAACGCTCTCGTGGTAGGA  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGCTTCCTTACCGCCACTCTGGGATGTCAAAACGCTCTCGTGGTAGGA  596

seq1  GAGTTGTTCAAGATGTCCTTGTTCCACAGTGCTGGGTTGGTCACTAGCCT  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTGTTCAAGATGTCCTTGTTCCACAGTGCTGGGTTGGTCACTAGCCT  646

seq1  TGGAAGCCTCTTTGTGGATCCATTGTTCGGTGAGCACAGTCGAGAGTGGG  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAGCCTCTTTGTGGATCCATTGTTCGGTGAGCACAGTCGAGAGTGGG  696

seq1  GGGCCCTGCTGGGAAGTTTCTTTAAGAGCTTGCTTCTTTTCTGTTGAAGA  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCCTGCTGGGAAGTTTCTTTAAGAGCTTGCTTCTTTTCTGTTGAAGA  746

seq1  TATACAACCCTCCCGCCTTGGTTTATTTAAGCAGACTTGACTCTGTGACA  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATACAACCCTCCCGCCTTGGTTTATTTAAGCAGACTTGACTCTGTGACA  796

seq1  TCATCTGCTGAAGCAGGAGACCAGAGTGAGAATGTTCAGAGCAGCATGGC  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCTGCTGAAGCAGGAGACCAGAGTGAGAATGTTCAGAGCAGCATGGC  846

seq1  TCACGGGAGAAAAATCTGGGGCCTGCCCCTGTGGCCATAAGCATCAGAGT  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACGGGAGAAAAATCTGGGGCCTGCCCCTGTGGCCATAAGCATCAGAGT  896

seq1  GGGTGAATGAGTGCGGCCACGCGGTCACATGGTGAAACGTTAGACAGCGG  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGAATGAGTGCGGCCACGCGGTCACATGGTGAAACGTTAGACAGCGG  946

seq1  TCAAGAAAAACGACCAGCCTAGCCTAACATGCCACAGTGTGATGGAACCA  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGAAAAACGACCAGCCTAGCCTAACATGCCACAGTGTGATGGAACCA  996

seq1  GGCAATAGGAATCCAAGACAGAAAGGTCCCAAGAGACGGCTTGCTGCATG  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAATAGGAATCCAAGACAGAAAGGTCCCAAGAGACGGCTTGCTGCATG  1046

seq1  ACACTCTTAAGTAAAATGAAAAATCCCCGAGTAGGAAATCTTAATTTTAT  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTCTTAAGTAAAATGAAAAATCCCCGAGTAGGAAATCTTAATTTTAT  1096

seq1  GGAATTC  1099
      |||||||
seq2  GGAATTC  1103

seq1: chr17_45769363_45769749
seq2: B6Ng01-243K14.g_66_452

seq1  GAATTCATGAAGCTCCAGCTTGCCAGAACCATCTTTCTAGGGAGATTAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGAAGCTCCAGCTTGCCAGAACCATCTTTCTAGGGAGATTAGT  50

seq1  CAAGGATAAGAGGAAAGAGGGCATTCTGGGGAAGAGGAAACAAAAGGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGATAAGAGGAAAGAGGGCATTCTGGGGAAGAGGAAACAAAAGGTGT  100

seq1  CCACAGTCTACACAGGCTTGGGGTTCCTCAATGCTAACAGCCAGAACTGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACAGTCTACACAGGCTTGGGGTTCCTCAATGCTAACAGCCAGAACTGG  150

seq1  GAGCTCCAGCTACGCCACCCCCCTCCCCCCAGATCTCTTCCCTATCACAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTCCAGCTACGCCACCCCCCTCCCCCCAGATCTCTTCCCTATCACAG  200

seq1  GGAAAGGGCACTGATGCTGGAGGGAGAGATGGCAGGGAGAAGATGGGAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAGGGCACTGATGCTGGAGGGAGAGATGGCAGGGAGAAGATGGGAAA  250

seq1  CACCCCAGTAGGCTAGCCACAGGGCAGAAAGATACATCCAGGAGGTTGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCCAGTAGGCTAGCCACAGGGCAGAAAGATACATCCAGGAGGTTGAT  300

seq1  CATCCGGCGACAGACTTCCAAGCTAAAGCCCTTCGTCTTGAAGTTCCTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCCGGCGACAGACTTCCAAGCTAAAGCCCTTCGTCTTGAAGTTCCTTA  350

seq1  CTGTGAAGGAGGGGTGGGGTGGGAAGAAGAGGTGGGT  387
      |||||||||||||||||||||||||||||||||||||
seq2  CTGTGAAGGAGGGGTGGGGTGGGAAGAAGAGGTGGGT  387

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information