MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-244M16
Chromosome	17 (Build37)
Map Location	13,510,286 - 13,511,411
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Map3k4, 4732491K20Rik, LOC625753, Plg, Slc22a3, LOC100041192, Slc22a2, Slc22a1, Igf2r, Air, EG635617, Mas1, Mrgprh, Pnldc1, Mrpl18, Tcp1, Acat3, Acat2, Wtap, Sod2, Gpr31c, Tcp10c, Ttll2, Unc93a, Smok2a, Smok2b
Downstream gene	LOC667359, LOC100041352, LOC667372, LOC667384, Smok4a, Tcte2, Mllt4, LOC100041464, EG635895, EG664821, EG664831, 4930488N24Rik, Dact2, Smoc2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Map3k4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26407 MGI:1346875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732491K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224523 MGI:3026975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs

name	LOC625753 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Plg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18815 MGI:97620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20519 MGI:1333817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041192 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 1 Protein pseudo : _no_value

name	Slc22a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20518 MGI:1335072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20517 MGI:108111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igf2r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16004 MGI:96435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Air (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104103 MGI:1353471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG635617 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635617 MGI:3645097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Mas1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17171 MGI:96918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80978 MGI:1934134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnldc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240023 MGI:2685159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins

name	Mrpl18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67681 MGI:1914931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21454 MGI:98535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acat3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224530 MGI:109182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110460 MGI:87871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wtap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60532 MGI:1926395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sod2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20656 MGI:98352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr31c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436440 MGI:1354371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcp10c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21462 MGI:98543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625850 MGI:3644030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 23 Proteins

name	Unc93a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381058 MGI:1933250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smok2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27263 MGI:1351487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 99 Proteins

name	Smok2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236574 MGI:3037705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 99 Proteins

name	LOC667359 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein pseudo : _no_value

name	LOC100041352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 70 ESTs, 11 Proteins

name	LOC667372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	LOC667384 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 59 Proteins

name	Smok4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272667 MGI:3036233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 50 Proteins

name	Tcte2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21646 MGI:98641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mllt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17356 MGI:1314653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 177 ESTs, 3 Proteins

name	LOC100041464 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1021 ESTs, 8 Proteins pseudo : _no_value

name	EG635895 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635895 MGI:3643198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 Proteins

name	EG664821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664821 MGI:3646178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	EG664831 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664831 MGI:3643256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 Proteins

name	4930488N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75011 MGI:1922261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins

name	Dact2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240025 MGI:1920347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smoc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64074 MGI:1929881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map3k4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102420 GeneID:26407 MGI:1346875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase 4 transcript_id : NM_011948.2

name	4732491K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401588 GeneID:224523 MGI:3026975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs product : RIKEN cDNA 4732491K20 gene transcript_id : XM_488795.3

name	Plg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982112 GeneID:18815 MGI:97620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plasminogen transcript_id : NM_008877.2

name	Slc22a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892398 GeneID:20519 MGI:1333817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 3 transcript_id : NM_011395.2

name	Slc22a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130849 GeneID:20518 MGI:1335072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 2 transcript_id : NM_013667.2

name	Slc22a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370695 GeneID:20517 MGI:108111
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic cation transporter), member 1 transcript_id : NM_009202.3

name	Igf2r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778977 GeneID:16004 MGI:96435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor 2 receptor transcript_id : NM_010515.2

name	Mas1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371805 GeneID:17171 MGI:96918
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS1 oncogene transcript_id : NM_008552.3

name	Mrgprh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507681 GeneID:80978 MGI:1934134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member H transcript_id : NM_030726.1

name	Pnldc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268416 GeneID:240023 MGI:2685159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : poly(A)-specific ribonuclease (PARN)-like domain containing 1 transcript_id : XM_139740.8

name	Mrpl18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343757 GeneID:67681 MGI:1914931
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L18 transcript_id : NM_026310.2

name	Tcp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802409 GeneID:21454 MGI:98535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex protein 1 transcript_id : NM_013686.3

name	Acat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181180 GeneID:224530 MGI:109182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acetyl-Coenzyme A acetyltransferase 3 transcript_id : NM_153151.3

name	Acat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347821 GeneID:110460 MGI:87871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acetyl-Coenzyme A acetyltransferase 2 transcript_id : NM_009338.2

name	Wtap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33946270 GeneID:60532 MGI:1926395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wilms' tumour 1-associating protein transcript_id : NM_175394.1

name	Sod2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253932 GeneID:20656 MGI:98352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : superoxide dismutase 2, mitochondrial transcript_id : NM_013671.3

name	Gpr31c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130505519 GeneID:436440 MGI:1354371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 31, D17Leh66c region transcript_id : NM_001013832.2

name	Tcp10c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130497907 GeneID:21462 MGI:98543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex protein 10c transcript_id : NM_009341.2

name	Ttll2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401591 GeneID:625850 MGI:3644030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 23 Proteins product : tubulin tyrosine ligase-like family, member 2 transcript_id : XM_890411.2

name	Unc93a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40445394 GeneID:381058 MGI:1933250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-93 homolog A (C. elegans) transcript_id : NM_199252.1

name	Smok2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401593 GeneID:27263 MGI:1351487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 99 Proteins product : sperm motility kinase 2A transcript_id : XM_990030.1

name	Smok2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268409 GeneID:236574 MGI:3037705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 99 Proteins product : sperm motility kinase 2B transcript_id : XM_990063.2

name	LOC100041352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268426 GeneID:100041352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 64 ESTs, 5 Proteins product : similar to t-complex protein 10c, transcript variant 5 transcript_id : XM_001477351.1

name	LOC100041352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268418 GeneID:100041352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 50 ESTs, 5 Proteins product : similar to t-complex protein 10c, transcript variant 1 transcript_id : XM_001477276.1

name	LOC100041352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268420 GeneID:100041352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 46 ESTs, 2 Proteins product : similar to t-complex protein 10c, transcript variant 2 transcript_id : XM_001477299.1

name	LOC100041352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268422 GeneID:100041352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 47 ESTs, 1 Protein product : similar to t-complex protein 10c, transcript variant 3 transcript_id : XM_001477320.1

name	LOC100041352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268424 GeneID:100041352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 49 ESTs, 5 Proteins product : similar to t-complex protein 10c, transcript variant 4 transcript_id : XM_001477339.1

name	LOC667384 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268413 GeneID:667384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 59 Proteins product : similar to Smok4a protein transcript_id : XM_001475874.1

name	Smok4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401599 GeneID:272667 MGI:3036233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 50 Proteins product : sperm motility kinase 4A transcript_id : XM_990288.1

name	Tcte2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687622 GeneID:21646 MGI:98641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex-associated testis expressed 2 transcript_id : NM_022311.2

name	Mllt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401629 GeneID:17356 MGI:1314653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 167 ESTs, 2 Proteins product : myeloid/lymphoid or mixed lineage-leukemia translocation to 4 homolog (Drosophila), transcript variant 1 transcript_id : XM_890447.2

name	EG635895 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268490 GeneID:635895 MGI:3643198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 Proteins product : predicted gene, EG635895 transcript_id : XM_972801.2

name	EG664821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268469 GeneID:664821 MGI:3646178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins product : predicted gene, EG664821 transcript_id : XM_972876.2

name	EG664831 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268491 GeneID:664831 MGI:3643256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 Proteins product : predicted gene, EG664831 transcript_id : XM_972968.2

name	4930488N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268493 GeneID:75011 MGI:1922261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins product : RIKEN cDNA 4930488N24 gene transcript_id : XM_619430.4

name	Dact2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982103 GeneID:240025 MGI:1920347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dapper homolog 2, antagonist of beta-catenin (xenopus) transcript_id : NM_172826.2

name	Smoc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612492 GeneID:64074 MGI:1929881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPARC related modular calcium binding 2 transcript_id : NM_022315.1

name	Map3k4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93102421 GeneID:26407 MGI:1346875
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : MEK kinase 4 product : mitogen activated protein kinase kinase kinase 4 protein_id : NP_036078.2

name	4732491K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51769961 GeneID:224523 MGI:3026975
definition	codon_start : 1 product : hypothetical protein protein_id : XP_488795.1

name	Plg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982113 CCDS:CCDS28390.1 GeneID:18815 MGI:97620
definition	GO_component : GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004283 - plasmin activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0007596 - blood coagulation [Evidence IEA]; GO:0042730 - fibrinolysis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0046716 - muscle maintenance [Evidence IMP]; GO:0045445 - myoblast differentiation [Evidence IMP]; GO:0016525 - negative regulation of angiogenesis [Evidence TAS]; GO:0043537 - negative regulation of blood vessel endothelial cell migration [Evidence ISS]; GO:0050874 - organismal physiological process [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0009888 - tissue development [Evidence IEA]; GO:0042246 - tissue regeneration [Evidence IMP] codon_start : 1 exception : mismatches in translation product : plasminogen protein_id : NP_032903.2

name	Slc22a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755538 CCDS:CCDS28391.1 GeneID:20519 MGI:1333817
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015075 - ion transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0015101 - organic cation transporter activity [Evidence ISS]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0015695 - organic cation transport [Evidence ISS]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 22, member 3; organic cation transporter 3 product : solute carrier family 22 (organic cation transporter), member 3 protein_id : NP_035525.1

name	Slc22a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305499 CCDS:CCDS28392.1 GeneID:20518 MGI:1335072
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0015101 - organic cation transporter activity [Evidence ISS] [Evidence IDA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IDA]; GO:0015695 - organic cation transport [Evidence ISS]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 22, member 2; organic cation transporter 2 product : solute carrier family 22 member 2 protein_id : NP_038695.1

name	Slc22a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982010 CCDS:CCDS28393.1 GeneID:20517 MGI:108111
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0015101 - organic cation transporter activity [Evidence IDA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 22, member 1 product : solute carrier family 22 member 1 protein_id : NP_033228.2

name	Igf2r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778978 GeneID:16004 MGI:96435
definition	GO_component : GO:0005768 - endosome [Evidence ISS]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005641 - nuclear envelope lumen [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030140 - trans-Golgi network transport vesicle [Evidence ISS] GO_function : GO:0005520 - insulin-like growth factor binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : IGF-II/CI-MPR; cation-independent MPR; cation-independent mannose 6-phosphate receptor; mannose-6-phosphate receptor, cation independent product : insulin-like growth factor 2 receptor protein_id : NP_034645.2

name	Mas1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543241 CCDS:CCDS28394.1 GeneID:17171 MGI:96918
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : MAS1 oncogene protein_id : NP_032578.2

name	Mrgprh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507682 CCDS:CCDS28395.1 GeneID:80978 MGI:1934134
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G-protein coupled receptor GPR90; G protein-coupled receptor 90 product : MAS-related GPR, member H protein_id : NP_109651.1

name	Pnldc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268417 GeneID:240023 MGI:2685159
definition	codon_start : 1 product : poly(A)-specific ribonuclease (PARN)-like domain containing 1 protein_id : XP_139740.6

name	Mrpl18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385808 CCDS:CCDS28396.1 GeneID:67681 MGI:1914931
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L18 protein_id : NP_080586.1

name	Tcp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625624 CCDS:CCDS28397.1 GeneID:21454 MGI:98535
definition	GO_component : GO:0005832 - chaperonin-containing T-complex [Evidence IDA]; GO:0005815 - microtubule organizing center [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0000242 - pericentriolar material [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : snoRNA MBI-39; snoRNA MBI-125; t-complex polypeptide 1 product : t-complex protein 1 protein_id : NP_038714.2

name	Acat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625948 CCDS:CCDS28398.1 GeneID:224530 MGI:109182
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : acetyl CoA transferase-like product : acetyl-Coenzyme A acetyltransferase 3 protein_id : NP_694791.2

name	Acat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348956 GeneID:110460 MGI:87871
definition	GO_function : GO:0003985 - acetyl-CoA C-acetyltransferase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : t-complex protein 1, related sequence 1 product : acetyl-Coenzyme A acetyltransferase 2 protein_id : NP_033364.1

name	Wtap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33946271 GeneID:60532 MGI:1926395
definition	GO_component : GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : Wilms' tumour 1-associating protein protein_id : NP_780603.1

name	Sod2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980762 CCDS:CCDS28399.1 GeneID:20656 MGI:98352
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0030145 - manganese ion binding [Evidence IEA]; GO:0008383 - manganese superoxide dismutase activity [Evidence IMP] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004784 - superoxide dismutase activity [Evidence IEA] GO_process : GO:0001315 - age-dependent response to reactive oxygen species [Evidence ISS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0000303 - response to superoxide [Evidence ISS]; GO:0006801 - superoxide metabolism [Evidence ISS] [Evidence IMP] codon_start : 1 note : manganese SOD; manganese superoxide dismutase product : superoxide dismutase 2, mitochondrial protein_id : NP_038699.2

name	Gpr31c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130505520 GeneID:436440 MGI:1354371
definition	codon_start : 1 product : G protein-coupled receptor 31, D17Leh66c region protein_id : NP_001013854.2

name	Tcp10c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130497908 CCDS:CCDS28401.1 GeneID:21462 MGI:98543
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : t-complex protein 10c protein_id : NP_033367.2

name	Ttll2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401592 GeneID:625850 MGI:3644030
definition	codon_start : 1 product : similar to RP3-366N23.3 protein_id : XP_895504.2

name	Unc93a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40445395 CCDS:CCDS28402.1 GeneID:381058 MGI:1933250
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : unc93 (C.elegans) homolog A product : unc-93 homolog A protein_id : NP_954860.1

name	Smok2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401594 GeneID:27263 MGI:1351487
definition	codon_start : 1 product : sperm motility kinase 2 protein_id : XP_995124.1

name	Smok2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268410 GeneID:236574 MGI:3037705
definition	codon_start : 1 product : sperm motility kinase 2B protein_id : XP_995157.2

name	LOC100041352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268419 GeneID:100041352
definition	codon_start : 1 product : similar to t-complex protein 10c isoform 1 protein_id : XP_001477326.1

name	LOC100041352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268421 GeneID:100041352
definition	codon_start : 1 product : similar to t-complex protein 10c isoform 2 protein_id : XP_001477349.1

name	LOC100041352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268425 GeneID:100041352
definition	codon_start : 1 product : similar to t-complex protein 10c isoform 4 protein_id : XP_001477389.1

name	LOC100041352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268427 GeneID:100041352
definition	codon_start : 1 product : similar to t-complex protein 10c isoform 5 protein_id : XP_001477401.1

name	LOC100041352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268423 GeneID:100041352
definition	codon_start : 1 product : similar to t-complex protein 10c isoform 3 protein_id : XP_001477370.1

name	LOC667384 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268414 GeneID:667384
definition	codon_start : 1 product : similar to Smok4a protein protein_id : XP_001475924.1

name	Smok4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401600 GeneID:272667 MGI:3036233
definition	codon_start : 1 product : similar to Smok4a protein protein_id : XP_995382.1

name	Tcte2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114687623 GeneID:21646 MGI:98641
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : t-complex-associated testis expressed 2 protein_id : NP_071706.2

name	Mllt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401630 GeneID:17356 MGI:1314653
definition	codon_start : 1 product : myeloid/lymphoid or mixed lineage-leukemia translocation to 4 homolog isoform 1 protein_id : XP_895540.2

name	EG635895 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401632 GeneID:635895 MGI:3643198
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_977895.1

name	EG664821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268470 GeneID:664821 MGI:3646178
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_977970.2

name	EG664831 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268492 GeneID:664831 MGI:3643256
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_978062.2

name	4930488N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268494 GeneID:75011 MGI:1922261
definition	codon_start : 1 product : hypothetical protein LOC75011 protein_id : XP_619430.4

name	Dact2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982104 CCDS:CCDS28406.1 GeneID:240025 MGI:1920347
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : dapper 2 protein_id : NP_766414.2

name	Smoc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612493 GeneID:64074 MGI:1929881
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy product : secreted modular calcium-binding protein 2 protein_id : NP_071710.1

name	LOC625753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625753
definition	number : 1 pseudo : _no_value

name	LOC100041192 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268415 GeneID:100041192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 1 Protein product : similar to NADH dehydrogenase (ubiquinone) 1 beta subcomplex 3 pseudo : _no_value transcript_id : XR_033029.1

name	Air (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872146 GeneID:104103 MGI:1353471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : antisense Igf2r RNA transcript_id : NR_002853.1

name	EG635617 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94401589 GeneID:635617 MGI:3645097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG635617 pseudo : _no_value transcript_id : XR_002006.1

name	LOC667359 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268411 GeneID:667359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : similar to G protein-coupled receptor 31, D17Leh66c region pseudo : _no_value transcript_id : XR_032451.1

name	LOC667372 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268412 GeneID:667372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to UNC-93A protein pseudo : _no_value transcript_id : XR_032456.1

name	LOC100041464 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268487 GeneID:100041464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1021 ESTs, 8 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_033253.1

clone name	MSMg01-363B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532D12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-196F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461I15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482J10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110K03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-306M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-351J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-499L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307F21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-267E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370N19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-274P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484D06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260N15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-378N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531H11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-158D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046J06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-244M16.b	B6Ng01-244M16.g
ACC	GA053840	GA053841
length	1,112	1,169
definition	B6Ng01-244M16.b	B6Ng01-244M16.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctttgattaacttgccatagtttaaaaagttattatgcattcatg agaaaatcagtacaaacatgggtgcatgacagcttatcaaccttaatgta tataattgcatggggtgttacccttactgaaatttagaaactttctgctt atgtattatatacacaatgaagtttatgaaactaagttaatgttttctct ccttgggttttctttaggatattaggaagcagaagctgagttcaggcaca tggttattttaacaggaggacatttcatgcttttatatatgctaatacag atagaatcggttagataactggggtgatttgaacctgtagagattttaat ttccatttttttagacatagacttttatgtatattgtatttttatcttat ttcgttacaaataggatttatatatacatgtacatcctttccaactactc gttcacttaagaatttatagacagaaaatgataacaagtgactcagtttg tgacagatggcttaatctttagtaagcaccaggcctcatgataaagtgtg cagcagtttccttctggtctgcagctgaacatttaaacagttaaacattt gtctttataagaaggaccttggtttggttgtcccttcacaccaatgatcc caaactaagatgccatctgtttactgatcttagactttgaagaacatgga gactttgtcagagactctgagatctaataaacactgccagcaaagtagca agatgggaaaaaaatcatctatttatacacaaattaaaaaatcagaaacc aggcaggaggggtgcatgcctttaatcccagcactcagaggcagaagcag aggcagaggcaggtggatctctgtgagtttgaggccagcctggttctaca gggggggcagccaaggatacacagagaaaaaccatgtcttgaacactaaa cagaaaaacacagaagagaaaatcactagaaacgtcagaaaacattcctt taacatattatcaaaataaacctaagagcagcatgcccagaacagaagcc tctacagaaacactaagagaagaaatgaagaatacctagaatatgccaag accttctcatgc	gaattctcctctgaagaaacagactgggaggaagaagcagctcattatga gaaaaaagggtaccagccaggtaaagtgctagctaatcagttaaggaagc caaaagcggctggcgaaggccagtttgctgattggcctcagggcagtcgg cttcaaggtccgccctatgcggagcccccgccctgcgtagtgcgtcagca atgcgcagagaggcaatgcgcagagagatgcgcagagaggcagtgcgcag agaggcaatgcgcagagaggcagtgcgcagactcattcattcccagagag gaacaaaggaaaatacaacaggcatttccggtctttgaaggagccgaggg tgggcgtgtccacgctccggtagaatacttacaaattaaagagcttgccg agtcggtccgtaaatacggaaccaatgctaattttaccttggtgcagtta gacaggctcgccggcatggcactaactcctgctgactggcaaacggttgt aaaagccgctctccctagtatgggcaaatatatggaatggagagcgcttt ggcacgaagctgcacaagcgcaggcccgagcaaacgcagctgctttgact ccagagcagagagattggacttttgacttgttaacgggtcagggagctta ttctgctgatcagacaaactaccattggggagcttatgcccagatttctt ccacggctattagggcctggaaggcgctctctcgagcaggtgaaaccact gggcagttaacaaagataatccagggacctcaggaatccttctcagattt tgtggccagaatgacagaggcagcagagcgtatttttggagagtcagagc aagctgcgcctctgatagaacagctaatctatgagcaagccacaaaggga gtgccgagcggccatagcccccaagaaaagaacaaaggcttacaagactg gctcaggtctgtcgagagctgggggaccttctcacaatgcaggctagcgg ccgccatctccaatctcagaaccgctcatgagcagaattgatcagaggac atggtttactgccgaaaggcctggcattagaaagatggcagagctcgata acagaggaacctcaactttgccttaagtgtgcagtatccataagaagctg tacagggttcgcactctgg
quality values	Open. Hide. 58 33 22 34 58 58 58 58 58 58 34 23 47 38 62 62 62 62 62 62 39 30 62 62 62 62 62 47 62 62 56 50 41 28 30 38 51 47 62 62 59 62 62 62 62 62 59 59 62 62 62 62 59 62 49 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 38 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 52 62 62 54 62 62 62 62 54 62 62 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 52 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 49 58 58 58 58 58 58 58 46 58 58 54 58 54 58 54 54 54 58 58 58 58 58 54 54 58 58 37 49 58 58 51 58 58 52 58 54 58 53 58 54 50 58 58 58 49 58 45 43 58 58 58 58 52 58 58 54 52 51 50 58 47 58 58 48 50 50 58 58 58 51 58 58 58 50 50 51 51 52 58 50 51 50 54 58 58 54 50 50 58 58 49 52 50 51 58 50 58 52 50 58 38 25 58 51 41 41 58 49 58 40 47 41 53 51 58 42 52 58 58 40 51 53 39 53 42 47 44 29 49 53 51 41 41 51 58 51 28 58 51 52 41 50 53 40 53 40 51 50 50 21 53 53 49 54 37 54 41 38 42 52 54 52 45 53 33 27 38 34 51 42 49 54 49 42 53 53 31 47 49 32 32 49 51 54 51 33 30 29 44 54 47 52 34 42 42 32 54 25 37 32 53 47 37 52 54 29 33 28 40 41 41 37 42 33 54 51 41 40 40 42 51 47 54 34 39 37 32 52 34 28 45 45 32 53 31 28 32 33 29 34 49 53 53 52 49 51 52 53 53 39 40 32 45 43 45 35 35 53 52 32 52 31 52 24 41 35 46 30 45 43 35 51 51 51 51 31 31 34 31 24 51 51 25 26 43 31 31 25 30 15 6 19 31 31 51 51 45 31 38 31 25 31 43 31 27 28 46 35 21 23 32 31 48 30 32 32 43 32 36 42 34 8 7 33 21 24 21 29 32 35 34 26 31 20 15 46 13 30 31 29 23 41 12 27 31 24 27 26 25 33 29 14 30 27 34 38 35 30 26 24 31 21 37 41 25 21 31 18 29 13 31 19 25 32 29 25 27 31 10 6 9 20 21 30 28 32 44 41 35 44 36 33 19 31 30 21 28 7 31 13 24 14 13 22 31 16 17 13 21 26 9 31 44 44 44 28 15 17 16 33 36 33 31 21 26 31 12 16 6 29 12 29 18 37 14 22 16 6 24 43 36 39 17 14 20 23 29 12 17 18 21 48 11 19 43 24 23 22 25 10 23 32 21 21 26 37 12 34 28 33 24 16 16 31 34 37 23 23 17 6 10 27 27 11 47 21 8 11 13 11 3 4 25 11 19 16 7 16 40 38 13 27 11 15 6 3 7 7 9 6 29 23 17 17 17 16 22 20 27 27 10 18 14 8 5 19 15 7 6 12 14 18 4 8 7 11 14 16 8 12 12 4 3 26 13 12 8 15 6 15 18 9 20 4 9 8 6 25 17 14 14 9 16 17 8 16 10 4 4 6 10 21 16 6 23 25 8 4 6 10 6 5 25 14 5 12 8 4 4 1 3 4 9 12 7 20 5	Open. Hide. 62 38 37 44 62 62 62 62 62 56 59 34 28 24 28 25 29 46 46 59 59 62 59 62 62 59 62 62 59 59 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 59 59 50 51 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 49 58 58 58 54 58 58 58 54 58 58 58 58 58 54 54 58 58 58 54 54 58 58 58 58 58 54 58 58 58 54 58 54 45 52 58 58 58 58 58 54 58 58 58 52 58 52 51 58 58 58 54 47 58 58 58 58 58 51 54 46 39 58 54 58 49 49 40 40 53 52 58 46 42 58 58 58 58 40 51 51 58 52 58 58 49 39 28 58 37 58 58 52 36 22 46 50 58 40 49 40 53 53 49 58 58 58 50 58 58 51 41 29 32 54 53 36 25 46 58 31 51 53 39 58 35 36 41 39 32 50 58 52 49 25 49 53 58 52 52 50 32 52 52 58 31 50 32 52 52 49 58 58 39 41 50 19 58 58 39 25 41 54 41 49 49 41 49 49 51 35 49 51 47 37 53 41 37 51 38 39 54 54 52 42 39 41 38 32 51 52 53 49 54 54 39 30 42 36 39 37 35 47 35 54 51 34 31 33 52 54 53 52 43 40 32 47 24 37 32 54 27 51 42 52 37 40 32 54 39 28 31 32 37 41 39 40 30 49 18 47 53 53 53 53 52 53 53 37 32 28 40 32 27 36 30 41 42 53 32 32 24 28 53 35 42 49 49 40 43 40 32 52 35 26 24 19 51 42 36 34 25 31 36 42 35 32 31 42 51 46 26 31 34 31 32 29 24 24 42 25 26 35 42 25 43 35 30 25 35 23 29 18 48 46 46 42 32 34 31 31 30 30 35 42 9 12 31 21 27 31 27 27 7 35 32 31 14 23 18 12 46 13 30 31 31 22 34 48 48 41 31 21 39 28 20 36 30 26 32 24 30 38 11 31 23 27 30 32 31 26 31 18 21 25 29 31 25 22 32 28 24 26 31 16 19 27 29 37 37 30 22 34 31 32 31 31 29 34 19 21 7 36 25 26 30 17 16 22 36 38 19 48 9 21 11 33 31 16 30 30 35 22 19 13 20 24 21 21 32 20 6 16 36 39 25 16 12 5 7 20 43 39 18 21 23 26 15 14 31 6 4 8 6 10 21 32 32 11 21 32 33 25 28 30 16 25 21 27 6 4 11 13 25 27 28 17 26 22 32 27 22 13 15 22 10 34 34 34 27 27 12 9 20 7 6 14 18 12 17 3 7 20 21 14 14 18 11 7 30 8 7 21 12 25 7 21 15 5 20 18 26 21 17 26 21 10 9 7 14 13 10 7 9 30 25 11 19 24 15 18 27 15 6 6 12 5 6 11 8 24 25 5 9 15 23 21 16 9 9 25 13 10 8 7 16 6 6 6 6 17 11 7 1 3 13 5 6 18 16 28 20 6 6 18 9 12 16 15 5 4 4 3 3 3 11 20 8 4 7 6 5 13 9 3 3 6 4 4 11 6 2 5 8 18 4 10 2 5 2 2 17 8 13 7 6 7 4 6 4 6 4 4 14 8 5 4 12 4 3 2 5 6 4 4 16 3 5 3 2 2 7 6 6 3 6 8 6 6 7 16 4 9 7 6 4 4 8 7 6 13 4 6 6 6 8 16 4 6 12 8 10 8 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_13510286_13511411
seq2: B6Ng01-244M16.b_47_1158

seq1  GAATTCTTTGATTAACTTGCCATAGTTTAAAAAGTTATTATGCATTCATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTGATTAACTTGCCATAGTTTAAAAAGTTATTATGCATTCATG  50

seq1  AGAAAATCAGTACAAACATGGGTGCATGACAGCTTATCAACCTTAATGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAATCAGTACAAACATGGGTGCATGACAGCTTATCAACCTTAATGTA  100

seq1  TATAATTGCATGGGGTGTTACCCTTACTGAAATTTAGAAACTTTCTGCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAATTGCATGGGGTGTTACCCTTACTGAAATTTAGAAACTTTCTGCTT  150

seq1  ATGTATTATATACACAATGAAGTTTATGAAACTAAGTTAATGTTTTCTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTATTATATACACAATGAAGTTTATGAAACTAAGTTAATGTTTTCTCT  200

seq1  CCTTGGGTTTTCTTTAGGATATTAGGAAGCAGAAGCTGAGTTCAGGCACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGGGTTTTCTTTAGGATATTAGGAAGCAGAAGCTGAGTTCAGGCACA  250

seq1  TGGTTATTTTAACAGGAGGACATTTCATGCTTTTATATATGCTAATACAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTATTTTAACAGGAGGACATTTCATGCTTTTATATATGCTAATACAG  300

seq1  ATAGAATCGGTTAGATAACTGGGGTGATTTGAACCTGTAGAGATTTTAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGAATCGGTTAGATAACTGGGGTGATTTGAACCTGTAGAGATTTTAAT  350

seq1  TTCCATTTTTTTAGACATAGACTTTTATGTATATTGTATTTTTATCTTAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCATTTTTTTAGACATAGACTTTTATGTATATTGTATTTTTATCTTAT  400

seq1  TTCGTTACAAATAGGATTTATATATACATGTACATCCTTTCCAACTACTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGTTACAAATAGGATTTATATATACATGTACATCCTTTCCAACTACTC  450

seq1  GTTCACTTAAGAATTTATAGACAGAAAATGATAACAAGTGACTCAGTTTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCACTTAAGAATTTATAGACAGAAAATGATAACAAGTGACTCAGTTTG  500

seq1  TGACAGATGGCTTAATCTTTAGTAAGCACCAGGCCTCATGATAAAGTGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAGATGGCTTAATCTTTAGTAAGCACCAGGCCTCATGATAAAGTGTG  550

seq1  CAGCAGTTTCCTTCTGGTCTGCAGCTGAACATTTAAACAGTTAAACATTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAGTTTCCTTCTGGTCTGCAGCTGAACATTTAAACAGTTAAACATTT  600

seq1  GTCTTTATAAGAAGGACCTTGGTTTGGTTGTCCCTTCACACCAATGATCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTTATAAGAAGGACCTTGGTTTGGTTGTCCCTTCACACCAATGATCC  650

seq1  CAAACTAAGATGCCATCTGTTTACTGATCTTAGACTTTGAAGAACATGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACTAAGATGCCATCTGTTTACTGATCTTAGACTTTGAAGAACATGGA  700

seq1  GACTTTGTCAGAGACTCTGAGATCTAATAAACACTGCCAGCAAAGTAGCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTTTGTCAGAGACTCTGAGATCTAATAAACACTGCCAGCAAAGTAGCA  750

seq1  AGATGGGAAAAAAATCATCTATTTATACACAAATTAAAAAATCAGAAACC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGGGAAAAAAATCATCTATTTATACACAAATTAAAAAATCAGAAACC  800

seq1  AGGCAGGAGGGGTGCATGCCTTTAATCCCAGCACTCAGGAGGCAGAAGCA  850
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  AGGCAGGAGGGGTGCATGCCTTTAATCCCAGCACTCA-GAGGCAGAAGCA  849

seq1  GAGGCAGAGGCAGGTGGATCTCTGTGAGTTTGAGGCCAGCCTGG-TCTAC  899
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  GAGGCAGAGGCAGGTGGATCTCTGTGAGTTTGAGGCCAGCCTGGTTCTAC  899

seq1  AGGGGGGGCAGCCAAGGATACACAGAGAAAAACCATGTCTTGAACAACTA  949
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  AGGGGGGGCAGCCAAGGATACACAGAGAAAAACCATGTCTTGAAC-ACTA  948

seq1  AACAAGAAAAACAACAAGAAGAAGAAAATCACTAGAAACGTCAGAAAAAC  999
      ||| |||||||||   ||||| ||||||||||||||||||||||||||  
seq2  AAC-AGAAAAACA--CAGAAG-AGAAAATCACTAGAAACGTCAGAAAA--  992

seq1  AATCCCTTTAACAATATTATCAAAATAAAACCTAGGAGCAAGCATGCCCA  1049
       || |||||||| ||||||||||||| ||||||| |||| ||||||||| 
seq2  CATTCCTTTAAC-ATATTATCAAAAT-AAACCTAAGAGC-AGCATGCCC-  1038

seq1  AGAACCAGAAAGCCTCTACAAGGAAAACACTAAGAAGAGAAAATGAAG-A  1098
      |||| ||| |||||||||||    |||||||||| |||  |||||||| |
seq2  AGAA-CAG-AAGCCTCTACA---GAAACACTAAG-AGAAGAAATGAAGAA  1082

seq1  TA-CTAGAATATGCAAAGACC-TCTCATGC  1126
      || ||||||||||| |||||| ||||||||
seq2  TACCTAGAATATGCCAAGACCTTCTCATGC  1112

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information