MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-277I11
Chromosome	17 (Build37)
Map Location	18,221,153 - 18,222,277
singlet/doublet	singlet
Overlap gene	none
Upstream gene	BC018101, Zfp97, EG382161, LOC676238, EG626854, LOC100041965, Riok2, Lix1, LOC383297, Lnpep, EG665140, LOC100041519, EG626942, 4930546H06Rik, Has1, Fpr1, Fpr-rs2, LOC665183, LOC670250, EG665187, LOC546683, Fprl1, LOC627060, Fpr-rs4, EG637021
Downstream gene	EG665210, Vmn2r92, EG665227, EG627132, LOC100041612, Vmn2r95, Vmn2r-ps114, EG433070, Vmn2r-ps115, Vmn2r-ps117, LOC100042183, EG627367, EG224552
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC018101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:449000 MGI:3052731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22759 MGI:105921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG382161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382161 MGI:3646034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	LOC676238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG626854 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626854 MGI:3645888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041965 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 1484 ESTs, 6 Proteins pseudo : _no_value

name	Riok2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67045 MGI:1914295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lix1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66643 MGI:1913893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383297 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Lnpep (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240028 MGI:2387123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665140 MGI:3643010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG626942 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626942 MGI:3645076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins

name	4930546H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75202 MGI:1922452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Has1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15116 MGI:106590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fpr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14293 MGI:107443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fpr-rs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14289 MGI:1278319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665183 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC670250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG665187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665187 MGI:3644434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 148 ESTs, 6 Proteins pseudo : _no_value

name	LOC546683 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Fprl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14294 MGI:1194495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627060 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Fpr-rs4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14291 MGI:1278317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 Proteins

name	EG637021 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637021 MGI:3643332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	EG665210 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665210 MGI:3645072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Vmn2r92 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG665227 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665227 MGI:3648050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG627132 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627132 MGI:3645591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	LOC100041612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Vmn2r95 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	Vmn2r-ps114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG433070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433070 MGI:3644514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Vmn2r-ps115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100042183 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs

name	EG627367 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627367 MGI:3645271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 16 Proteins

name	EG224552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224552 MGI:3647977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	BC018101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52851394 GeneID:449000 MGI:3052731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC018101 transcript_id : NM_001005358.1

name	Zfp97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815835 GeneID:22759 MGI:105921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 97 transcript_id : NM_011765.4

name	EG382161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268488 GeneID:382161 MGI:3646034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : predicted gene, EG382161, transcript variant 1 transcript_id : XM_356261.6

name	EG626854 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268457 GeneID:626854 MGI:3645888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG626854 transcript_id : XM_001471565.1

name	Riok2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385427 GeneID:67045 MGI:1914295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIO kinase 2 (yeast) transcript_id : NM_025934.1

name	Lix1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403301 GeneID:66643 MGI:1913893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : limb expression 1 homolog (chicken) transcript_id : NM_025681.2

name	Lnpep (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802386 GeneID:240028 MGI:2387123
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucyl/cystinyl aminopeptidase transcript_id : NM_172827.2

name	EG626942 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268496 GeneID:626942 MGI:3645076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins product : predicted gene, EG626942 transcript_id : XM_891564.2

name	4930546H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802652 GeneID:75202 MGI:1922452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930546H06 gene transcript_id : NM_029205.2

name	Has1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680168 GeneID:15116 MGI:106590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronan synthase1 transcript_id : NM_008215.1

name	Fpr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71361679 GeneID:14293 MGI:107443
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formyl peptide receptor 1 transcript_id : NM_013521.2

name	Fpr-rs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50345973 GeneID:14289 MGI:1278319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formyl peptide receptor, related sequence 2 transcript_id : NM_008039.2

name	LOC670250 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268571 GeneID:670250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to mitochondrial ribosomal protein L41 transcript_id : XM_001478218.1

name	Fprl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358929 GeneID:14294 MGI:1194495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formyl peptide receptor-like 1 transcript_id : NM_008042.2

name	EG637021 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268498 GeneID:637021 MGI:3643332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG637021 transcript_id : XM_975323.2

name	EG665210 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268502 GeneID:665210 MGI:3645072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG665210 transcript_id : XM_975359.2

name	Vmn2r92 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268508 GeneID:627111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : vomeronasal receptor Vmn2r92 transcript_id : XM_001476639.1

name	EG665227 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268510 GeneID:665227 MGI:3648050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG665227 transcript_id : XM_975475.2

name	EG627132 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268512 GeneID:627132 MGI:3645591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG627132 transcript_id : XM_891791.3

name	LOC100041612 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268514 GeneID:100041612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to pol protein transcript_id : XM_001476688.1

name	Vmn2r95 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268518 GeneID:328759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : vomeronasal receptor Vmn2r95 transcript_id : XM_001476711.1

name	EG433070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268524 GeneID:433070 MGI:3644514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG433070 transcript_id : XM_484597.5

name	LOC100042183 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268580 GeneID:100042183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs product : hypothetical protein LOC100042183 transcript_id : XM_001478279.1

name	EG627367 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268529 GeneID:627367 MGI:3645271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 16 Proteins product : predicted gene, EG627367 transcript_id : XM_892023.3

name	EG224552 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268531 GeneID:224552 MGI:3647977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG224552 transcript_id : XM_139768.6

name	BC018101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52851395 GeneID:449000 MGI:3052731
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC449000 protein_id : NP_001005358.1

name	Zfp97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815836 GeneID:22759 MGI:105921
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 97 protein_id : NP_035895.2

name	EG382161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268489 GeneID:382161 MGI:3646034
definition	codon_start : 1 product : similar to CDNA sequence BC018101 isoform 1 protein_id : XP_356261.6

name	EG626854 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268458 GeneID:626854 MGI:3645888
definition	codon_start : 1 product : similar to zinc finger protein 709 protein_id : XP_001471615.1

name	Riok2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385428 CCDS:CCDS28417.1 GeneID:67045 MGI:1914295
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : RIO kinase 2 protein_id : NP_080210.1

name	Lix1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118403302 GeneID:66643 MGI:1913893
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : limb expression 1 protein_id : NP_079957.2

name	Lnpep (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370240 GeneID:240028 MGI:2387123
definition	GO_component : GO:0005624 - membrane fraction [Evidence IMP]; GO:0005792 - microsome [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030163 - protein catabolism [Evidence IMP] codon_start : 1 product : leucyl/cystinyl aminopeptidase protein_id : NP_766415.1

name	EG626942 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268497 GeneID:626942 MGI:3645076
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_896657.2

name	4930546H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037403 GeneID:75202 MGI:1922452
definition	codon_start : 1 product : hypothetical protein LOC75202 protein_id : NP_083481.1

name	Has1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680169 GeneID:15116 MGI:106590
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050501 - hyaluronan synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : hyaluronan synthase1 protein_id : NP_032241.1

name	Fpr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305065 CCDS:CCDS28418.1 GeneID:14293 MGI:107443
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004982 - N-formyl peptide receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : lipoxin A4 receptor product : formyl peptide receptor 1 protein_id : NP_038549.1

name	Fpr-rs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679853 CCDS:CCDS28419.1 GeneID:14289 MGI:1278319
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004943 - C3a anaphylatoxin receptor activity [Evidence IEA]; GO:0004982 - N-formyl peptide receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : lipoxin A4 receptor-like protein product : formyl peptide receptor, related sequence 2 protein_id : NP_032065.1

name	LOC670250 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268572 GeneID:670250
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478268.1

name	Fprl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358930 CCDS:CCDS28420.1 GeneID:14294 MGI:1194495
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004943 - C3a anaphylatoxin receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004982 - N-formyl peptide receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : formyl peptide receptor-like 1 protein_id : NP_032068.2

name	EG637021 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268499 GeneID:637021 MGI:3643332
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_980417.2

name	EG665210 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268503 GeneID:665210 MGI:3645072
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_980453.2

name	Vmn2r92 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268509 GeneID:627111
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001476689.1

name	EG665227 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268511 GeneID:665227 MGI:3648050
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_980569.2

name	EG627132 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268513 GeneID:627132 MGI:3645591
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_896884.3

name	LOC100041612 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268515 GeneID:100041612
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001476738.1

name	Vmn2r95 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268519 GeneID:328759
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001476761.1

name	EG433070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268525 GeneID:433070 MGI:3644514
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_484597.5

name	LOC100042183 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268581 GeneID:100042183
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478329.1

name	EG627367 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268530 GeneID:627367 MGI:3645271
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897116.3

name	EG224552 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268532 GeneID:224552 MGI:3647977
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_139768.6

name	LOC676238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676238
definition	number : 1 pseudo : _no_value

name	LOC676238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676238
definition	number : 2 pseudo : _no_value

name	LOC676238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676238
definition	number : 3 pseudo : _no_value

name	LOC676238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676238
definition	number : 4 pseudo : _no_value

name	LOC676238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676238
definition	number : 5 pseudo : _no_value

name	LOC676238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676238
definition	number : 6 pseudo : _no_value

name	LOC676238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676238
definition	number : 7 pseudo : _no_value

name	LOC383297 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383297
definition	number : 1 pseudo : _no_value

name	EG665140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665140
definition	number : 1 pseudo : _no_value

name	EG665140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665140
definition	number : 2 pseudo : _no_value

name	LOC100041519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041519
definition	number : 4 pseudo : _no_value

name	LOC100041519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041519
definition	number : 3 pseudo : _no_value

name	LOC100041519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041519
definition	number : 2 pseudo : _no_value

name	LOC100041519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041519
definition	number : 1 pseudo : _no_value

name	LOC665183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665183
definition	number : 2 pseudo : _no_value

name	LOC665183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665183
definition	number : 1 pseudo : _no_value

name	LOC546683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546683
definition	number : 1 pseudo : _no_value

name	LOC627060 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627060
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps114 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041645
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps114 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041645
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 7 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 8 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 7 pseudo : _no_value

name	LOC100041965 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268563 GeneID:100041965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 1484 ESTs, 6 Proteins product : similar to ornithine decarboxylase antizyme pseudo : _no_value transcript_id : XR_033561.1

name	EG665187 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268568 GeneID:665187 MGI:3644434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 148 ESTs, 6 Proteins product : predicted gene, EG665187 pseudo : _no_value transcript_id : XR_001702.2

name	Fpr-rs4 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268573 GeneID:14291 MGI:1278317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 Proteins product : formyl peptide receptor, related sequence 4 transcript_id : XR_035345.1

clone name	MSMg01-143F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-234O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494F06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-072H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-198A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-515F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-417A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-449I17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-306J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-277L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356J01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145F02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-271I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-385P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049G13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-327B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080G16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-311J01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-187B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-217N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093A08
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-316J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226G22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-277I11.b	B6Ng01-277I11.g
ACC	GA078023	GA078024
length	1,163	1,126
definition	B6Ng01-277I11.b	B6Ng01-277I11.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctttgtttagctctgtgcccaatttttccatgaggttattagatt ttctggagtccatcttcttgagttctttatatatattggagattagtccc ctatctgatttatgattggtaaagatcctttcccaatctgttggtggcct ttttgtgttatggacagtgtcttttgccttacagaagctttgtaatttta tgaggtcccatttgtcaattcttgatcttacagcacaagtcatttccatt ctgtttaggaatttttccgctgtgtccatatctttgaagcttttctccac tttttcctctagaattttcagtgtctctggttttatgtggagtcccttga tccatttagacctaagtacaaggagataaggatggatcaattccagttct tctacattataaccgccagttctgcaaagcaccatttcttgaaaatgctg tcttttctccactggatggttttagctcccttgtcaaagatcaagtcacc atatatatgtaggttcatttctggatattcaattctattctattcttcga cctgtctgtcactataccagtaccatgcagtttttatcacaatttctctg tagtacagctttaggtcaggcatggagatttcaccagagattcttttatc attgagaagagtttttgctatcttaggttttttgttattccagatgaatt tgcaaatttccctttctaattcattgtgagttggaattttgatggggatt gcattgtatctgtagattgctttcagcaagatagccattttcactatatt gatcctggcaatccatgagcatgggagatctttccatcttctgagatctt tgatttctttcttcaaacacttgaagttcttatcatacagatctttcact tccttagttagagtcacaccaagctatttacattatttgtgactactgtg aaggttgtgtttccctaatttcctttctcagctgtttatcctttgtgtta gagaaaggccatttgaattgtggagttatttatattccactactgctagg tttgagtgtcctgtcgaattttagggtcacttattatactatcatacatc ggcaagtaaaattgactaatcctcatgtatccttgacccttgtttgaagg ctctggctacgac	gaattctgaactaaaaatataaataattttacttactgtatgtaattatc caaatattgatatggtacagctgaatttggcattttcttcccagtgtaga aagtatgaagagggaaaaatgcaccaatcagaacatctccttcatgatga aattcttcagtaattatgtaataacatctactgatattaaacataatagc agagaaaaattttggaacttgcaagagccagaagattaaaatccaggagg acatcatattattacatggatctgcttgatgcagaaaaaactgtgtccag tacatgtatgcttggttcttatttttgtgaccatgatttgtatttgttga tgactcagtctgtcacactaattattccaagggattgagaatccaattgg gaattttaaaactatccttcccatggactctgcttctgaagccctctatt caagtgaaaaacaagttaggaaatatgtttcttcatattcttcactaccc aaaggccctatgacttcagcaaagactacaaacagcaagagctcaagttt gatcttctcttgggatgaattggctaaccatgtgaaacaagaaactttta atatgaaaaacaatttaggctgatgtaaccctacaggttacatcagagga ggcaaactaagtggaaaaggaaaaggctaaaaagaaagcactgaaggact gaccactcaaaatttatatattgcagcgctttagttggcaattaacaagt gtgagttataggaaacaactaccaatcaagtttatacaatatacattaga gtacattataccaacatttcctgcttttattccaagaaagagactttatt tctaatatctgtaagctttatacaataagaacacttaagagaattttcag ggtaaggattgttattacaatgtctagttcatttgtatttacaactttta ataaattacttctattctatcttatttagtccaaagttctctaaaggttt atgccaaaaaagcacaagaagaagtgcatttaaatgatactttaaaagac aacctaaggaaatgtttggttggggtttgtgacctaaagaataaaattat cagaccgttggctaagttatgtaagc
quality values	Open. Hide. 41 22 19 22 58 58 54 58 58 62 62 46 36 42 54 62 62 62 62 62 62 62 62 62 42 39 62 62 62 62 62 51 51 39 14 41 43 29 35 62 59 59 59 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 54 54 47 62 62 62 62 62 49 47 62 62 43 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 52 62 62 54 62 47 51 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 46 47 42 62 62 62 62 62 62 54 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 54 58 58 58 58 52 54 42 58 54 54 58 58 58 58 54 58 53 58 54 58 58 54 58 58 58 58 54 54 58 46 58 58 58 58 58 58 58 54 54 52 48 54 48 58 54 58 41 25 54 58 54 51 54 52 58 58 58 52 54 58 58 58 58 58 53 49 47 40 47 36 58 58 58 58 51 58 58 54 58 52 52 40 42 53 53 54 52 58 58 58 58 53 40 58 52 53 52 41 58 35 53 52 54 58 34 37 39 39 58 58 47 40 28 43 37 46 58 37 38 25 58 51 51 58 58 48 46 41 47 39 41 58 50 54 40 58 58 32 58 37 36 58 58 58 58 39 47 49 50 39 51 50 38 51 29 54 37 58 58 58 58 40 44 36 50 50 42 52 50 50 25 39 54 32 49 58 40 50 58 51 41 52 47 54 51 45 54 50 40 42 42 41 54 53 45 45 52 38 42 53 39 34 53 41 51 53 47 54 32 51 51 51 40 49 33 41 33 36 47 32 43 39 54 54 54 53 33 25 46 47 38 37 42 39 49 37 37 40 52 45 52 31 35 36 34 32 39 47 28 32 52 31 40 31 34 53 37 35 42 34 26 41 32 31 25 27 40 51 51 45 35 26 31 33 34 35 31 32 31 45 31 31 27 30 31 46 38 32 31 25 32 31 30 28 31 43 46 26 32 25 31 31 48 43 38 26 19 18 38 31 47 33 23 35 29 31 37 24 48 31 30 31 39 24 28 31 37 35 47 32 29 32 29 47 35 30 31 48 39 37 37 38 35 30 46 37 20 16 13 23 27 38 30 30 31 31 24 19 20 25 31 25 31 28 35 31 27 20 18 25 25 33 26 44 26 33 16 15 26 29 13 25 15 25 29 23 25 19 32 24 28 24 31 32 16 14 11 13 24 8 21 29 22 31 19 24 43 33 32 32 24 30 11 27 22 43 28 14 19 19 28 24 27 18 20 14 23 12 17 13 5 5 22 5 5 8 8 5 6 21 11 18 28 24 14 10 14 9 26 12 8 10 28 40 16 28 20 27 27 4 3 3 15 5 30 9 5 6 11 15 21 32 6 10 7 12 4 5 9 7 22 10 14 27 11 13 11 9 18 5 9 12 7 7 5 10 23 23 8 5 7 7 19 5 8 9 4 3 20 17 4 5 21 9 6 13 3 7 11 8 12 16 6 8 4 5 7 6 16 18 20 11 13 2 1 2 4 4 4 4 5 8 3 3 3 20 20 6 27 22 15 8 17 28 15 7 7 5 9 5 13 9 4 4 3 5 3 3 4 5 6 13 10 8 5 9 3 2 3 3 9 1 3 3 3 1 2 6 6 11 4 4 6 10 6 16 5 5 9 13 2 3 5 2 2 2 5 15 4 5 4 4 5 6 8 5 3 12 17 8 4 4 1 2 1 3 2 4 7 1 3 6 4 16 4 4 4 2 3 10 6 4	Open. Hide. 62 47 51 39 62 62 62 62 54 62 51 32 24 22 24 24 27 43 51 56 62 62 62 49 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 59 54 33 54 56 59 59 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 54 62 28 18 22 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 51 58 58 54 58 58 58 58 58 58 58 58 52 58 54 58 58 58 58 58 58 52 58 58 54 52 58 58 52 58 58 58 58 52 58 58 58 54 58 58 54 48 58 58 58 42 58 58 58 58 58 50 51 49 51 51 58 50 58 58 58 54 58 58 52 58 58 58 49 58 58 51 53 58 58 58 58 58 58 58 51 58 51 58 51 53 53 58 58 58 58 58 48 24 58 58 48 37 58 58 41 46 46 50 51 50 58 48 58 58 58 58 58 58 54 50 37 58 54 54 42 37 37 44 48 58 41 50 48 50 53 49 54 58 58 58 58 50 50 52 50 51 58 52 50 21 46 41 52 58 51 39 54 52 50 50 50 58 58 46 52 53 34 39 58 50 50 32 53 35 49 53 40 39 49 17 54 49 17 54 32 49 35 39 47 53 52 49 42 53 49 54 46 54 54 51 40 54 53 54 54 49 32 54 24 50 54 54 54 54 51 32 51 54 51 39 39 30 37 51 41 36 52 15 46 41 31 41 54 41 31 52 37 51 53 53 31 54 54 53 37 54 52 38 45 41 47 37 49 39 53 33 28 37 51 45 41 51 51 42 39 28 45 52 46 53 35 32 33 45 39 25 45 47 21 33 40 42 53 31 31 38 26 42 35 31 31 42 32 31 42 49 34 32 29 36 31 34 29 43 38 33 31 33 36 31 33 31 42 51 43 31 30 31 37 14 37 31 39 31 30 45 25 32 51 39 35 51 35 31 34 33 26 30 31 30 31 31 30 22 18 42 41 28 31 46 36 27 30 31 42 31 46 46 48 31 31 29 27 31 27 22 27 31 41 46 31 36 43 25 30 29 31 47 32 30 29 46 30 29 32 21 32 31 30 30 18 31 36 31 37 33 26 30 36 48 41 31 27 32 32 21 25 32 33 36 35 35 25 28 23 23 11 28 22 29 23 34 13 29 21 26 48 48 31 28 9 18 32 24 25 24 14 23 17 36 21 14 41 14 11 30 19 23 31 31 16 22 18 36 21 31 16 24 23 25 16 31 33 21 47 31 37 28 34 34 48 30 14 17 24 24 28 33 43 43 26 29 16 18 30 34 23 30 19 17 32 32 32 24 20 19 13 10 32 24 27 23 20 14 10 30 19 48 30 25 21 33 21 26 18 36 26 13 28 31 19 14 11 8 17 28 11 20 13 17 34 20 6 11 17 7 21 15 40 47 40 21 20 11 26 15 27 13 11 5 3 10 10 9 9 4 4 6 12 19 27 40 18 13 30 9 11 13 18 19 17 27 13 32 7 20 21 12 12 13 15 11 8 13 13 18 8 5 12 15 10 18 26 16 10 13 9 25 13 4 4 3 4 6 28 30 17 2 15 12 9 4 5 6 8 11 20 16 19 7 4 8 15 7 11 30 28 15 18 5 6 10 10 6 9 24 5 10 6 4 5 7 6 5 5 15 6 4 6 7 16 4 4 3 2 9 5 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_18221153_18222277
seq2: B6Ng01-277I11.g_68_1193 (reverse)

seq1  GCTTAACATTACTTAG-CAACGTTCTGATAATTTTA-TCTT--AGTCACA  46
      |||| |||| |||||| ||||| ||||||||||||| ||||   ||||||
seq2  GCTT-ACATAACTTAGCCAACGGTCTGATAATTTTATTCTTTAGGTCACA  49

seq1  AACCCCAAACCAAACATTTCCTTAGGTTGTCTTTT-AAGTATCAATTTAA  95
      |||||| |||||||||||||||||||||||||||| ||||||| ||||||
seq2  AACCCC-AACCAAACATTTCCTTAGGTTGTCTTTTAAAGTATC-ATTTAA  97

seq1  ATGCACTCTTCCTTGTGCTTTTTTGGCATAAAACCTTTAGAGAACTTTGG  145
      |||||||  | |||||||||||||||||| ||||||||||||||||||||
seq2  ATGCACTTCTTCTTGTGCTTTTTTGGCAT-AAACCTTTAGAGAACTTTGG  146

seq1  ACTAAATAAGATAGAATAGAAGTAATTTATTAAAAGTTGTAAATACAAAT  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAAATAAGATAGAATAGAAGTAATTTATTAAAAGTTGTAAATACAAAT  196

seq1  GAACTAGACATTGTAATAACAATCCTTACCCTGAAAATTCTCTTAAGTGT  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTAGACATTGTAATAACAATCCTTACCCTGAAAATTCTCTTAAGTGT  246

seq1  TCTTATTGTATAAAGCTTACAGATATTAGAAATAAAGTCTCTTTCTTGGA  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATTGTATAAAGCTTACAGATATTAGAAATAAAGTCTCTTTCTTGGA  296

seq1  ATAAAAGCAGGAAATGTTGGTATAATGTACTCTAATGTATATTGTATAAA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAGCAGGAAATGTTGGTATAATGTACTCTAATGTATATTGTATAAA  346

seq1  CTTGATTGGTAGTTGTTTCCTATAACTCACACTTGTTAATTGCCAACTAA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGATTGGTAGTTGTTTCCTATAACTCACACTTGTTAATTGCCAACTAA  396

seq1  AGCGCTGCAATATATAAATTTTGAGTGGTCAGTCCTTCAGTGCTTTCTTT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGCTGCAATATATAAATTTTGAGTGGTCAGTCCTTCAGTGCTTTCTTT  446

seq1  TTAGCCTTTTCCTTTTCCACTTAGTTTGCCTCCTCTGATGTAACCTGTAG  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCCTTTTCCTTTTCCACTTAGTTTGCCTCCTCTGATGTAACCTGTAG  496

seq1  GGTTACATCAGCCTAAATTGTTTTTCATATTAAAAGTTTCTTGTTTCACA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTACATCAGCCTAAATTGTTTTTCATATTAAAAGTTTCTTGTTTCACA  546

seq1  TGGTTAGCCAATTCATCCCAAGAGAAGATCAAACTTGAGCTCTTGCTGTT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTAGCCAATTCATCCCAAGAGAAGATCAAACTTGAGCTCTTGCTGTT  596

seq1  TGTAGTCTTTGCTGAAGTCATAGGGCCTTTGGGTAGTGAAGAATATGAAG  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAGTCTTTGCTGAAGTCATAGGGCCTTTGGGTAGTGAAGAATATGAAG  646

seq1  AAACATATTTCCTAACTTGTTTTTCACTTGAATAGAGGGCTTCAGAAGCA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACATATTTCCTAACTTGTTTTTCACTTGAATAGAGGGCTTCAGAAGCA  696

seq1  GAGTCCATGGGAAGGATAGTTTTAAAATTCCCAATTGGATTCTCAATCCC  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCCATGGGAAGGATAGTTTTAAAATTCCCAATTGGATTCTCAATCCC  746

seq1  TTGGAATAATTAGTGTGACAGACTGAGTCATCAACAAATACAAATCATGG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGAATAATTAGTGTGACAGACTGAGTCATCAACAAATACAAATCATGG  796

seq1  TCACAAAAATAAGAACCAAGCATACATGTACTGGACACAGTTTTTTCTGC  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAAAAATAAGAACCAAGCATACATGTACTGGACACAGTTTTTTCTGC  846

seq1  ATCAAGCAGATCCATGTAATAATATGATGTCCTCCTGGATTTTAATCTTC  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGCAGATCCATGTAATAATATGATGTCCTCCTGGATTTTAATCTTC  896

seq1  TGGCTCTTGCAAGTTCCAAAATTTTTCTCTGCTATTATGTTTAATATCAG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTCTTGCAAGTTCCAAAATTTTTCTCTGCTATTATGTTTAATATCAG  946

seq1  TAGATGTTATTACATAATTACTGAAGAATTTCATCATGAAGGAGATGTTC  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATGTTATTACATAATTACTGAAGAATTTCATCATGAAGGAGATGTTC  996

seq1  TGATTGGTGCATTTTTCCCTCTTCATACTTTCTACACTGGGAAGAAAATG  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGGTGCATTTTTCCCTCTTCATACTTTCTACACTGGGAAGAAAATG  1046

seq1  CCAAATTCAGCTGTACCATATCAATATTTGGATAATTACATACAGTAAGT  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAATTCAGCTGTACCATATCAATATTTGGATAATTACATACAGTAAGT  1096

seq1  AAAATTATTTATATTTTTAGTTCAGAATTC  1125
      ||||||||||||||||||||||||||||||
seq2  AAAATTATTTATATTTTTAGTTCAGAATTC  1126

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information