MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-284H15
Chromosome	17 (Build37)
Map Location	23,264,615 - 23,265,285
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG210853, LOC671007, EG240038, EG631624, 6330416L07Rik, Zfp758, 1300003B13Rik, EG210876, LOC100042656, EG628185, ENSMUSG00000046088, EG383218, EG433078, LOC100042679, A630033E08Rik, LOC671128, LOC665961, EG434701, LOC665976, LOC100042225
Downstream gene	LOC100042234, EG665988, LOC100042248, Zfp40, LOC100042257, LOC100042261, Vmn2r-ps133, EG666002, EG638102, EG619697, EG619775, EG619788, Olfr752-ps1, EG666030, EG381070, Zfp213, Zfp13, Zscan10, LOC666062, Mmp25, LOC665757, BC038613, Thoc6, Hcfc1r1, Tnfrsf12a, Cldn6, Cldn9, EG666080, 1520401A03Rik, Pkmyt1, Paqr4, Kremen2, 9530082P21Rik, Flywch1, 2810417J12Rik, LOC100042865, Srrm2, Tceb2, Prss33, 4931440B09Rik, Prss32, Prss21, Dcpp1, LOC666157, Dcpp2, LOC620233, Dcpp3, Sbp, Sbpl, Tmprss8, Prss22, LOC100042414, LOC383225, Prss27, Kctd5, Pdpk1
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG210853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210853 MGI:3646759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 110 ESTs, 3 Proteins pseudo : _no_value

name	EG240038 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240038 MGI:3643318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 1 Protein

name	EG631624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631624 MGI:3648314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein

name	6330416L07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319615 MGI:2442394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224598 MGI:2385044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300003B13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74149 MGI:1921399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG210876 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210876 MGI:3647034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 Proteins

name	LOC100042656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG628185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628185 MGI:3644292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 Proteins

name	ENSMUSG00000046088 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194612 MGI:3642566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG383218 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	EG433078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433078 MGI:3644511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	A630033E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240041 MGI:2445132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins pseudo : _no_value

name	LOC665961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG434701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434701 MGI:3648972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	LOC665976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins pseudo : _no_value

name	LOC100042225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	LOC100042234 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG665988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665988 MGI:3644410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100042248 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zfp40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22700 MGI:99185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638056
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	EG666002 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666002 MGI:3648252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	EG638102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638102 MGI:3647235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG619697 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619697 MGI:3646674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	EG619775 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619775 MGI:3648606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG619788 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619788 MGI:3648766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Olfr752-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257878 MGI:3030586
definition	gene_synonym : MOR220-4P note : olfactory receptor 752, pseudogene 1 pseudo : _no_value

name	EG666030 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666030 MGI:3645045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 8 Proteins pseudo : _no_value

name	EG381070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381070 MGI:3646305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Zfp213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:449521 MGI:3053094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22654 MGI:99159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332221 MGI:3040700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Mmp25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240047 MGI:2443938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665757 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	BC038613 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212733 MGI:2388267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thoc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386612 MGI:2677480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcfc1r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353502 MGI:2663619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf12a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27279 MGI:1351484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54419 MGI:1859284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56863 MGI:1913100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666080 MGI:3649130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	1520401A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320309 MGI:2443785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkmyt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268930 MGI:2137630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paqr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76498 MGI:1923748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kremen2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73016 MGI:1920266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530082P21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638247 MGI:3603340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs

name	Flywch1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224613 MGI:2442638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810417J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76917 MGI:1924167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	Srrm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75956 MGI:1923206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67673 MGI:1914923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353130 MGI:2661234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931440B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71003 MGI:1918253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69814 MGI:1917064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57256 MGI:1916698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13184 MGI:105949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666157 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Dcpp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630537 MGI:3644062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 5 Proteins pseudo : _no_value

name	Dcpp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620253 MGI:3646420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20234 MGI:106021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sbpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638345 MGI:3694550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30943 MGI:1353645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70835 MGI:1918085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042414 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC383225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Prss27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213171 MGI:2450123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69259 MGI:1916509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdpk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18607 MGI:1338068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG210853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130448 GeneID:210853 MGI:3646759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG210853 transcript_id : NM_177596.3

name	EG240038 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268619 GeneID:240038 MGI:3643318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 1 Protein product : predicted gene, EG240038, transcript variant 1 transcript_id : XM_139814.9

name	6330416L07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802178 GeneID:319615 MGI:2442394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330416L07 gene transcript_id : NM_176962.3

name	Zfp758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842386 GeneID:224598 MGI:2385044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 758 transcript_id : NM_145484.2

name	1300003B13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371067 GeneID:74149 MGI:1921399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300003B13 gene transcript_id : NM_198003.2

name	EG210876 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268576 GeneID:210876 MGI:3647034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 Proteins product : predicted gene, EG210876 transcript_id : XM_139816.6

name	LOC100042656 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268624 GeneID:100042656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042656 transcript_id : XM_001478701.1

name	EG628185 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268577 GeneID:628185 MGI:3644292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 Proteins product : predicted gene, EG628185 transcript_id : XM_892918.3

name	ENSMUSG00000046088 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268578 GeneID:194612 MGI:3642566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, ENSMUSG00000046088 transcript_id : XM_001477677.1

name	EG383218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268628 GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG383218 transcript_id : XM_001478718.1

name	EG383218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268626 GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG383218, transcript variant 1 transcript_id : XM_356928.5

name	EG433078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401745 GeneID:433078 MGI:3644511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG433078 transcript_id : XM_484608.3

name	LOC100042679 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268630 GeneID:100042679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042679 transcript_id : XM_001478735.1

name	A630033E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381579 GeneID:240041 MGI:2445132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630033E08 gene transcript_id : NM_177358.3

name	EG434701 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268583 GeneID:434701 MGI:3648972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG434701 transcript_id : XM_486573.4

name	LOC100042225 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268584 GeneID:100042225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins product : similar to putative pheromone receptor transcript_id : XM_001477755.1

name	EG665988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268586 GeneID:665988 MGI:3644410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG665988 transcript_id : XM_980741.2

name	Zfp40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374191 GeneID:22700 MGI:99185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 40 transcript_id : NM_009555.2

name	EG666002 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268590 GeneID:666002 MGI:3648252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : predicted gene, EG666002 transcript_id : XM_980871.2

name	EG638102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268592 GeneID:638102 MGI:3647235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG638102 transcript_id : XM_980908.2

name	EG619697 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268593 GeneID:619697 MGI:3646674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins product : predicted gene, EG619697 transcript_id : XM_884066.3

name	EG619775 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401756 GeneID:619775 MGI:3648606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG619775 transcript_id : XM_884146.2

name	EG619788 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268594 GeneID:619788 MGI:3648766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG619788 transcript_id : XM_884160.3

name	EG381070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268641 GeneID:381070 MGI:3646305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG381070 transcript_id : XM_001478765.1

name	Zfp213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372179 GeneID:449521 MGI:3053094
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 213 transcript_id : NM_001033496.2

name	Zfp13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802256 GeneID:22654 MGI:99159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 13 transcript_id : NM_011747.2

name	Zscan10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803483 GeneID:332221 MGI:3040700
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domains 10 transcript_id : NM_001033425.2

name	Mmp25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802536 GeneID:240047 MGI:2443938
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 25 transcript_id : NM_001033339.2

name	BC038613 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802304 GeneID:212733 MGI:2388267
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038613 transcript_id : NM_153784.2

name	Thoc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605679 GeneID:386612 MGI:2677480
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THO complex 6 homolog (Drosophila) transcript_id : NM_001008425.1

name	Hcfc1r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32451499 GeneID:353502 MGI:2663619
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : host cell factor C1 regulator 1 (XPO1-dependent) transcript_id : NM_181821.1

name	Tnfrsf12a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305058 GeneID:27279 MGI:1351484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 12a transcript_id : NM_013749.1

name	Cldn6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382484 GeneID:54419 MGI:1859284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 6 transcript_id : NM_018777.3

name	Cldn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098101 GeneID:56863 MGI:1913100
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 9 transcript_id : NM_020293.2

name	EG666080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401762 GeneID:666080 MGI:3649130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : predicted gene, EG666080 transcript_id : XM_981456.1

name	1520401A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359763 GeneID:320309 MGI:2443785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1520401A03 gene transcript_id : NM_177132.3

name	Pkmyt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389041 GeneID:268930 MGI:2137630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, membrane associated tyrosine/threonine 1 transcript_id : NM_023058.3

name	Paqr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130648 GeneID:76498 MGI:1923748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progestin and adipoQ receptor family member IV transcript_id : NM_023824.3

name	Kremen2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703353 GeneID:73016 MGI:1920266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kringle containing transmembrane protein 2 transcript_id : NM_028416.1

name	9530082P21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401764 GeneID:638247 MGI:3603340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs product : RIKEN cDNA 9530082P21 gene transcript_id : XM_895607.1

name	Flywch1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418894 GeneID:224613 MGI:2442638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FLYWCH-type zinc finger 1 transcript_id : NM_153791.1

name	2810417J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372204 GeneID:76917 MGI:1924167
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810417J12 gene transcript_id : NM_029798.2

name	LOC100042865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268646 GeneID:100042865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : similar to SPAC23A1.17 transcript_id : XM_001478950.1

name	Srrm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157503 GeneID:75956 MGI:1923206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/arginine repetitive matrix 2 transcript_id : NM_175229.3

name	Tceb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368491 GeneID:67673 MGI:1914923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor B (SIII), polypeptide 2 transcript_id : NM_026305.2

name	Prss33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487128 GeneID:353130 MGI:2661234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 33 transcript_id : NM_001081399.1

name	4931440B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037228 GeneID:71003 MGI:1918253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931440B09 gene transcript_id : NM_027644.1

name	Prss32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037178 GeneID:69814 MGI:1917064
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 32 transcript_id : NM_027220.1

name	Prss21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349958 GeneID:57256 MGI:1916698
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 21 transcript_id : NM_020487.3

name	Dcpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815810 GeneID:13184 MGI:105949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : demilune cell and parotid protein 1 transcript_id : NM_019910.2

name	Dcpp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647233 GeneID:630537 MGI:3644062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : demilune cell and parotid protein 2 transcript_id : NM_001039238.2

name	Dcpp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647231 GeneID:620253 MGI:3646420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : demilune cell and parotid protein 3 transcript_id : NM_001077633.1

name	Sbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116812645 GeneID:20234 MGI:106021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermine binding protein transcript_id : NM_011321.3

name	Sbpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116812641 GeneID:638345 MGI:3694550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermine binding protein-like transcript_id : NM_001077421.1

name	Tmprss8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24496767 GeneID:30943 MGI:1353645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 8 (intestinal) transcript_id : NM_013921.2

name	Prss22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526923 GeneID:70835 MGI:1918085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 22 transcript_id : NM_133731.1

name	LOC100042414 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268599 GeneID:100042414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to ribosomal protein L32 transcript_id : XM_001478147.1

name	Prss27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359500 GeneID:213171 MGI:2450123
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine 27 transcript_id : NM_175440.3

name	Kctd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794419 GeneID:69259 MGI:1916509
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 5 transcript_id : NM_027008.1

name	Pdpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107597 GeneID:18607 MGI:1338068
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-phosphoinositide dependent protein kinase-1 transcript_id : NM_001080773.1

name	Pdpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107593 GeneID:18607 MGI:1338068
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-phosphoinositide dependent protein kinase-1 transcript_id : NM_011062.2

name	EG210853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243956 GeneID:210853 MGI:3646759
definition	codon_start : 1 product : hypothetical protein LOC210853 protein_id : NP_808264.1

name	EG240038 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268620 GeneID:240038 MGI:3643318
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_139814.9

name	6330416L07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892783 GeneID:319615 MGI:2442394
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319615 protein_id : NP_795936.1

name	Zfp758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842387 GeneID:224598 MGI:2385044
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 758 protein_id : NP_663459.2

name	1300003B13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574094 GeneID:74149 MGI:1921399
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74149 protein_id : NP_932120.1

name	EG210876 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986795 GeneID:210876 MGI:3647034
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_139816.4

name	LOC100042656 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268625 GeneID:100042656
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478751.1

name	EG628185 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986799 GeneID:628185 MGI:3644292
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_898011.1

name	ENSMUSG00000046088 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268579 GeneID:194612 MGI:3642566
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477727.1

name	EG383218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268629 GeneID:383218 MGI:3647439
definition	codon_start : 1 product : similar to endosulfine-alpha protein_id : XP_001478768.1

name	EG383218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268627 GeneID:383218 MGI:3647439
definition	codon_start : 1 product : similar to endosulfine-alpha isoform 1 protein_id : XP_356928.5

name	EG433078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770048 GeneID:433078 MGI:3644511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484608.1

name	LOC100042679 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268631 GeneID:100042679
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478785.1

name	A630033E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893509 GeneID:240041 MGI:2445132
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC240041 protein_id : NP_796332.1

name	EG434701 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986820 GeneID:434701 MGI:3648972
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_486573.2

name	LOC100042225 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268585 GeneID:100042225
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001477805.1

name	EG665988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268587 GeneID:665988 MGI:3644410
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_985835.2

name	Zfp40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374192 GeneID:22700 MGI:99185
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 40 protein_id : NP_033581.2

name	EG666002 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268591 GeneID:666002 MGI:3648252
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_985965.2

name	EG638102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401754 GeneID:638102 MGI:3647235
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_986002.1

name	EG619697 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992463 GeneID:619697 MGI:3646674
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_889159.1

name	EG619775 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401757 GeneID:619775 MGI:3648606
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_889239.2

name	EG619788 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992469 GeneID:619788 MGI:3648766
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_889253.1

name	EG381070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268642 GeneID:381070 MGI:3646305
definition	codon_start : 1 product : caspase 14-like protein protein_id : XP_001478815.1

name	Zfp213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702031 CCDS:CCDS28449.1 GeneID:449521 MGI:3053094
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zin finger protein 213 protein_id : NP_001028668.1

name	Zfp13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777687 CCDS:CCDS28450.1 GeneID:22654 MGI:99159
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Kruppel-related protein product : zinc finger protein 13 protein_id : NP_035877.1

name	Zscan10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701933 CCDS:CCDS28451.1 GeneID:332221 MGI:3040700
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger with KRAB and SCAN domains 10 product : zinc finger protein 206 protein_id : NP_001028597.1

name	Mmp25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677470 CCDS:CCDS28452.1 GeneID:240047 MGI:2443938
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0016504 - protease activator activity [Evidence ISS] GO_process : GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : matrix metalloproteinase 25 product : matrix metallopeptidase 25 protein_id : NP_001028511.1

name	BC038613 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418887 CCDS:CCDS28453.1 GeneID:212733 MGI:2388267
definition	codon_start : 1 product : hypothetical protein LOC212733 protein_id : NP_722479.1

name	Thoc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605680 CCDS:CCDS28454.1 GeneID:386612 MGI:2677480
definition	codon_start : 1 product : WD repeat domain 58 protein_id : NP_001008425.1

name	Hcfc1r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32451500 CCDS:CCDS28455.1 GeneID:353502 MGI:2663619
definition	codon_start : 1 product : host cell factor C1 regulator 1 protein_id : NP_861542.1

name	Tnfrsf12a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305059 CCDS:CCDS28456.1 GeneID:27279 MGI:1351484
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007155 - cell adhesion [Evidence IDA]; GO:0008219 - cell death [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045773 - positive regulation of axon extension [Evidence IDA]; GO:0006931 - substrate-bound cell migration, cell attachment to substrate [Evidence IDA] codon_start : 1 exception : mismatches in translation function : modulates adhesion and migration note : fibroblast growth factor regulated protein 2; type I transmembrane protein Fn14 product : tumor necrosis factor receptor superfamily, member 12a protein_id : NP_038777.1

name	Cldn6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055190 CCDS:CCDS28457.1 GeneID:54419 MGI:1859284
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : tight junction molecule claudin 6 product : claudin 6 protein_id : NP_061247.1

name	Cldn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098102 CCDS:CCDS28458.1 GeneID:56863 MGI:1913100
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : claudin-9 product : claudin 9 protein_id : NP_064689.2

name	EG666080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401763 GeneID:666080 MGI:3649130
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986550.1

name	1520401A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893093 GeneID:320309 MGI:2443785
definition	codon_start : 1 product : hypothetical protein LOC320309 protein_id : NP_796106.1

name	Pkmyt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625699 CCDS:CCDS28460.1 GeneID:268930 MGI:2137630
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : MYT1 kinase product : membrane-associated tyrosine-and threonine-specific cdc2-inhibitory kinase protein_id : NP_075545.2

name	Paqr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963841 CCDS:CCDS28461.1 GeneID:76498 MGI:1923748
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : progestin and adipoQ receptor family member IV protein_id : NP_076313.1

name	Kremen2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703354 CCDS:CCDS28462.1 GeneID:73016 MGI:1920266
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : kringle-containing transmembrane protein 2 protein_id : NP_082692.1

name	9530082P21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401765 GeneID:638247 MGI:3603340
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900700.1

name	Flywch1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418895 CCDS:CCDS28463.1 GeneID:224613 MGI:2442638
definition	codon_start : 1 exception : mismatches in translation product : FLYWCH-type zinc finger 1 protein_id : NP_722486.1

name	2810417J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553307 CCDS:CCDS28464.1 GeneID:76917 MGI:1924167
definition	codon_start : 1 product : hypothetical protein LOC76917 protein_id : NP_084074.1

name	LOC100042865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268647 GeneID:100042865
definition	codon_start : 1 product : similar to SPAC23A1.17 protein_id : XP_001479000.1

name	Srrm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157504 GeneID:75956 MGI:1923206
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : serine/arginine repetitive matrix 2 protein_id : NP_780438.2

name	Tceb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385800 GeneID:67673 MGI:1914923
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : 18 kDa, elongin B; transcription elongation factor B (SIII), polypeptide 2 (18 kDa, elongin B) product : transcription elongation factor B (SIII), polypeptide 2 protein_id : NP_080581.1

name	Prss33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487129 GeneID:353130 MGI:2661234
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IC] codon_start : 1 note : tryptase 6; serine protease EOS product : protease, serine, 33 protein_id : NP_001074868.1

name	4931440B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037229 CCDS:CCDS28466.1 GeneID:71003 MGI:1918253
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : testis-specific serine protease 1 protein_id : NP_081920.1

name	Prss32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037179 GeneID:69814 MGI:1917064
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IC] codon_start : 1 exception : unclassified translation discrepancy note : testisin; eosinophil serine protease product : tryptase 5 protein_id : NP_081496.1

name	Prss21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11055972 CCDS:CCDS28468.1 GeneID:57256 MGI:1916698
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IDA]; GO:0008236 - serine-type peptidase activity [Evidence ISS] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence TAS] codon_start : 1 note : testicular serine protease 5; protease, serine, 21 (testisin) product : tryptase 4 protein_id : NP_065233.2

name	Dcpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815811 GeneID:13184 MGI:105949
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001824 - blastocyst development [Evidence IDA] codon_start : 1 note : common salivary protein 1 product : demilune cell and parotid protein protein_id : NP_064294.2

name	Dcpp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647234 GeneID:630537 MGI:3644062
definition	codon_start : 1 note : sublingual parotid tongue-2 salivary protein product : demilune cell and parotid protein 2 protein_id : NP_001034327.2

name	Dcpp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647232 GeneID:620253 MGI:3646420
definition	codon_start : 1 note : sublingual parotid tongue-3 salivary protein product : demilune cell and parotid protein 3 protein_id : NP_001071101.1

name	Sbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755402 GeneID:20234 MGI:106021
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : spermine binding protein precursor protein_id : NP_035451.1

name	Sbpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116812642 GeneID:638345 MGI:3694550
definition	codon_start : 1 product : spermine binding protein like protein_id : NP_001070889.1

name	Tmprss8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24496768 CCDS:CCDS28470.1 GeneID:30943 MGI:1353645
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence ISS]; GO:0017080 - sodium channel regulator activity [Evidence ISS]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence ISS]; GO:0006814 - sodium ion transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : distal intestinal serine protease product : transmembrane protease, serine 8 (intestinal) protein_id : NP_038949.2

name	Prss22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526924 GeneID:70835 MGI:1918085
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : protease, serine, 22 protein_id : NP_598492.1

name	LOC100042414 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268600 GeneID:100042414
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478197.1

name	Prss27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202035 CCDS:CCDS28472.1 GeneID:213171 MGI:2450123
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : pancreasin; channel-activating protease 2-like protein product : protease, serine 27 protein_id : NP_780649.1

name	Kctd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794420 CCDS:CCDS28473.1 GeneID:69259 MGI:1916509
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : potassium channel tetramerisation domain containing 5 protein_id : NP_081284.1

name	Pdpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107598 GeneID:18607 MGI:1338068
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004676 - 3-phosphoinositide-dependent protein kinase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006972 - hyperosmotic response [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform B is encoded by transcript variant 2; Pkb kinase product : 3-phosphoinositide dependent protein kinase-1 isoform B protein_id : NP_001074242.1

name	Pdpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107594 CCDS:CCDS28474.1 GeneID:18607 MGI:1338068
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004676 - 3-phosphoinositide-dependent protein kinase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006972 - hyperosmotic response [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform A is encoded by transcript variant 1; Pkb kinase product : 3-phosphoinositide dependent protein kinase-1 isoform A protein_id : NP_035192.2

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 6 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 5 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 4 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 3 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 2 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 1 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 1 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 2 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 3 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 4 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 5 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 6 pseudo : _no_value

name	LOC100042234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042234
definition	number : 1 pseudo : _no_value

name	LOC100042248 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042248
definition	number : 1 pseudo : _no_value

name	LOC100042257 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042257
definition	number : 4 pseudo : _no_value

name	LOC100042257 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042257
definition	number : 3 pseudo : _no_value

name	LOC100042257 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042257
definition	number : 2 pseudo : _no_value

name	LOC100042257 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042257
definition	number : 1 pseudo : _no_value

name	LOC100042261 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042261
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 7 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 1 pseudo : _no_value

name	LOC666062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666062
definition	number : 3 pseudo : _no_value

name	LOC666062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666062
definition	number : 2 pseudo : _no_value

name	LOC666062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666062
definition	number : 1 pseudo : _no_value

name	LOC383225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383225
definition	number : 1 pseudo : _no_value

name	LOC383225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383225
definition	number : 2 pseudo : _no_value

name	LOC671007 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268623 GeneID:671007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 110 ESTs, 3 Proteins product : similar to Sorting nexin 4 pseudo : _no_value transcript_id : XR_033824.1

name	EG631624 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268622 GeneID:631624 MGI:3648314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : predicted gene, EG631624 transcript_id : XR_033816.1

name	LOC671128 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268582 GeneID:671128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_033358.1

name	EG666030 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94401759 GeneID:666030 MGI:3645045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 8 Proteins product : predicted gene, EG666030 pseudo : _no_value transcript_id : XR_001815.1

name	LOC665757 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268643 GeneID:665757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to 60S ribosomal protein L36 pseudo : _no_value transcript_id : XR_033924.1

name	LOC666157 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268597 GeneID:666157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Ribosomal protein L7a pseudo : _no_value transcript_id : XR_033542.1

name	LOC620233 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268598 GeneID:620233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 5 Proteins product : similar to Ribosomal protein L7a pseudo : _no_value transcript_id : XR_035691.1

clone name	MSMg01-459B16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-122B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-320P12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-452H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-274G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-547G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-182B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-207F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050B11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454E09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-405M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-214F15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-214G15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-062H04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309C23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-284H15.b	B6Ng01-284H15.g
ACC	GA083168	GA083169
length	671	1,197
definition	B6Ng01-284H15.b	B6Ng01-284H15.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctaaaacaccatcttccccctagaaccttagttctcaattatcaa tatattgtatcgatacatttcttttaatttttcttagatttcctatgctg cttttgcttgatttacattccagtagtggctgtgagaaaaatgatttagg cattggtaaagacttcctcagcaggactccacctcacttgtttgggaaaa aaggccaacaactgtcttttaagagttcataagaagaggaggaggaggaa gaggaagaggggaggagaaggaagagaaagaagaagaaagtaaaaagaaa gaaagaaagaaagaaagaaagaaagaaagacccaaaagtattgaataaat gagcactcaacaaaatggaagaaaatcattgcacaatatacgtgtgacag aggattaaaatccataatatataaaaacctcagaagactaaataacaaaa aattcagacaatatggttattaaatgggctaatgaaataacagtttccaa atgatgaaatgtagggtcccggatccctcagagacaagtctgcacaggtg agagtgtggactacataagctacacagcttctgagacaggccctgtttcg agccttcatcttcaagcagtaggcaggtctgaatgccagatatctgtgca ccttcccttgtagaggagagc	gaattctcacctgaggaatactgaatggcagagaagcacctgagaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgtggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgggtaagaaggacacatgctccactatgttcatag cagccttatttataatagccagaagctggaaagaacctagatgcccctca acagaggaatggatacagaaaatgtggtacatctacacaatggagtacta ctcagctatcaaaaagaatgaatttatgaaattcctagccaaatggatgg acctggagggcatcatcctgagtgaggtaacacattcacaaagaaactca cacaatatgtactcactgataagtggatattagccccaaatgtaggatac ccaagatataagatataatttgctaaacacatgaaactcaagaagaatga agactgaagtgtggacactatgcccctccttagatttgggaacaaaacac ccatggaaggagttacagagacaaagtttggagctgagatgaaaggatgg accatatagagactgccatatccagggatccaccccataatcagcatcca aacgctgacaccattgcatacactagcaagatttttactgaaaggaccca gatgtagctgtctcttgtgagactatgccgggggcctagcaaacacagaa gttggatgctcacagtcagctaatgggatggggtcattagggctcccagt tggagggagctaggaagaaaagttagccaaaggagctaaaggggatcttg caacccttataagtggaccacatatgaactaccagtactcccggtgctct tggactcttagctgcatttatattccaagatgctagtcgggcatcactgg caaggaaggccaattggactggcaacctttattgcctaagttacggcact catgtcccaaaaaggtgggacttgggttggctccaggggtgagacgt
quality values	Open. Hide. 62 31 39 32 62 62 56 51 62 62 62 42 42 62 44 39 62 62 62 62 59 62 62 62 37 59 62 62 59 62 59 59 56 40 34 28 59 59 48 56 59 51 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 54 49 54 54 62 59 59 62 56 46 56 46 50 48 43 40 56 27 34 59 38 36 56 46 34 34 34 28 19 19 34 28 27 20 40 30 34 30 46 23 24 18 34 26 30 30 48 34 27 31 35 28 25 23 28 28 34 24 34 34 34 23 44 34 49 51 34 27 34 48 46 35 38 44 51 51 43 50 56 56 56 46 46 50 49 34 39 39 46 50 49 39 38 43 34 49 50 56 49 56 48 56 50 43 59 46 50 46 49 59 38 56 56 59 50 43 50 50 46 34 46 46 43 43 41 36 48 34 51 59 56 41 34 56 34 56 59 36 32 43 43 46 34 41 24 17 18 30 24 30 59 59 46 50 51 34 43 34 46 43 51 51 51 51 39 21 46 34 15 39 17 12 13 12 34 33 18 34 34 23 27 23 23 34 28 39 28 22 25 13 62 49 39 46 51 56 30 30 30 12 12 23 24 28 17 41 34 40 48 37 36 12 16 12 12 17 18 50 28 27 27 23 21 30 14 30 24 16 13 23 23 11 21 34 34 37 43 39 29 34 34 30 41 43 16 18 12 23 28 17 19 34 30 25 28 44 36 16 14 25 27 36 43 11 26 17 43 32 14 37 22 34 34 34 34 16 18 32 24 25 30 15 15 35 24 34 14 25 39 24 39 25 43 36 21 27 24 19 10 26 24 14 18 22 22 30 14 20 32 22 37 50 39 24 5 21 28 16 39 39 24 24 32 17 24 15 42 33 32 26 34 23 14 24 31 37 20 12 15 13 9 22 33 42 42 17 10 31 42 33 20 6 39 31 14 30 12 11 12 35 21 26 10 4 11 10 10 31 21 18 20 20 26 31 27 27 30 23 20 15 10 20 23 19 20 23 16 21 18 17 14 9 15 11 16 7 19 8 22 35 14 43 9 11	Open. Hide. 62 47 56 47 62 62 62 59 51 62 62 50 29 15 21 34 29 28 40 39 36 62 62 59 59 62 62 62 62 62 59 59 59 59 62 62 62 62 59 62 62 59 59 59 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 59 51 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 47 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 47 54 62 62 56 62 56 62 56 47 62 62 62 62 62 62 56 62 54 45 62 62 62 62 62 47 54 62 62 41 47 62 62 62 62 47 41 62 49 62 52 62 62 62 62 62 62 62 62 62 62 62 62 58 45 54 52 54 41 58 54 54 54 58 58 54 52 58 48 58 58 54 58 58 44 58 58 58 49 58 54 54 58 58 58 54 54 58 54 54 58 58 58 49 58 58 49 42 52 54 58 58 54 58 58 54 49 54 58 54 54 54 58 58 58 54 54 54 58 54 58 54 54 54 58 54 42 39 45 58 58 48 52 51 42 40 46 49 47 49 52 51 52 50 53 42 24 45 58 58 58 51 54 51 58 47 54 50 58 50 58 58 58 58 49 50 53 53 41 51 32 58 48 28 58 35 40 58 43 58 36 49 30 54 54 46 58 41 50 51 46 51 40 48 31 50 51 50 52 53 53 53 54 58 48 49 43 39 42 43 46 29 36 29 58 50 51 58 41 26 49 32 39 58 51 43 40 40 25 44 44 35 52 50 58 54 50 20 58 49 30 39 35 32 41 25 40 51 20 25 40 26 50 44 23 39 54 42 51 18 54 25 38 53 34 39 14 35 25 49 41 54 34 32 51 35 24 41 54 47 34 53 37 52 37 40 39 25 38 31 40 32 37 53 54 30 31 37 37 42 40 29 24 29 54 49 28 26 24 51 32 52 54 54 45 28 37 20 24 32 31 23 27 31 31 41 49 26 10 46 41 32 22 30 33 34 31 12 14 18 32 25 33 14 16 24 26 40 32 34 21 19 30 32 13 30 30 23 18 8 6 51 51 51 19 23 31 34 31 26 46 18 19 32 16 9 46 16 11 7 30 13 31 20 26 22 38 37 32 42 31 31 32 41 25 31 22 26 33 23 37 21 37 31 31 31 31 27 13 46 46 44 17 31 25 14 23 12 25 30 27 23 15 27 29 30 21 22 14 6 15 6 10 26 17 15 31 32 32 34 24 31 26 11 9 9 7 19 42 26 25 16 32 24 41 10 24 29 21 48 44 13 25 31 16 11 14 11 14 41 32 17 25 31 28 13 17 13 8 7 17 20 23 8 37 11 34 9 31 8 8 8 7 17 9 6 33 40 36 22 16 11 19 15 7 19 23 7 32 7 24 24 30 12 27 34 14 32 25 7 34 48 17 16 15 14 18 6 6 15 11 9 26 48 17 7 6 6 6 5 5 5 3 7 3 3 3 7 16 3 4 6 3 11 24 13 21 18 21 27 6 19 11 20 28 16 20 10 25 28 15 17 28 15 14 12 11 7 9 29 11 19 24 20 26 9 7 18 18 20 28 11 13 21 6 14 8 5 6 7 5 4 17 8 5 18 9 3 6 4 3 3 2 10 1 3 11 9 24 5 22 5 8 7 7 4 3 6 2 3 5 3 5 8 6 3 3 15 16 16 5 6 7 6 7 6 3 4 18 5 4 6 14 19 8 13 21 25 5 11 7 16 5 8 10 5 5 6 8 7 4 4 2 5 5 2 3 2 4 22 3 2 3 1 1 13 6 7 21 15 6 11 11 14 7 20 15 5 2 1 1 4 11 8 12 1 5 5 13 1 2 3 5 5 13 6 1 3 2 4 6 3 2 1 3 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_23264615_23265285
seq2: B6Ng01-284H15.b_45_715

seq1  GAATTCTAAAACACCATCTTCCCCCTAGAACCTTAGTTCTCAATTATCAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAAAACACCATCTTCCCCCTAGAACCTTAGTTCTCAATTATCAA  50

seq1  TATATTGTATCGATACATTTCTTTTAATTTTTCTTAGATTTCCTATGCTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATTGTATCGATACATTTCTTTTAATTTTTCTTAGATTTCCTATGCTG  100

seq1  CTTTTGCTTGATTTACATTCCAGTAGTGGCTGTGAGAAAAATGATTTAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTGCTTGATTTACATTCCAGTAGTGGCTGTGAGAAAAATGATTTAGG  150

seq1  CATTGGTAAAGACTTCCTCAGCAGGACTCCACCTCACTTGTTTGGGAAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGGTAAAGACTTCCTCAGCAGGACTCCACCTCACTTGTTTGGGAAAA  200

seq1  AAGGCCAACAACTGTCTTTTAAGAGTTCATAAGAAGAGGAGGAGGAGGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCCAACAACTGTCTTTTAAGAGTTCATAAGAAGAGGAGGAGGAGGAA  250

seq1  GAGGAAGAGGGGAGGAGAAGGAAGAGAAAGAAGAAGAAAGTAAAAAGAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAAGAGGGGAGGAGAAGGAAGAGAAAGAAGAAGAAAGTAAAAAGAAA  300

seq1  GAAAGAAAGAAAGAAAGAAAGAAAGAAAGACCCAAAAGTATTGAATAAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAAAGAAAGAAAGAAAGAAAGAAAGACCCAAAAGTATTGAATAAAT  350

seq1  GAGCACTCAACAAAATGGAAGAAAATCATTGCACAATATACGTGTGACAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCACTCAACAAAATGGAAGAAAATCATTGCACAATATACGTGTGACAG  400

seq1  AGGATTAAAATCCATAATATATAAAAACCTCAGAAGACTAAATAACAAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATTAAAATCCATAATATATAAAAACCTCAGAAGACTAAATAACAAAA  450

seq1  AATTCAGACAATATGGTTATTAAATGGGCTAATGAAATAACAGTTTCCAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCAGACAATATGGTTATTAAATGGGCTAATGAAATAACAGTTTCCAA  500

seq1  ATGATGAAATGTAGGGTCCCGGATCCCTCAGAGACAAGTCTGCACAGGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATGAAATGTAGGGTCCCGGATCCCTCAGAGACAAGTCTGCACAGGTG  550

seq1  AGAGTGTGGACTACAGAAGCTACACAGCTTCTGAGACAGGCCCTGTTTCG  600
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  AGAGTGTGGACTACATAAGCTACACAGCTTCTGAGACAGGCCCTGTTTCG  600

seq1  AGCCTTCATCTTCAAGCAGTAGGCAGGTCCGAATGCCAGATATCTGTGCA  650
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  AGCCTTCATCTTCAAGCAGTAGGCAGGTCTGAATGCCAGATATCTGTGCA  650

seq1  CCTTCCCTGTAAGAGGAGAGC  671
      ||||||||   ||||||||||
seq2  CCTTCCCTTGTAGAGGAGAGC  671

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information