MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-304D04
Chromosome	17 (Build37)
Map Location	25,475,552 - 25,636,936
singlet/doublet	doublet
Overlap gene	Tpsab1, Mcpt6, Tpsg1, Cacna1h, Tekt4, Sstr5
Upstream gene	Abca17, Abca3, Rnps1, Dci, Dnase1l2, E4f1, 1700012G19Rik, Gbl, 9930021D14Rik, LOC666299, Caskin1, Traf7, Rab26, Pkd1, Tsc2, Nthl1, Slc9a3r2, Npw, Zfp598, Syngr3, Gfer, Noxo1, Tbl3, Rnf151, Rps2, Snora64, Ndufb10, Rpl3l, Sepx1, Hs3st6, 4930528F23Rik, Fahd1, Hagh, Igfals, Nubp2, Spsb3, Mrps34, Nme3, Mapk8ip3, Hn1l, Cramp1l, Ift140, BC054438, Telo2, 1110018H23Rik, Clcn7, Gm317, BC003965, Unkl, Gnptg, 0610007P22Rik, Ube2i, Prss34, Prss28, Prss29, LOC432543, LOC666472
Downstream gene	LOC100042580, Sox8, Tmem112, LOC545396, Gng13, Chtf18, Rpusd1, BC052484, Msln, Narfl, Haghl, Ccdc78, BC008155, Metrn, Fbxl16, Wdr24, 2610003J06Rik, Stub1, Rhbdl1, Rhot2, Wdr90, 9530058B02Rik, 0610011F06Rik, Wfikkn1, Rab40c, LOC100043160, Pigq, F430201B04Rik, D630044L22Rik, Solh, 1700022N22Rik, Rab11fip3, Decr2, Nme4, EG666609, Tmem8, Mrpl28, Axin1, Pdia2, Arhgdig, Rgs11, Itfg3, LOC100042643, Luc7l, EG383229, EG240055, C230078M08Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Abca17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381072 MGI:3625331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27410 MGI:1351617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rnps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19826 MGI:97960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Dci (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13177 MGI:94871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnase1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66705 MGI:1913955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E4f1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13560 MGI:109530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700012G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67078 MGI:1914328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56716 MGI:1929514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930021D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319259 MGI:2441766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Caskin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268932 MGI:2442952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224619 MGI:3042141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328778 MGI:2443284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 52 ESTs, 10 Proteins

name	Pkd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18763 MGI:97603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22084 MGI:102548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nthl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18207 MGI:1313275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc9a3r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65962 MGI:1890662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Npw (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381073 MGI:2685781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Zfp598 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213753 MGI:2670965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syngr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20974 MGI:1341881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfer (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11692 MGI:107757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Noxo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71893 MGI:1919143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213773 MGI:2384863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67504 MGI:1914754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16898 MGI:105110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Snora64 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104366 MGI:2148175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68342 MGI:1915592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66211 MGI:1913461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sepx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27361 MGI:1351642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hs3st6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328779 MGI:3580487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930528F23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75178 MGI:1922428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 2 Proteins

name	Fahd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68636 MGI:1915886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hagh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14651 MGI:95745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfals (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16005 MGI:107973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nubp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26426 MGI:1347072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spsb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79043 MGI:1891471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79044 MGI:1930188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nme3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79059 MGI:1930182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk8ip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30957 MGI:1353598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hn1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52009 MGI:1196260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cramp1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57354 MGI:1930190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 164 ESTs, 2 Proteins

name	Ift140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106633 MGI:2146906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC054438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407831 MGI:3039635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Telo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71718 MGI:1918968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110018H23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68509 MGI:1915759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 12 ESTs, 6 Proteins

name	Clcn7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26373 MGI:1347048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm317 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207209 MGI:2685163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	BC003965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214489 MGI:2670966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 104 ESTs

name	Unkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74154 MGI:1921404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnptg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214505 MGI:2147006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610007P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68327 MGI:1915577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22196 MGI:107365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328780 MGI:2681414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114661 MGI:2149951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114662 MGI:2149952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 ESTs, 24 Proteins pseudo : _no_value

name	LOC666472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Tpsab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17230 MGI:96943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17229 MGI:96942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpsg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26945 MGI:1349391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58226 MGI:1928842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tekt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71840 MGI:1919090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sstr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20609 MGI:894282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Sox8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20681 MGI:98370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76483 MGI:1923733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Gng13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64337 MGI:1925616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chtf18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214901 MGI:2384887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpusd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106707 MGI:1919186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC052484 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328783 MGI:3607710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56047 MGI:1888992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Narfl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67563 MGI:1914813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Haghl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68977 MGI:1919877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc78 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381077 MGI:2685784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	BC008155 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214917 MGI:2384888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Metrn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70083 MGI:1917333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214931 MGI:2448488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 ESTs, 4 Proteins

name	Wdr24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268933 MGI:2446285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610003J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72106 MGI:1919356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56424 MGI:1891731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhbdl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214951 MGI:2384891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhot2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214952 MGI:2384892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr90 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106618 MGI:1921267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 136 ESTs, 5 Proteins

name	9530058B02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68241 MGI:1915491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610011F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68347 MGI:1915597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfikkn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215001 MGI:2670967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 3 Proteins

name	Rab40c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224624 MGI:2183454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043160 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 231 ESTs, 2 Proteins

name	Pigq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14755 MGI:1333114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F430201B04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621239 MGI:3687200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D630044L22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240054 MGI:3709661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Solh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50817 MGI:1355075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022N22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69431 MGI:1916681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rab11fip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215445 MGI:2444431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 93 ESTs, 7 Proteins

name	Decr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26378 MGI:1347059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nme4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56520 MGI:1931148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666609 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666609 MGI:3643110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Tmem8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60455 MGI:1926283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68611 MGI:1915861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Axin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12005 MGI:1096327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdia2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69191 MGI:1916441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgdig (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14570 MGI:108430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50782 MGI:1354739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itfg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106581 MGI:2146854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Luc7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66978 MGI:1914228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG383229 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383229 MGI:3649055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG240055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240055 MGI:3643092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230078M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319749 MGI:2442659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83716005 GeneID:381072 MGI:3625331
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 17 transcript_id : NM_001031621.1

name	Abca3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759349 GeneID:27410 MGI:1351617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 3 transcript_id : NM_013855.2

name	Abca3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853070 GeneID:27410 MGI:1351617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 3 transcript_id : NM_001039581.1

name	Rnps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674792 GeneID:19826 MGI:97960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleic acid binding protein S1 transcript_id : NM_009070.2

name	Rnps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674789 GeneID:19826 MGI:97960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleic acid binding protein S1 transcript_id : NM_001080127.1

name	Rnps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674798 GeneID:19826 MGI:97960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleic acid binding protein S1 transcript_id : NM_001080128.1

name	Dci (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379490 GeneID:13177 MGI:94871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenyme A isomerase) transcript_id : NM_010023.3

name	Dnase1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803156 GeneID:66705 MGI:1913955
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease 1-like 2 transcript_id : NM_025718.2

name	E4f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922712 GeneID:13560 MGI:109530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E4F transcription factor 1 transcript_id : NM_007893.3

name	1700012G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129884 GeneID:67078 MGI:1914328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700012G19 gene transcript_id : NM_025954.3

name	Gbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367623 GeneID:56716 MGI:1929514
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein beta subunit-like transcript_id : NM_019988.3

name	9930021D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381781 GeneID:319259 MGI:2441766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930021D14 gene transcript_id : NM_175682.3

name	LOC666299 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268603 GeneID:666299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC666299 transcript_id : XM_982880.2

name	Caskin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592862 GeneID:268932 MGI:2442952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CASK interacting protein 1 transcript_id : NM_027937.1

name	Traf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418904 GeneID:224619 MGI:3042141
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 7 transcript_id : NM_153792.1

name	Rab26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268664 GeneID:328778 MGI:2443284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 52 ESTs, 10 Proteins product : RAB26, member RAS oncogene family, transcript variant 1 transcript_id : XM_283428.6

name	Pkd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487379 GeneID:18763 MGI:97603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 1 homolog transcript_id : NM_013630.2

name	Tsc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439991 GeneID:22084 MGI:102548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberous sclerosis 2 transcript_id : NM_001039363.1

name	Tsc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439986 GeneID:22084 MGI:102548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberous sclerosis 2 transcript_id : NM_011647.2

name	Nthl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679145 GeneID:18207 MGI:1313275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nth (endonuclease III)-like 1 (E.coli) transcript_id : NM_008743.1

name	Slc9a3r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12746431 GeneID:65962 MGI:1890662
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2 transcript_id : NM_023055.1

name	Slc9a3r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357121 GeneID:65962 MGI:1890662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2 transcript_id : NM_023449.2

name	Npw (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268608 GeneID:381073 MGI:2685781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : neuropeptide W transcript_id : XM_001478349.1

name	Zfp598 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147168 GeneID:213753 MGI:2670965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 598 transcript_id : NM_183149.1

name	Syngr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370504 GeneID:20974 MGI:1341881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 3 transcript_id : NM_011522.3

name	Gfer (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403593 GeneID:11692 MGI:107757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration) transcript_id : NM_023040.3

name	Noxo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363839 GeneID:71893 MGI:1919143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADPH oxidase organizer 1 transcript_id : NM_027988.2

name	Tbl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802154 GeneID:213773 MGI:2384863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin (beta)-like 3 transcript_id : NM_145396.4

name	Rnf151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129829 GeneID:67504 MGI:1914754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 151 transcript_id : NM_026205.3

name	Rps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802378 GeneID:16898 MGI:105110
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S2 transcript_id : NM_008503.3

name	Ndufb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367767 GeneID:68342 MGI:1915592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 transcript_id : NM_026684.2

name	Rpl3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802699 GeneID:66211 MGI:1913461
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L3-like transcript_id : NM_025425.2

name	Sepx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110832840 GeneID:27361 MGI:1351642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenoprotein X 1 transcript_id : NM_013759.2

name	Hs3st6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60223080 GeneID:328779 MGI:3580487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate (glucosamine) 3-O-sulfotransferase 6 transcript_id : NM_001012402.1

name	4930528F23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268668 GeneID:75178 MGI:1922428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 2 Proteins product : RIKEN cDNA 4930528F23 gene transcript_id : XM_128478.6

name	Fahd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311548 GeneID:68636 MGI:1915886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fumarylacetoacetate hydrolase domain containing 1 transcript_id : NM_023480.2

name	Hagh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21729785 GeneID:14651 MGI:95745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxyacyl glutathione hydrolase transcript_id : NM_024284.1

name	Igfals (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388344 GeneID:16005 MGI:107973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein, acid labile subunit transcript_id : NM_008340.3

name	Nubp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981334 GeneID:26426 MGI:1347072
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleotide binding protein 2 transcript_id : NM_011956.2

name	Spsb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252773 GeneID:79043 MGI:1891471
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splA/ryanodine receptor domain and SOCS box containing 3 transcript_id : NM_027141.1

name	Mrps34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385669 GeneID:79044 MGI:1930188
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S34 transcript_id : NM_023260.1

name	Nme3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790120 GeneID:79059 MGI:1930182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 3 transcript_id : NM_019730.1

name	Mapk8ip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353174 GeneID:30957 MGI:1353598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase 8 interacting protein 3 transcript_id : NM_013931.2

name	Hn1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130913 GeneID:52009 MGI:1196260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematological and neurological expressed 1-like transcript_id : NM_198937.2

name	Cramp1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401770 GeneID:57354 MGI:1930190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 161 ESTs, 2 Proteins product : Crm, cramped-like (Drosophila), transcript variant 1 transcript_id : XM_484614.4

name	Cramp1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401766 GeneID:57354 MGI:1930190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 160 ESTs, 2 Proteins product : Crm, cramped-like (Drosophila), transcript variant 5 transcript_id : XM_983827.1

name	Ift140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993725 GeneID:106633 MGI:2146906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intraflagellar transport 140 homolog (Chlamydomonas) transcript_id : NM_134126.2

name	BC054438 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47564089 GeneID:407831 MGI:3039635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC054438 transcript_id : NM_001001183.1

name	Telo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311991 GeneID:71718 MGI:1918968
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEL2, telomere maintenance 2, homolog (S. cerevisiae) transcript_id : NM_027880.1

name	1110018H23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268669 GeneID:68509 MGI:1915759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins product : RIKEN cDNA 1110018H23 gene transcript_id : XM_128459.6

name	Clcn7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802324 GeneID:26373 MGI:1347048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 7 transcript_id : NM_011930.3

name	Gm317 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268610 GeneID:207209 MGI:2685163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : gene model 317, (NCBI) transcript_id : XM_139904.7

name	BC003965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401787 GeneID:214489 MGI:2670966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 104 ESTs product : cDNA sequence BC003965 transcript_id : XM_128528.5

name	Unkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377990 GeneID:74154 MGI:1921404
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unkempt-like (Drosophila) transcript_id : NM_028789.2

name	Gnptg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892310 GeneID:214505 MGI:2147006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglucosamine-1-phosphotransferase, gamma subunit transcript_id : NM_172529.3

name	0610007P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372926 GeneID:68327 MGI:1915577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610007P22 gene transcript_id : NM_026676.2

name	Ube2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379350 GeneID:22196 MGI:107365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2I transcript_id : NM_011665.3

name	Prss34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342000 GeneID:328780 MGI:2681414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 34 transcript_id : NM_178372.2

name	Prss28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299757 GeneID:114661 MGI:2149951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 28 transcript_id : NM_053259.2

name	Prss29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981507 GeneID:114662 MGI:2149952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 29 transcript_id : NM_053260.2

name	Tpsab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981623 GeneID:17230 MGI:96943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptase alpha/beta 1 transcript_id : NM_031187.2

name	Mcpt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130496075 GeneID:17229 MGI:96942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 6 transcript_id : NM_010781.3

name	Tpsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981315 GeneID:26945 MGI:1349391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptase gamma 1 transcript_id : NM_012034.2

name	Cacna1h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62739189 GeneID:58226 MGI:1928842
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, T type, alpha 1H subunit transcript_id : NM_021415.3

name	Tekt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625870 GeneID:71840 MGI:1919090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tektin 4 transcript_id : NM_027951.1

name	Sstr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803431 GeneID:20609 MGI:894282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : somatostatin receptor 5 transcript_id : NM_011425.2

name	Sox8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364470 GeneID:20681 MGI:98370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 8 transcript_id : NM_011447.2

name	Tmem112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981341 GeneID:76483 MGI:1923733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 112 transcript_id : NM_029624.2

name	Gng13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801840 GeneID:64337 MGI:1925616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein 13, gamma transcript_id : NM_022422.4

name	Chtf18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703815 GeneID:214901 MGI:2384887
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) transcript_id : NM_145409.1

name	Rpusd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803202 GeneID:106707 MGI:1919186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA pseudouridylate synthase domain containing 1 transcript_id : NM_028009.2

name	BC052484 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891839 GeneID:328783 MGI:3607710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC052484 transcript_id : NM_177822.3

name	Msln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9256567 GeneID:56047 MGI:1888992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesothelin transcript_id : NM_018857.1

name	Narfl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802092 GeneID:67563 MGI:1914813
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear prelamin A recognition factor-like transcript_id : NM_026238.3

name	Haghl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377149 GeneID:68977 MGI:1919877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxyacylglutathione hydrolase-like transcript_id : NM_026897.2

name	Ccdc78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401811 GeneID:381077 MGI:2685784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : coiled-coil domain containing 78 transcript_id : XM_354998.4

name	BC008155 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348873 GeneID:214917 MGI:2384888
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC008155 transcript_id : NM_145410.3

name	Metrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56550040 GeneID:70083 MGI:1917333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : meteorin, glial cell differentiation regulator transcript_id : NM_133719.2

name	Fbxl16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268683 GeneID:214931 MGI:2448488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 4 Proteins product : F-box and leucine-rich repeat protein 16, transcript variant 2 transcript_id : XM_001479825.1

name	Fbxl16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268681 GeneID:214931 MGI:2448488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs, 4 Proteins product : F-box and leucine-rich repeat protein 16, transcript variant 1 transcript_id : XM_001479823.1

name	Wdr24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343449 GeneID:268933 MGI:2446285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 24 transcript_id : NM_173741.2

name	2610003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802052 GeneID:72106 MGI:1919356
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610003J06 gene transcript_id : NM_028101.2

name	Stub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130581 GeneID:56424 MGI:1891731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : STIP1 homology and U-Box containing protein 1 transcript_id : NM_019719.3

name	Rhbdl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450188 GeneID:214951 MGI:2384891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhomboid, veinlet-like 1 (Drosophila) transcript_id : NM_144816.1

name	Rhot2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328359 GeneID:214952 MGI:2384892
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member T2 transcript_id : NM_145999.2

name	Wdr90 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268687 GeneID:106618 MGI:1921267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 129 ESTs, 3 Proteins product : WD repeat domain 90, transcript variant 2 transcript_id : XM_001479848.1

name	Wdr90 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268685 GeneID:106618 MGI:1921267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 135 ESTs, 4 Proteins product : WD repeat domain 90, transcript variant 1 transcript_id : XM_001479840.1

name	9530058B02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388442 GeneID:68241 MGI:1915491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530058B02 gene transcript_id : NM_026633.2

name	0610011F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037114 GeneID:68347 MGI:1915597
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610011F06 gene transcript_id : NM_026686.1

name	Wfikkn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401812 GeneID:215001 MGI:2670967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 3 Proteins product : WAP, FS, Ig, KU, and NTR-containing protein 1 transcript_id : XM_128578.5

name	Rab40c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21040230 GeneID:224624 MGI:2183454
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rab40c, member RAS oncogene family transcript_id : NM_139154.1

name	LOC100043160 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268689 GeneID:100043160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 231 ESTs, 2 Proteins product : similar to cytochrome c oxidase, subunit VIIc transcript_id : XM_001479891.1

name	Pigq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130030 GeneID:14755 MGI:1333114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class Q transcript_id : NM_011822.3

name	F430201B04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802990 GeneID:621239 MGI:3687200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F430201B04 gene transcript_id : NM_001039038.2

name	D630044L22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386153 GeneID:240054 MGI:3709661
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA gene D630044L22 gene transcript_id : NM_175505.3

name	Solh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657600 GeneID:50817 MGI:1355075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small optic lobes homolog (Drosophila) transcript_id : NM_015830.1

name	1700022N22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268692 GeneID:69431 MGI:1916681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 1700022N22 gene transcript_id : XM_001479914.1

name	Rab11fip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268695 GeneID:215445 MGI:2444431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 87 ESTs, 7 Proteins product : RAB11 family interacting protein 3 (class II) transcript_id : XM_001479926.1

name	Rab11fip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268694 GeneID:215445 MGI:2444431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 88 ESTs, 4 Proteins product : RAB11 family interacting protein 3 (class II), transcript variant 1 transcript_id : XM_484616.4

name	Rab11fip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401792 GeneID:215445 MGI:2444431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 72 ESTs, 5 Proteins product : RAB11 family interacting protein 3 (class II), transcript variant 9 transcript_id : XM_989054.1

name	Decr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129992 GeneID:26378 MGI:1347059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal transcript_id : NM_011933.2

name	Nme4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790122 GeneID:56520 MGI:1931148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 4, protein transcript_id : NM_019731.1

name	EG666609 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268621 GeneID:666609 MGI:3643110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG666609 transcript_id : XM_984926.2

name	Tmem8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11140832 GeneID:60455 MGI:1926283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 8 (five membrane-spanning domains) transcript_id : NM_021793.1

name	Mrpl28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26787988 GeneID:68611 MGI:1915861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L28 transcript_id : NM_024227.2

name	Axin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50979283 GeneID:12005 MGI:1096327
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : axin 1 transcript_id : NM_009733.1

name	Pdia2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486723 GeneID:69191 MGI:1916441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein disulfide isomerase associated 2 transcript_id : NM_001081070.1

name	Arhgdig (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130965 GeneID:14570 MGI:108430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GDP dissociation inhibitor (GDI) gamma transcript_id : NM_008113.3

name	Rgs11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486717 GeneID:50782 MGI:1354739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 11 transcript_id : NM_001081069.1

name	Itfg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386504 GeneID:106581 MGI:2146854
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha FG-GAP repeat containing 3 transcript_id : NM_207217.2

name	Luc7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158676 GeneID:66978 MGI:1914228
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Luc7 homolog (S. cerevisiae)-like transcript_id : NM_028190.2

name	Luc7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158673 GeneID:66978 MGI:1914228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Luc7 homolog (S. cerevisiae)-like transcript_id : NM_025881.2

name	EG383229 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401820 GeneID:383229 MGI:3649055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG383229 transcript_id : XM_356935.3

name	EG240055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116566 GeneID:240055 MGI:3643092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG240055 transcript_id : NM_001081656.1

name	C230078M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342547 GeneID:319749 MGI:2442659
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230078M08 gene transcript_id : NM_176995.2

name	Abca17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716006 GeneID:381072 MGI:3625331
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0003913 - DNA photolyase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006638 - neutral lipid metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ATP-binding cassette, sub-family A (ABC1), member 17 protein_id : NP_001026792.1

name	Abca3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853071 GeneID:27410 MGI:1351617
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0042599 - lamellar body [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence ISS] codon_start : 1 product : ATP-binding cassette, sub-family A (ABC1), member 3 protein_id : NP_001034670.1

name	Abca3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759350 GeneID:27410 MGI:1351617
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0042599 - lamellar body [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence ISS] codon_start : 1 product : ATP-binding cassette, sub-family A (ABC1), member 3 protein_id : NP_038883.2

name	Rnps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674799 GeneID:19826 MGI:97960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3 product : ribonucleic acid binding protein S1 isoform 2 protein_id : NP_001073597.1

name	Rnps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674790 GeneID:19826 MGI:97960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 2 product : ribonucleic acid binding protein S1 isoform 1 protein_id : NP_001073596.1

name	Rnps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674793 GeneID:19826 MGI:97960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : ribonucleic acid binding protein S1 isoform 1 protein_id : NP_033096.2

name	Dci (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981810 CCDS:CCDS28480.1 GeneID:13177 MGI:94871
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence TAS] [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004165 - dodecenoyl-CoA delta-isomerase activity [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0006635 - fatty acid beta-oxidation [Evidence IMP]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenyme A isomerase) protein_id : NP_034153.2

name	Dnase1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385174 GeneID:66705 MGI:1913955
definition	GO_function : GO:0004536 - deoxyribonuclease activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006308 - DNA catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : deoxyribonuclease 1-like 2 protein_id : NP_079994.1

name	E4f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719296 CCDS:CCDS28481.1 GeneID:13560 MGI:109530
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IMP]; GO:0009790 - embryonic development [Evidence IMP]; GO:0009794 - regulation of progression through embryonic mitotic cell cycle [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence TAS] codon_start : 1 product : E4F transcription factor 1 protein_id : NP_031919.2

name	1700012G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254507 CCDS:CCDS28482.1 GeneID:67078 MGI:1914328
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67078 protein_id : NP_080230.2

name	9930021D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316786 CCDS:CCDS28483.1 GeneID:319259 MGI:2441766
definition	codon_start : 1 product : hypothetical protein LOC319259 protein_id : NP_783613.1

name	Gbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542885 CCDS:CCDS28484.1 GeneID:56716 MGI:1929514
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : transducin (beta)-like 4 product : G protein beta subunit-like protein_id : NP_064372.2

name	LOC666299 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94401775 GeneID:666299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987974.1

name	Caskin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592863 GeneID:268932 MGI:2442952
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : CASK interacting protein 1 protein_id : NP_082213.1

name	Traf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418905 GeneID:224619 MGI:3042141
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0000185 - activation of MAPKKK activity [Evidence ISS]; GO:0006915 - apoptosis [Evidence ISS]; GO:0043410 - positive regulation of MAPKKK cascade [Evidence ISS]; GO:0016567 - protein ubiquitination [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ring finger and WD repeat domain 1 product : Tnf receptor-associated factor 7 protein_id : NP_722487.1

name	Rab26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268665 GeneID:328778 MGI:2443284
definition	codon_start : 1 product : RAB26, member RAS oncogene family isoform 1 protein_id : XP_283428.6

name	Pkd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487380 CCDS:CCDS28485.1 GeneID:18763 MGI:97603
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IPI] GO_function : GO:0005262 - calcium channel activity [Evidence TAS]; GO:0005261 - cation channel activity [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0001502 - cartilage condensation [Evidence IMP]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0050982 - detection of mechanical stimulus [Evidence IDA]; GO:0007507 - heart development [Evidence IMP]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0050954 - sensory perception of mechanical stimulus [Evidence IMP] codon_start : 1 product : polycystin 1 protein_id : NP_038658.2

name	Tsc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86439992 CCDS:CCDS28486.1 GeneID:22084 MGI:102548
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0046626 - regulation of insulin receptor signaling pathway [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; tuberin product : tuberous sclerosis 2 isoform 2 protein_id : NP_001034452.1

name	Tsc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86439987 GeneID:22084 MGI:102548
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0046626 - regulation of insulin receptor signaling pathway [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; tuberin product : tuberous sclerosis 2 isoform 1 protein_id : NP_035777.2

name	Nthl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679146 CCDS:CCDS28487.1 GeneID:18207 MGI:1313275
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0019104 - DNA N-glycosylase activity [Evidence IDA] [Evidence TAS]; GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IDA] [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006296 - nucleotide-excision repair, DNA incision, 5'-to lesion [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : thymine glycol DNA glycosylase/AP lyase product : nth (endonuclease III)-like 1 protein_id : NP_032769.1

name	Slc9a3r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746432 CCDS:CCDS28488.1 GeneID:65962 MGI:1890662
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform A is encoded by transcript variant A; sodium/hydrogen exchanger product : solute carrier family 9 isoform 3 regulator 2 isoform A protein_id : NP_075542.1

name	Slc9a3r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21264334 CCDS:CCDS28489.1 GeneID:65962 MGI:1890662
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform B is encoded by transcript variant B; sodium/hydrogen exchanger product : solute carrier family 9 isoform 3 regulator 2 isoform B protein_id : NP_075938.1

name	Npw (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268609 GeneID:381073 MGI:2685781
definition	codon_start : 1 product : similar to prepro-Neuropeptide W polypeptide protein_id : XP_001478399.1

name	Zfp598 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147169 CCDS:CCDS28490.1 GeneID:213753 MGI:2670965
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 598 protein_id : NP_898972.1

name	Syngr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560541 CCDS:CCDS28491.1 GeneID:20974 MGI:1341881
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : Sgyr III; synaptogryin III product : synaptogyrin 3 protein_id : NP_035652.2

name	Gfer (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909575 CCDS:CCDS28492.1 GeneID:11692 MGI:107757
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 note : augmenter of liver regeneration product : growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration) protein_id : NP_075527.2

name	Noxo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26080420 GeneID:71893 MGI:1919143
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016176 - superoxide-generating NADPH oxidase activator activity [Evidence IDA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : NADPH oxidase organizer 1 protein_id : NP_082264.1

name	Tbl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30102935 CCDS:CCDS28493.1 GeneID:213773 MGI:2384863
definition	codon_start : 1 product : transducin (beta)-like 3 protein_id : NP_663371.2

name	Rnf151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385712 GeneID:67504 MGI:1914754
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : ring finger protein 151 protein_id : NP_080481.1

name	Rps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087805 GeneID:16898 MGI:105110
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : repeat family 3 product : ribosomal protein S2 protein_id : NP_032529.2

name	Ndufb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037109 CCDS:CCDS28494.1 GeneID:68342 MGI:1915592
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 protein_id : NP_080960.1

name	Rpl3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384820 GeneID:66211 MGI:1913461
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L3-like protein_id : NP_079701.1

name	Sepx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305479 CCDS:CCDS28495.1 GeneID:27361 MGI:1351642
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0000318 - protein-methionine-R-oxide reductase activity [Evidence IDA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence IDA] GO_process : GO:0030091 - protein repair [Evidence IDA] codon_start : 1 note : selenoprotein R; methionine-R-sulfoxide reductase product : selenoprotein X 1 protein_id : NP_038787.1 transl_except : (pos:24877103..24877105,aa:Sec)

name	Hs3st6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60223081 CCDS:CCDS28496.1 GeneID:328779 MGI:3580487
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008467 - heparin-glucosamine 3-O-sulfotransferase activity [Evidence IDA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : heparan sulfate 3-O-sulfotransferase 6 product : heparan sulfate (glucosamine) 3-O-sulfotransferase 6 protein_id : NP_001012402.1

name	4930528F23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770106 GeneID:75178 MGI:1922428
definition	codon_start : 1 product : hypothetical protein LOC75178 protein_id : XP_128478.3

name	Fahd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963697 GeneID:68636 MGI:1915886
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : Similar to homoprotocatechuate catabolism bifunctional isomerase/decarboxylase homolog (UniProt\|Q8BLJ7, evidence: FASTY, 100%ID, 100%length, match=663); putative product : fumarylacetoacetate hydrolase domain containing 1 protein_id : NP_075969.1

name	Hagh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729786 CCDS:CCDS28499.1 GeneID:14651 MGI:95745
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004416 - hydroxyacylglutathione hydrolase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glyoxalase II; round spermatid protein RSP29; glyoxylase 2 product : hydroxyacyl glutathione hydrolase protein_id : NP_077246.1

name	Igfals (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982258 GeneID:16005 MGI:107973
definition	GO_function : GO:0005520 - insulin-like growth factor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : insulin-like growth factor binding protein, acid labile subunit protein_id : NP_032366.2

name	Nubp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754908 CCDS:CCDS28500.1 GeneID:26426 MGI:1347072
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : nucleotide binding protein 2 protein_id : NP_036086.1

name	Spsb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252774 CCDS:CCDS28501.1 GeneID:79043 MGI:1891471
definition	codon_start : 1 exception : mismatches in translation note : SPRY domain-containing SOCS box protein SSB-3 product : splA/ryanodine receptor domain and SOCS box containing 3 protein_id : NP_081417.1

name	Mrps34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385670 CCDS:CCDS28502.1 GeneID:79044 MGI:1930188
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : T-complex expressed gene 2 product : mitochondrial ribosomal protein S34 protein_id : NP_075749.1

name	Nme3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790121 CCDS:CCDS28503.1 GeneID:79059 MGI:1930182
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0009209 - pyrimidine ribonucleoside triphosphate biosynthesis [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nucleoside diphosphate kinase DR-nm23 protein_id : NP_062704.1

name	Mapk8ip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305255 GeneID:30957 MGI:1353598
definition	GO_component : GO:0030673 - axolemma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] [Evidence IEP]; GO:0030425 - dendrite [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005790 - smooth endoplasmic reticulum [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0019894 - kinesin binding [Evidence IPI]; GO:0005078 - MAP-kinase scaffold activity [Evidence IPI] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IPI] GO_process : GO:0007257 - activation of JNK activity [Evidence IDA]; GO:0007411 - axon guidance [Evidence IMP]; GO:0030900 - forebrain development [Evidence IMP]; GO:0007254 - JNK cascade [Evidence IDA]; GO:0008104 - protein localization [Evidence IMP]; GO:0046328 - regulation of JNK cascade [Evidence IDA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0016192 - vesicle-mediated transport [Evidence IDA] codon_start : 1 exception : mismatches in translation function : JNK MAP kinase signal transduction pathway molecular scaffold note : JNK-interacting protein 3; JUN/SAPK-associated protein 1; c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1; sunday driver 2 product : mitogen-activated protein kinase 8 interacting protein 3 protein_id : NP_038959.1

name	Hn1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39573709 CCDS:CCDS28504.1 GeneID:52009 MGI:1196260
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : hematopoietic- and neurologic-expressed sequence 1-like product : HN1-like protein protein_id : NP_945175.1

name	Cramp1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770109 GeneID:57354 MGI:1930190
definition	codon_start : 1 product : Crm, cramped-like isoform 1 protein_id : XP_484614.1

name	Cramp1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401767 GeneID:57354 MGI:1930190
definition	codon_start : 1 product : Crm, cramped-like isoform 5 protein_id : XP_988921.1

name	Ift140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993726 CCDS:CCDS28505.1 GeneID:106633 MGI:2146906
definition	GO_component : GO:0019861 - flagellum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : WD and tetratricopeptide repeats 2 product : intraflagellar transport 140 protein_id : NP_598887.2

name	BC054438 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564090 CCDS:CCDS28506.1 GeneID:407831 MGI:3039635
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : cDNA sequence BC054438 protein_id : NP_001001183.1

name	Telo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311992 CCDS:CCDS28507.1 GeneID:71718 MGI:1918968
definition	codon_start : 1 exception : mismatches in translation product : TEL2, telomere maintenance 2, homolog protein_id : NP_082156.1

name	1110018H23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268670 GeneID:68509 MGI:1915759
definition	codon_start : 1 product : neuronal pentraxin II-like protein_id : XP_128459.3

name	Clcn7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753436 CCDS:CCDS28509.1 GeneID:26373 MGI:1347048
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : chloride channel 7 protein_id : NP_036060.1

name	Gm317 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268611 GeneID:207209 MGI:2685163
definition	codon_start : 1 product : hypothetical protein LOC207209 protein_id : XP_139904.6

name	BC003965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401788 GeneID:214489 MGI:2670966
definition	codon_start : 1 product : hypothetical protein LOC214489 protein_id : XP_128528.4

name	Unkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794158 CCDS:CCDS28510.1 GeneID:74154 MGI:1921404
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : Grailexp predicted product : unkempt-like protein_id : NP_083065.1

name	Gnptg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49457855 CCDS:CCDS28511.1 GeneID:214505 MGI:2147006
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] codon_start : 1 note : M6PR domain containing protein 1; M6PR domain-containing protein 1; mannose-6-phosphate receptor domain; T-complex expressed 7 product : M6PR domain-containing protein 1 precursor protein_id : NP_766117.2

name	0610007P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489947 CCDS:CCDS28512.1 GeneID:68327 MGI:1915577
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68327 protein_id : NP_080952.1

name	Ube2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549799 CCDS:CCDS28513.1 GeneID:22196 MGI:107365
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2I protein_id : NP_035795.1

name	Prss34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410030 CCDS:CCDS28514.1 GeneID:328780 MGI:2681414
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IC] codon_start : 1 note : mast cell protease-11; mast cell protease 11 product : protease, serine, 34 protein_id : NP_848459.1

name	Prss28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299758 CCDS:CCDS28515.1 GeneID:114661 MGI:2149951
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IMP] GO_process : GO:0007566 - embryo implantation [Evidence IMP] codon_start : 1 note : implantation serine protease 1 product : protease, serine, 28 protein_id : NP_444489.2

name	Prss29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716593 CCDS:CCDS28516.1 GeneID:114662 MGI:2149952
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : implantation serine protease 2 protein_id : NP_444490.1

name	Tpsab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981624 GeneID:17230 MGI:96943
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0030019 - tryptase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mast cell protease 7 protein_id : NP_112464.2

name	Mcpt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130496076 CCDS:CCDS28517.1 GeneID:17229 MGI:96942
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008201 - heparin binding [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0030019 - tryptase activity [Evidence IDA] GO_process : GO:0006954 - inflammatory response [Evidence TAS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 6 protein_id : NP_034911.3

name	Tpsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755819 CCDS:CCDS28518.1 GeneID:26945 MGI:1349391
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence ISS] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transmembrane tryptase product : tryptase gamma 1 protein_id : NP_036164.1

name	Cacna1h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62739190 GeneID:58226 MGI:1928842
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence ISS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0008332 - low voltage-gated calcium channel activity [Evidence ISS]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : T-type Cav3.2; low-voltage-activated calcium channel alpha13.2 subunit product : calcium channel alpha13.2 subunit protein_id : NP_067390.3

name	Tekt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625871 CCDS:CCDS28519.1 GeneID:71840 MGI:1919090
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : testicular microtubules-related protein 4 product : tektin 4 protein_id : NP_082227.1

name	Sstr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315983 CCDS:CCDS28520.1 GeneID:20609 MGI:894282
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004994 - somatostatin receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0050796 - regulation of insulin secretion [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : somatostatin receptor 5 protein_id : NP_035555.1

name	Sox8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563276 CCDS:CCDS28521.1 GeneID:20681 MGI:98370
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IGI]; GO:0048469 - cell maturation [Evidence IGI] [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SRY-box containing gene 8 protein_id : NP_035577.1

name	Tmem112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981342 GeneID:76483 MGI:1923733
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76483 protein_id : NP_083900.2

name	Gng13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967949 GeneID:64337 MGI:1925616
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IPI]; GO:0016020 - membrane [Evidence TAS] GO_function : GO:0003924 - GTPase activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IDA]; GO:0050909 - sensory perception of taste [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G gamma subunit, clone 2-35 product : guanine nucleotide binding protein 13, gamma protein_id : NP_071867.1

name	Chtf18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703816 CCDS:CCDS28523.1 GeneID:214901 MGI:2384887
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Chl12 homolog product : CTF18, chromosome transmission fidelity factor 18 homolog protein_id : NP_663384.1

name	Rpusd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076995 CCDS:CCDS28524.1 GeneID:106707 MGI:1919186
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0009982 - pseudouridine synthase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : ribosomal large subunit pseudouridine synthase C like product : RNA pseudouridylate synthase domain containing 1 protein_id : NP_082285.1

name	BC052484 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244378 CCDS:CCDS28525.1 GeneID:328783 MGI:3607710
definition	codon_start : 1 product : hypothetical protein LOC328783 protein_id : NP_808490.1

name	Msln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256568 CCDS:CCDS28526.1 GeneID:56047 MGI:1888992
definition	codon_start : 1 function : stimulates the megakasryocyte colony forming activity of murine interleukin-3 in mouse bone marrow cell culture note : megakaryocyte potentiating factor product : mesothelin protein_id : NP_061345.1

name	Narfl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981017 GeneID:67563 MGI:1914813
definition	codon_start : 1 exception : mismatches in translation product : nuclear prelamin A recognition factor-like protein_id : NP_080514.2

name	Haghl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312167 CCDS:CCDS28527.1 GeneID:68977 MGI:1919877
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : hydroxyacylglutathione hydrolase-like protein_id : NP_081173.1

name	Ccdc78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992525 GeneID:381077 MGI:2685784
definition	codon_start : 1 product : coiled-coil domain containing 78 protein_id : XP_354998.3

name	BC008155 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66955879 CCDS:CCDS28528.1 GeneID:214917 MGI:2384888
definition	codon_start : 1 product : hypothetical protein LOC214917 protein_id : NP_663385.2

name	Metrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317368 CCDS:CCDS28529.1 GeneID:70083 MGI:1917333
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0010001 - glial cell differentiation [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence IDA] codon_start : 1 note : hypoxia/reoxygenation regulatory factor in astrocytes product : meteorin protein_id : NP_598480.1

name	Fbxl16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268682 GeneID:214931 MGI:2448488
definition	codon_start : 1 product : similar to Fbxl16 protein isoform 1 protein_id : XP_001479873.1

name	Fbxl16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268684 GeneID:214931 MGI:2448488
definition	codon_start : 1 product : similar to Fbxl16 protein isoform 2 protein_id : XP_001479875.1

name	Wdr24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424575 CCDS:CCDS28531.1 GeneID:268933 MGI:2446285
definition	codon_start : 1 product : WD repeat domain 24 protein_id : NP_776102.1

name	2610003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312440 CCDS:CCDS28532.1 GeneID:72106 MGI:1919356
definition	codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2610003J06 protein_id : NP_082377.1

name	Stub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789907 CCDS:CCDS28533.1 GeneID:56424 MGI:1891731
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0031371 - ubiquitin conjugating enzyme complex [Evidence TAS]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0030544 - Hsp70 protein binding [Evidence TAS]; GO:0051879 - Hsp90 protein binding [Evidence ISS]; GO:0016874 - ligase activity [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence TAS]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0046332 - SMAD binding [Evidence ISS]; GO:0004842 - ubiquitin-protein ligase activity [Evidence TAS] [Evidence IEA] GO_process : GO:0043161 - proteasomal ubiquitin-dependent protein catabolism [Evidence ISS]; GO:0006457 - protein folding [Evidence TAS]; GO:0051604 - protein maturation [Evidence TAS]; GO:0000209 - protein polyubiquitination [Evidence ISS]; GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0030579 - ubiquitin-dependent SMAD protein catabolism [Evidence ISS] codon_start : 1 note : carboxy terminus of Hsp70-interacting protein product : STIP1 homology and U-box containing protein 1 protein_id : NP_062693.1

name	Rhbdl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450189 CCDS:CCDS28534.1 GeneID:214951 MGI:2384891
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : rhomboid, veinlet-like 1 protein_id : NP_659065.1

name	Rhot2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122457 GeneID:214952 MGI:2384892
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0031307 - integral to mitochondrial outer membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0019725 - cell homeostasis [Evidence ISS]; GO:0047497 - mitochondrion transport along microtubule [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : mitochondrial Rho 2 product : ras homolog gene family, member T2 protein_id : NP_666111.1

name	Wdr90 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268688 GeneID:106618 MGI:1921267
definition	codon_start : 1 product : hypothetical protein LOC106618 isoform 2 protein_id : XP_001479898.1

name	Wdr90 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268686 GeneID:106618 MGI:1921267
definition	codon_start : 1 product : hypothetical protein LOC106618 isoform 1 protein_id : XP_001479890.1

name	9530058B02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386124 CCDS:CCDS28535.1 GeneID:68241 MGI:1915491
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC68241 protein_id : NP_080909.1

name	0610011F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037115 CCDS:CCDS28536.1 GeneID:68347 MGI:1915597
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68347 protein_id : NP_080962.1

name	Wfikkn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992527 GeneID:215001 MGI:2670967
definition	codon_start : 1 product : similar to putative multivalent protease inhibitor WFIKKN protein_id : XP_128578.4

name	Rab40c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21040231 CCDS:CCDS28537.1 GeneID:224624 MGI:2183454
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : RAR (RAS like GTPASE) like; SOCS box containing protein RAR3 product : Rab40c, member RAS oncogene family protein_id : NP_631893.1

name	LOC100043160 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268690 GeneID:100043160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479941.1

name	Pigq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981380 CCDS:CCDS28538.1 GeneID:14755 MGI:1333114
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence IEA] codon_start : 1 note : phosphatidylinositol glycan, class Q; glycosylphosphatidylinositol homolog product : glycosylphosphatidylinositol 1 homolog protein_id : NP_035952.2

name	F430201B04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702336 CCDS:CCDS28539.1 GeneID:621239 MGI:3687200
definition	codon_start : 1 product : hypothetical protein LOC621239 protein_id : NP_001034127.1

name	Solh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657601 CCDS:CCDS28540.1 GeneID:50817 MGI:1355075
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004198 - calpain activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : small optic lobes protein_id : NP_056645.1

name	D630044L22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425260 GeneID:240054 MGI:3709661
definition	codon_start : 1 product : hypothetical protein LOC240054 protein_id : NP_780714.1

name	1700022N22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268693 GeneID:69431 MGI:1916681
definition	codon_start : 1 product : hypothetical protein LOC69431 protein_id : XP_001479964.1

name	Rab11fip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268696 GeneID:215445 MGI:2444431
definition	codon_start : 1 product : RAB11 family interacting protein 3 (class II) protein_id : XP_001479976.1

name	Rab11fip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770135 GeneID:215445 MGI:2444431
definition	codon_start : 1 product : RAB11 family interacting protein 3 (class II) isoform 1 protein_id : XP_484616.1

name	Rab11fip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401793 GeneID:215445 MGI:2444431
definition	codon_start : 1 product : RAB11 family interacting protein 3 (class II) isoform 9 protein_id : XP_994148.1

name	Decr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753622 CCDS:CCDS28543.1 GeneID:26378 MGI:1347059
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0008670 - 2,4-dienoyl-CoA reductase (NADPH) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 product : 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal protein_id : NP_036063.1

name	Nme4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790123 CCDS:CCDS28544.1 GeneID:56520 MGI:1931148
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 note : nucleoside diphosphate kinase product : nucleoside diphosphate kinase 4 protein_id : NP_062705.1

name	EG666609 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401818 GeneID:666609 MGI:3643110
definition	codon_start : 1 product : similar to Sm protein G protein_id : XP_990020.1

name	Tmem8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11140833 CCDS:CCDS28546.1 GeneID:60455 MGI:1926283
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : transmembrane protein 6; type I transmembrane protein product : transmembrane protein 8 (five membrane-spanning domains) protein_id : NP_068565.1

name	Mrpl28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26787989 GeneID:68611 MGI:1915861
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L28 protein_id : NP_077189.2

name	Axin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50979284 CCDS:CCDS28547.1 GeneID:12005 MGI:1096327
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016328 - lateral plasma membrane [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0030163 - protein catabolism [Evidence IDA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence IPI] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : axis inhibition product : axin 1 protein_id : NP_033863.1

name	Pdia2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486724 GeneID:69191 MGI:1916441
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003756 - protein disulfide isomerase activity [Evidence TAS]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : protein disulfide isomerase (pancreas) like; protein disulfide isomerase, pancreatic product : protein disulfide isomerase associated 2 protein_id : NP_001074539.1

name	Arhgdig (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679989 CCDS:CCDS28548.1 GeneID:14570 MGI:108430
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005094 - Rho GDP-dissociation inhibitor activity [Evidence IEA] codon_start : 1 note : guanosine diphosphate (GDP) dissociation inhibitor 5, Rho associated product : Rho GDP dissociation inhibitor (GDI) gamma protein_id : NP_032139.1

name	Rgs11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486718 GeneID:50782 MGI:1354739
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS] [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 product : regulator of G-protein signaling 11 protein_id : NP_001074538.1

name	Itfg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402185 GeneID:106581 MGI:2146854
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : integrin alpha FG-GAP repeat containing 3 protein_id : NP_997100.1

name	Luc7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158677 CCDS:CCDS28549.1 GeneID:66978 MGI:1914228
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045843 - negative regulation of striated muscle development [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Luc7 homolog (S. cerevisiae)-like isoform 2 protein_id : NP_082466.2

name	Luc7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536228 CCDS:CCDS28550.1 GeneID:66978 MGI:1914228
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045843 - negative regulation of striated muscle development [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Luc7 homolog (S. cerevisiae)-like isoform 1 protein_id : NP_080157.1

name	EG383229 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401821 GeneID:383229 MGI:3649055
definition	codon_start : 1 product : similar to Hemoglobin subunit alpha (Hemoglobin alpha chain) (Alpha-globin) protein_id : XP_356935.3

name	EG240055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116567 GeneID:240055 MGI:3643092
definition	codon_start : 1 note : neuralized-2 product : neuralized 2 protein_id : NP_001075125.1

name	C230078M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892843 GeneID:319749 MGI:2442659
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319749 protein_id : NP_795969.1

name	LOC432543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:432543
definition	number : 2 pseudo : _no_value

name	LOC432543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:432543
definition	number : 1 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 1 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 2 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 3 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 4 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 5 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 6 pseudo : _no_value

name	LOC100042580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042580
definition	number : 2 pseudo : _no_value

name	LOC100042580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042580
definition	number : 1 pseudo : _no_value

name	LOC545396 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:545396
definition	number : 1 pseudo : _no_value

name	LOC100042643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042643
definition	number : 1 pseudo : _no_value

name	LOC100042643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042643
definition	number : 2 pseudo : _no_value

name	Snora64 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604684 GeneID:104366 MGI:2148175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 64 transcript_id : NR_002897.1

clone name	MSMg01-205A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-399H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-088C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-304D04.b	B6Ng01-304D04.g
ACC	GA097813	GA097814
length	917	439
definition	B6Ng01-304D04.b	B6Ng01-304D04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(25,636,023 - 25,636,936)	(25,475,552 - 25,475,996)
sequence	gaattccataaggtgaggaatgagtcttaccacacacccctcagtggcta gcctacagttagtcctcagatgagacgctgagagtgaggtctactctggt ctggcctgtgccccactagtgctatccctaggatggctctatggccaaag gcaaccctatgctctgcctgcagcacctcaggttcagatggcagccagag gccagcacctgtcactcttcattccatgtcccataagaggaaaattctct gagaaggagccaacctctctgtggctaagcaaggtcgtgagggtgtgtgt gctggcgtttcaggtgtgggtagccttggtctttgccagctcagagacta ggaagctggaaacatgggaccctgcacactctgttggtgtgaggtgtggt caagtggggataagcctgaatagggttttgttggagatctgggctattgt ctctgttgtcccagttggaggagtctaggcagatgttctgtctagaagca gcctcttgagactgcctttgctggtctctggccaaactcaactggttact ctgtctgtctcccagtcttggacatggtttcactaagcagtgtgggtaaa tgaggggctggtgaggagcagcagttgggaggagaatcacaaatggggac agtggctggaatggagtagaggcagaactgtggatcagaacaaggagtca cattgggaccagcaccagtgtcatggctccctcgctcagccacagagctt cttgctaccctggggccttcaatcctctgacttctgcctaagtctcttcc tcagtagaccacactgcatttggagatggttcccagcctcctgcttgtct tttattacagtctaaaatttcttatttttattatttttatttatgtgtac ggtgttgtacctgtgtg	tcagaaagctgtcctccctgacatggacagtgacagcccacaaagagctg acaggtcacaaaggagagggtacgagagaaggctccctttgtacatgagt ggacattgcggggtggctagggtgtgcactgatagctttctctctgtgtg ggcaggctggctgtatagagtcaatgccggtcttcctcaggaacctaaca ccttagctactgttccattgctgtgaagagacaccatgacaaaggcaact catgagataaggcatttaattggggacttggttacagttttagagggtga gcccatcattatttctgcacaaagaagaccatggtgctggagcagtagct gagagctttgcatcctgatgtacaggcagcagggagagagagagagagag agagagagagagagagagagagagagagagagagagaag
quality values	Open. Hide. 31 13 22 24 58 58 31 17 58 52 46 46 49 44 46 34 28 38 18 19 22 62 62 62 62 62 62 62 62 54 11 10 16 10 24 12 11 11 15 10 15 10 17 17 13 38 34 59 62 62 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 56 59 62 54 54 46 59 28 18 39 34 21 32 18 27 34 34 32 28 35 46 59 59 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 54 62 62 54 54 62 54 54 62 62 62 59 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 50 54 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 49 48 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 46 49 49 35 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 51 62 62 62 62 62 62 62 56 62 56 56 47 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 56 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 43 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 52 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 44 58 54 54 58 58 58 58 58 58 58 52 54 45 58 58 52 58 58 58 54 58 58 58 58 58 52 54 58 58 46 58 58 52 58 49 58 54 58 58 58 52 54 54 34 49 58 46 58 50 42 58 58 34 58 49 58 58 58 58 36 58 58 38 51 48 37 50 58 53 58 52 51 46 47 31 31 41 45 47 50 50 52 58 49 50 51 58 44 58 51 39 58 49 51 21 39 39 25 58 28 35 30 51 37 58 46 53 51 58 49 39 58 38 41 49 35 22 58 50 50 35 51 33 58 39 27 50 52 52 50 43 37 47 44 41 41 33 30 50 32 52 50 30 39 54 52 51 31 58 50 37 42 53 52 51 40 41 19 54 54 38 37 40 35 40 40 27 17 41 44 32 53 52 39 54 15 41 39 54 40 39 32 40 37 28 23 30 54 54 35 38 34 34 44 34 35 24 23 19 12 27 29 33 29 34 25 23 32 53 24 37 54 40 52 45 49 44 33 42 46 26 37 39 34 33 34 37 34 34 41 34 31 34 27 32 26 41 31 37 34 45 32 34 27 31 31 30 28 51 24 33 29 25 8 53 28 24 11 14 31 28 53 18 26 14 47 31 31 36 43 30 40 31 31 33 25 23 16 6 41 36 16 21 37 37 31 31 29 19 31 40 21 26 37 37 30 9 45 40 30 20 10 11 22 30 46 48 42 18 11 43 22 7 46 46 46 12 12 29 42 31 40 27 33 22 18 23 24 31 11 17 7 27 22 15 27 10 19 37 35 22 13 10 20 16 9	Open. Hide. 62 59 59 45 11 12 15 11 13 13 10 18 10 10 13 10 10 9 12 16 43 59 59 62 62 62 59 62 59 62 59 59 59 62 59 62 62 62 59 62 62 54 56 59 56 62 59 59 59 18 22 30 13 13 27 28 23 34 23 25 25 25 28 36 54 46 54 62 62 62 62 59 59 51 62 46 54 59 59 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 54 54 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 42 54 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 46 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 46 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 62 49 49 59 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 56 46 43 62 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 62 56 33 38 24 24 19 56 31 36 38 62 43 43 43 62 56 62 62 62 47 62 47 47 62 62 43 62 41 62 52 62 52 47 40 40 26 31 24 22 20 20 21 40 46 40 40 40 40 39 43 38 38 46 46 46 26 34 24 38 30 38 31 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_25636023_25636936
seq2: B6Ng01-304D04.b_48_964 (reverse)

seq1  CACACAGGTACAACACCGTACACATAAAT-AAAATAATAAAAATAAGAAA  49
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  CACACAGGTACAACACCGTACACATAAATAAAAATAATAAAAATAAGAAA  50

seq1  TTTTAGACTGTAAT-AAAGACAAGCAGGAGGCTGGGAACCATCTCC-AAT  97
      |||||||||||||| ||||||||||||||||||||||||||||||| |||
seq2  TTTTAGACTGTAATAAAAGACAAGCAGGAGGCTGGGAACCATCTCCAAAT  100

seq1  GCAGTGTGGTCTACTGAGGAAGAGACTTAGGCAGAAGTCAGAGGATTGAA  147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTGTGGTCTACTGAGGAAGAGACTTAGGCAGAAGTCAGAGGATTGAA  150

seq1  GGCCCCAGGGTAGCAAGAAGCTCTGTGGCTGAGCGAGGGAGCCATGACAC  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCCAGGGTAGCAAGAAGCTCTGTGGCTGAGCGAGGGAGCCATGACAC  200

seq1  TGGTGCTGGTCCCAATGTGACTCCTTGTTCTGATCCACAGTTCTGCCTCT  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGCTGGTCCCAATGTGACTCCTTGTTCTGATCCACAGTTCTGCCTCT  250

seq1  ACTCCATTCCAGCCACTGTCCCCATTTGTGATTCTCCTCCCAACTGCTGC  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCATTCCAGCCACTGTCCCCATTTGTGATTCTCCTCCCAACTGCTGC  300

seq1  TCCTCACCAGCCCCTCATTTACCCACACTGCTTAGTGAAACCATGTCCAA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCACCAGCCCCTCATTTACCCACACTGCTTAGTGAAACCATGTCCAA  350

seq1  GACTGGGAGACAGACAGAGTAACCAGTTGAGTTTGGCCAGAGACCAGCAA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGGGAGACAGACAGAGTAACCAGTTGAGTTTGGCCAGAGACCAGCAA  400

seq1  AGGCAGTCTCAAGAGGCTGCTTCTAGACAGAACATCTGCCTAGACTCCTC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGTCTCAAGAGGCTGCTTCTAGACAGAACATCTGCCTAGACTCCTC  450

seq1  CAACTGGGACAACAGAGACAATAGCCCAGATCTCCAACAAAACCCTATTC  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTGGGACAACAGAGACAATAGCCCAGATCTCCAACAAAACCCTATTC  500

seq1  AGGCTTATCCCCACTTGACCACACCTCACACCAACAGAGTGTGCAGGGTC  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTTATCCCCACTTGACCACACCTCACACCAACAGAGTGTGCAGGGTC  550

seq1  CCATGTTTCCAGCTTCCTAGTCTCTGAGCTGGCAAAGACCAAGGCTACCC  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGTTTCCAGCTTCCTAGTCTCTGAGCTGGCAAAGACCAAGGCTACCC  600

seq1  ACACCTGAAACGCCAGCACACACACCCTCACGACCTTGCTTAGCCACAGA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCTGAAACGCCAGCACACACACCCTCACGACCTTGCTTAGCCACAGA  650

seq1  GAGGTTGGCTCCTTCTCAGAGAATTTTCCTCTTATGGGACATGGAATGAA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTTGGCTCCTTCTCAGAGAATTTTCCTCTTATGGGACATGGAATGAA  700

seq1  GAGTGACAGGTGCTGGCCTCTGGCTGCCATCTGAACCTGAGGTGCTGCAG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGACAGGTGCTGGCCTCTGGCTGCCATCTGAACCTGAGGTGCTGCAG  750

seq1  GCAGAGCATAGGGTTGCCTTTGGCCATAGAGCCATCCTAGGGATAGCACT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAGCATAGGGTTGCCTTTGGCCATAGAGCCATCCTAGGGATAGCACT  800

seq1  AGTGGGGCACAGGCCAGACCAGAGTAGACCTCACTCTCAGCGTCTCATCT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGGGCACAGGCCAGACCAGAGTAGACCTCACTCTCAGCGTCTCATCT  850

seq1  GAGGACTAACTGTAGGCTAGCCACTGAGGGGTGTGTGGTAAGACTCATTC  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGACTAACTGTAGGCTAGCCACTGAGGGGTGTGTGGTAAGACTCATTC  900

seq1  CTCACCTTATGGAATTC  914
      |||||||||||||||||
seq2  CTCACCTTATGGAATTC  917

seq1: chr17_25475552_25475996
seq2: B6Ng01-304D04.g_67_511

seq1  GAATTCTCAGAAAGCTGTCCTCCCTGACATGGACAGTGACAGCCCACAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCAGAAAGCTGTCCTCCCTGACATGGACAGTGACAGCCCACAAA  50

seq1  GAGCTGACAGGTCACAAAGGAGAGGGTACGAGAGAAGGCTCCCTTTGTAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTGACAGGTCACAAAGGAGAGGGTACGAGAGAAGGCTCCCTTTGTAC  100

seq1  ATGAGTGGACATTGCGGGGTGGCTAGGGTGTGCACTGATAGCTTTCTCTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGTGGACATTGCGGGGTGGCTAGGGTGTGCACTGATAGCTTTCTCTC  150

seq1  TGTGTGGGCAGGCTGGCTGTATAGAGTCAATGCCGGTCTTCCTCAGGAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGGGCAGGCTGGCTGTATAGAGTCAATGCCGGTCTTCCTCAGGAAC  200

seq1  CTAACACCTTAGCTACTGTTCCATTGCTGTGAAGAGACACCATGACAAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAACACCTTAGCTACTGTTCCATTGCTGTGAAGAGACACCATGACAAAG  250

seq1  GCAACTCATGAGATAAGGCATTTAATTGGGGACTTGGTTACAGTTTTAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAACTCATGAGATAAGGCATTTAATTGGGGACTTGGTTACAGTTTTAGA  300

seq1  GGGTGAGCCCATCATTATTTCTGCACAAAGAAGACCATGGTGCTGGAGCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGAGCCCATCATTATTTCTGCACAAAGAAGACCATGGTGCTGGAGCA  350

seq1  GTAGCTGAGAGCTTTGCATCCTGATGTACAGGCAGCAGGGAGAGAGAGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCTGAGAGCTTTGCATCCTGATGTACAGGCAGCAGGGAGAGAGAGAG  400

seq1  AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAG  445
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAG  445

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information