MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-340N13
Chromosome	17 (Build37)
Map Location	32,712,180 - 32,824,692
singlet/doublet	doublet
Overlap gene	LOC667178, LOC677156, EG631304, Cyp4f15
Upstream gene	Pknox1, Cbs, LOC623242, U2af1, Cryaa, Snf1lk, Hsf2bp, Rrp1b, LOC435518, Notch3, Pdxk-ps, Abhd9, Brd4, LOC100043434, LOC100043433, Akap8, Akap8l, Wiz, A430107D22Rik, Pglyrp2, 4732474A20Rik, EG208285, Cyp4f16
Downstream gene	LOC623809, 9030612M13Rik, Zfp811, 6030490I01Rik, LOC631266, BC066107, Cyp4f14, Cyp4f13, 6030422M01Rik, Zfp472, C920016K16Rik, 1700065O13Rik, 4921501E09Rik, Zfp563, Morc2b, LOC100038859, LOC100038860, LOC100043474, Zfp422-rs1, Olfr63, LOC100043468, Zfp81, Zfp101, 1700029I08Rik, LOC100042953, Adamts10, Myo1f, Zfp414, Pram1, Hnrpm, March2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pknox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18771 MGI:1201409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12411 MGI:88285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC623242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1398 ESTs, 8 Proteins pseudo : _no_value

name	U2af1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108121 MGI:98884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cryaa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12954 MGI:88515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snf1lk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17691 MGI:104754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsf2bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74377 MGI:1921627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 32 ESTs, 1 Protein

name	Rrp1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72462 MGI:1919712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435518 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Notch3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18131 MGI:99460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdxk-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140553 MGI:1933201
definition	note : pyridoxal (pyridoxine, vitamin B6) kinase, pseudogene pseudo : _no_value

name	Abhd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71932 MGI:1919182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57261 MGI:1888520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043434 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	LOC100043433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Akap8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56399 MGI:1928488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akap8l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54194 MGI:1860606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wiz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22404 MGI:1332638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	A430107D22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320484 MGI:2444128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pglyrp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57757 MGI:1928099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732474A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320997 MGI:2445210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG208285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208285 MGI:3646233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 24 Proteins

name	Cyp4f16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70101 MGI:1917351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC677156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 41 Proteins

name	EG631304 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631304 MGI:3645508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	Cyp4f15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106648 MGI:2146921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623809 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	9030612M13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208292 MGI:1921793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp811 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240063 MGI:2682944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030490I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240064 MGI:2443934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631266 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 10 Proteins pseudo : _no_value

name	BC066107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240066 MGI:3029586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4f14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64385 MGI:1927669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4f13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170716 MGI:2158641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030422M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77875 MGI:1925125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zfp472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224691 MGI:2385049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C920016K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240067 MGI:2441928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700065O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73451 MGI:1920701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921501E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74042 MGI:1921292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240068 MGI:2677168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morc2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240069 MGI:3045293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038860 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1110 Proteins

name	Zfp422-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77652 MGI:3028594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 108 ESTs

name	Olfr63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258939 MGI:1335096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs

name	Zfp81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224694 MGI:1890752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22643 MGI:107547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700029I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69481 MGI:1916731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Adamts10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224697 MGI:2449112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17916 MGI:107711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328801 MGI:1915641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pram1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378460 MGI:3576625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76936 MGI:1926465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	March2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224703 MGI:1925915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pknox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368579 GeneID:18771 MGI:1201409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Pbx/knotted 1 homeobox transcript_id : NM_016670.2

name	Cbs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130062 GeneID:12411 MGI:88285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystathionine beta-synthase transcript_id : NM_144855.2

name	Cbs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130577 GeneID:12411 MGI:88285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystathionine beta-synthase transcript_id : NM_178224.2

name	U2af1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353372 GeneID:108121 MGI:98884
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 transcript_id : NM_024187.3

name	Cryaa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931666 GeneID:12954 MGI:88515
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, alpha A transcript_id : NM_013501.2

name	Snf1lk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815829 GeneID:17691 MGI:104754
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF1-like kinase transcript_id : NM_010831.2

name	Hsf2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268656 GeneID:74377 MGI:1921627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 32 ESTs, 1 Protein product : heat shock transcription factor 2 binding protein transcript_id : XM_484622.4

name	Rrp1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076996 GeneID:72462 MGI:1919712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal RNA processing 1 homolog B (S. cerevisiae) transcript_id : NM_028244.1

name	Notch3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130663 GeneID:18131 MGI:99460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch gene homolog 3 (Drosophila) transcript_id : NM_008716.2

name	Abhd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369966 GeneID:71932 MGI:1919182
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 9 transcript_id : NM_001033163.2

name	Brd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560787 GeneID:57261 MGI:1888520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 4 transcript_id : NM_020508.2

name	Brd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674286 GeneID:57261 MGI:1888520
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 4 transcript_id : NM_198094.1

name	LOC100043433 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268731 GeneID:100043433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043433 transcript_id : XM_001480478.1

name	Akap8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801979 GeneID:56399 MGI:1928488
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 8 transcript_id : NM_019774.3

name	Akap8l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70780372 GeneID:54194 MGI:1860606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 8-like transcript_id : NM_017476.2

name	Wiz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909564 GeneID:22404 MGI:1332638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : widely-interspaced zinc finger motifs transcript_id : NM_212438.1

name	Wiz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909562 GeneID:22404 MGI:1332638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : widely-interspaced zinc finger motifs transcript_id : NM_011717.2

name	A430107D22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502227 GeneID:320484 MGI:2444128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430107D22 gene transcript_id : NM_178785.3

name	Pglyrp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476059 GeneID:57757 MGI:1928099
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 2 transcript_id : NM_021319.2

name	4732474A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361891 GeneID:320997 MGI:2445210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732474A20 gene transcript_id : NM_177307.3

name	EG208285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268657 GeneID:208285 MGI:3646233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 24 Proteins product : predicted gene, EG208285 transcript_id : XM_139863.7

name	Cyp4f16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13277361 GeneID:70101 MGI:1917351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 16 transcript_id : NM_024442.1

name	LOC677156 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268738 GeneID:677156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 41 Proteins product : similar to cytochrome P450, family 4, subfamily f, polypeptide 16 transcript_id : XM_001480532.1

name	EG631304 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401873 GeneID:631304 MGI:3645508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : predicted gene, EG631304 transcript_id : XM_988992.1

name	Cyp4f15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373164 GeneID:106648 MGI:2146921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 15 transcript_id : NM_134127.1

name	9030612M13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140969611 GeneID:208292 MGI:1921793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030612M13 gene transcript_id : NM_172458.3

name	Zfp811 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147227 GeneID:240063 MGI:2682944
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 811 transcript_id : NM_183177.1

name	6030490I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793417 GeneID:240064 MGI:2443934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030490I01 gene transcript_id : NM_177359.3

name	BC066107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402246 GeneID:240066 MGI:3029586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC066107 transcript_id : NM_207245.1

name	Cyp4f14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11967964 GeneID:64385 MGI:1927669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 14 transcript_id : NM_022434.1

name	Cyp4f13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373154 GeneID:170716 MGI:2158641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 13 transcript_id : NM_130882.1

name	6030422M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401875 GeneID:77875 MGI:1925125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 6030422M01 gene transcript_id : XM_128564.4

name	Zfp472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377185 GeneID:224691 MGI:2385049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 472 transcript_id : NM_153063.2

name	C920016K16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930751 GeneID:240067 MGI:2441928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C920016K16 gene transcript_id : NM_001045559.1

name	1700065O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802452 GeneID:73451 MGI:1920701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700065O13 gene transcript_id : NM_028543.2

name	4921501E09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222273 GeneID:74042 MGI:1921292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921501E09 gene transcript_id : NM_001009544.1

name	Zfp563 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930757 GeneID:240068 MGI:2677168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 563 transcript_id : NM_001024950.2

name	Morc2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354229 GeneID:240069 MGI:3045293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microrchidia 2B transcript_id : NM_177719.3

name	LOC100038859 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268461 GeneID:100038859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038859 transcript_id : XM_001471659.1

name	LOC100038860 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268463 GeneID:100038860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038860 transcript_id : XM_001471916.1

name	LOC100043474 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268754 GeneID:100043474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1110 Proteins product : similar to olfactory receptor Olr1092 transcript_id : XM_001480594.1

name	Zfp422-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268744 GeneID:77652 MGI:3028594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 108 ESTs product : zinc finger protein 422, related sequence 1 transcript_id : XM_001480577.1

name	Olfr63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128642 GeneID:258939 MGI:1335096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 63 transcript_id : NM_146937.1

name	LOC100043468 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268748 GeneID:100043468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs product : similar to Zinc finger protein 422, related sequence 1 transcript_id : XM_001480580.1

name	Zfp81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432559 GeneID:224694 MGI:1890752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 81 transcript_id : NM_207541.1

name	Zfp101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119120796 GeneID:22643 MGI:107547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 101 transcript_id : NM_009542.2

name	1700029I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662420 GeneID:69481 MGI:1916731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029I08 gene transcript_id : NM_183282.2

name	LOC100042953 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268658 GeneID:100042953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to nuclear factor, interleukin 3 regulated transcript_id : XM_001479150.1

name	Adamts10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064868 GeneID:224697 MGI:2449112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 transcript_id : NM_172619.2

name	Myo1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859762 GeneID:17916 MGI:107711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IF transcript_id : NM_053214.1

name	Zfp414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892660 GeneID:328801 MGI:1915641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 414 transcript_id : NM_026712.2

name	Pram1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50726895 GeneID:378460 MGI:3576625
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PML-RAR alpha-regulated adaptor molecule 1 transcript_id : NM_001002842.1

name	Hnrpm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803569 GeneID:76936 MGI:1926465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein M transcript_id : NM_029804.2

name	March2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349138 GeneID:224703 MGI:1925915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-associated ring finger (C3HC4) 2 transcript_id : NM_145486.3

name	Pknox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368580 CCDS:CCDS28608.1 GeneID:18771 MGI:1201409
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Pbx/knotted 1 homeobox protein_id : NP_057879.2

name	Cbs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089694 CCDS:CCDS28610.1 GeneID:12411 MGI:88285
definition	EC_number : 4.2.1.22 GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004122 - cystathionine beta-synthase activity [Evidence IEA] GO_process : GO:0019343 - cysteine biosynthesis via cystathione [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cystathionine beta-synthase isoform 2 protein_id : NP_835742.1

name	Cbs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450071 CCDS:CCDS28609.1 GeneID:12411 MGI:88285
definition	EC_number : 4.2.1.22 GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004122 - cystathionine beta-synthase activity [Evidence IEA] GO_process : GO:0019343 - cysteine biosynthesis via cystathione [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cystathionine beta-synthase isoform 1 protein_id : NP_659104.1

name	U2af1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17530980 CCDS:CCDS28611.1 GeneID:108121 MGI:98884
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 exception : mismatches in translation note : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF),35 kDa product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 protein_id : NP_077149.1

name	Cryaa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794510 GeneID:12954 MGI:88515
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence TAS] GO_process : GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0000072 - M phase specific microtubule process [Evidence IMP]; GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 note : lens opacity 18; crystallin, alpha 1; alpha-A-crystallin product : crystallin, alpha A protein_id : NP_038529.1

name	Snf1lk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815830 GeneID:17691 MGI:104754
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IDA] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0045595 - regulation of cell differentiation [Evidence IEP]; GO:0007346 - regulation of progression through mitotic cell cycle [Evidence IDA] codon_start : 1 note : SNF1-like kinase (MGD\|MGI:104754 GB\|NM_010831, evidence: BLASTN, 98%, match=4488); putative; myocardial SNF1-like kinase; salt inducible kinase product : SNF1-like kinase protein_id : NP_034961.2

name	Hsf2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401867 GeneID:74377 MGI:1921627
definition	codon_start : 1 product : heat shock transcription factor 2 binding protein protein_id : XP_484622.3

name	Rrp1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076997 CCDS:CCDS28613.1 GeneID:72462 MGI:1919712
definition	GO_component : GO:0030688 - nucleolar preribosome, small subunit precursor [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0004784 - superoxide dismutase activity [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribosomal RNA processing 1 homolog B protein_id : NP_082520.1

name	Notch3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679096 CCDS:CCDS28614.1 GeneID:18131 MGI:99460
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IGI]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0045665 - negative regulation of neuron differentiation [Evidence IMP]; GO:0048663 - neuron fate commitment [Evidence IGI]; GO:0007219 - Notch signaling pathway [Evidence IEA] [Evidence IC]; GO:0050793 - regulation of development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Notch gene homolog 3 protein_id : NP_032742.1

name	Abhd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716015 CCDS:CCDS28615.1 GeneID:71932 MGI:1919182
definition	codon_start : 1 product : abhydrolase domain containing 9 protein_id : NP_001028335.1

name	Brd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560788 GeneID:57261 MGI:1888520
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0043388 - positive regulation of DNA binding [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; bromodomain-containing 5; fsh-like protein product : bromodomain containing 4 isoform 1 protein_id : NP_065254.2

name	Brd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674287 GeneID:57261 MGI:1888520
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0043388 - positive regulation of DNA binding [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; bromodomain-containing 5; fsh-like protein product : bromodomain containing 4 isoform 2 protein_id : NP_932762.1

name	LOC100043433 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268732 GeneID:100043433
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480528.1

name	Akap8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560394 GeneID:56399 MGI:1928488
definition	GO_component : GO:0000793 - condensed chromosome [Evidence IDA] [Evidence ISS]; GO:0001939 - female pronucleus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0000790 - nuclear chromatin [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007076 - mitotic chromosome condensation [Evidence ISS] [Evidence IDA] codon_start : 1 note : A kinase anchor protein 95 product : A kinase anchor protein 8 protein_id : NP_062748.2

name	Akap8l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70780373 GeneID:54194 MGI:1860606
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : neighbor of A-kinase anchoring protein 95 product : A kinase (PRKA) anchor protein 8-like protein_id : NP_059504.2

name	Wiz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909563 CCDS:CCDS28616.1 GeneID:22404 MGI:1332638
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : widely-interspaced zinc finger motifs isoform 2 protein_id : NP_035847.2

name	Wiz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909565 CCDS:CCDS28617.1 GeneID:22404 MGI:1332638
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : widely-interspaced zinc finger motifs isoform 1 protein_id : NP_997603.1

name	A430107D22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130502228 GeneID:320484 MGI:2444128
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320484 protein_id : NP_848900.2

name	Pglyrp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946624 GeneID:57757 MGI:1928099
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0016020 - membrane [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0016019 - peptidoglycan receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0050830 - defense response to Gram-positive bacterium [Evidence ISS]; GO:0016045 - detection of bacterium [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence ISS]; GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : TAG-like; peptidoglycan recognition protein-like product : peptidoglycan recognition protein 2 protein_id : NP_067294.1

name	4732474A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893407 CCDS:CCDS28618.1 GeneID:320997 MGI:2445210
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0050051 - leukotriene-B4 20-monooxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : cytochrome P450, family 2, subfamily E, polypeptide 2 homolog protein_id : NP_796281.1

name	EG208285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992694 GeneID:208285 MGI:3646233
definition	codon_start : 1 product : similar to cytochrome P450 4F6 protein_id : XP_139863.4

name	Cyp4f16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277362 CCDS:CCDS28619.1 GeneID:70101 MGI:1917351
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : cytochrome P450, 4f16 product : cytochrome P450, family 4, subfamily f, polypeptide 16 protein_id : NP_077762.1

name	LOC677156 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268739 GeneID:677156
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480582.1

name	EG631304 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401874 GeneID:631304 MGI:3645508
definition	codon_start : 1 product : similar to Cyp4f15 protein protein_id : XP_994086.1

name	Cyp4f15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373165 CCDS:CCDS28620.1 GeneID:106648 MGI:2146921
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, 4f15 product : cytochrome P450 CYP4F15 protein_id : NP_598888.1

name	9030612M13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140969612 GeneID:208292 MGI:1921793
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208292 protein_id : NP_766046.3

name	Zfp811 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147228 GeneID:240063 MGI:2682944
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 811 protein_id : NP_899000.1

name	6030490I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793418 GeneID:240064 MGI:2443934
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein protein_id : NP_796333.2

name	BC066107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402247 GeneID:240066 MGI:3029586
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240066 protein_id : NP_997128.1

name	Cyp4f14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967965 CCDS:CCDS28621.1 GeneID:64385 MGI:1927669
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0050051 - leukotriene-B4 20-monooxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, subfamily IVF, polypeptide 14 (leukotriene B4 omega hydroxylase) product : cytochrome P450, family 4, subfamily f, polypeptide 14 protein_id : NP_071879.1

name	Cyp4f13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373155 CCDS:CCDS28622.1 GeneID:170716 MGI:2158641
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : cytochrome P450,subfamily IVF, polypeptide 13; cytochrome P450 CYP4F13; leukotriene B4 omega hydroxylase product : cytochrome P450, family 4, subfamily f, polypeptide 13 protein_id : NP_570952.1

name	6030422M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20899446 GeneID:77875 MGI:1925125
definition	codon_start : 1 product : hypothetical protein LOC77875 protein_id : XP_128564.1

name	Zfp472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346459 GeneID:224691 MGI:2385049
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : KRAB box containing zinc finger protein; Krab box proteins interacting with myc 1; zin finger protein 472 product : zinc finger protein 472 protein_id : NP_694703.1

name	C920016K16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930752 GeneID:240067 MGI:2441928
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240067 protein_id : NP_001039024.1

name	1700065O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037331 GeneID:73451 MGI:1920701
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : RIKEN cDNA 1700065O13 protein_id : NP_082819.1

name	4921501E09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222274 CCDS:CCDS28624.1 GeneID:74042 MGI:1921292
definition	codon_start : 1 note : KIAA1111-like protein product : PHD finger protein 8 protein_id : NP_001009544.1

name	Zfp563 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930758 GeneID:240068 MGI:2677168
definition	codon_start : 1 note : zinc finger protein NTfin7 product : zinc finger protein ZFP413 protein_id : NP_001020121.2

name	Morc2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244180 GeneID:240069 MGI:3045293
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Morc-like protein product : microrchidia 2B protein_id : NP_808387.1

name	LOC100038859 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268462 GeneID:100038859
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471709.1

name	LOC100038860 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268464 GeneID:100038860
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471966.1

name	LOC100043474 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268755 GeneID:100043474
definition	codon_start : 1 product : similar to olfactory receptor Olr1092 protein_id : XP_001480644.1

name	Zfp422-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268745 GeneID:77652 MGI:3028594
definition	codon_start : 1 product : zinc finger protein 422, related sequence 1 protein_id : XP_001480627.1

name	Olfr63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128643 GeneID:258939 MGI:1335096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NTC5-9778-8828 product : olfactory receptor 63 protein_id : NP_667148.1

name	LOC100043468 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268749 GeneID:100043468
definition	codon_start : 1 product : similar to Zinc finger protein 422, related sequence 1 protein_id : XP_001480630.1

name	Zfp81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432560 GeneID:224694 MGI:1890752
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : ZFP-36 zinc finger protein product : zinc finger protein 81 protein_id : NP_997424.1

name	Zfp101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119120797 GeneID:22643 MGI:107547
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 101 protein_id : NP_033568.2

name	1700029I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662421 GeneID:69481 MGI:1916731
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69481 protein_id : NP_899105.2

name	LOC100042953 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268659 GeneID:100042953
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479200.1

name	Adamts10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064869 GeneID:224697 MGI:2449112
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc metalloendopeptidase product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10 protein_id : NP_766207.2

name	Myo1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859763 GeneID:17916 MGI:107711
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myosin-1F-like protein product : myosin IF protein_id : NP_444444.1

name	Zfp414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34850068 GeneID:328801 MGI:1915641
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger, C2H2 type containing protein product : zinc finger protein 414 protein_id : NP_080988.1

name	Pram1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50726896 GeneID:378460 MGI:3576625
definition	codon_start : 1 exception : mismatches in translation product : PML-RARA regulated adaptor molecule 1 protein_id : NP_001002842.1

name	Hnrpm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313308 GeneID:76936 MGI:1926465
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein M protein_id : NP_084080.1

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 11 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 10 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 9 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 8 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 7 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 6 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 5 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 4 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 3 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 2 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 1 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 1 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 2 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 3 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 4 pseudo : _no_value

name	LOC623809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623809
definition	number : 1 pseudo : _no_value

name	LOC623242 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268730 GeneID:623242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1398 ESTs, 8 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_034688.1

name	LOC100043434 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268733 GeneID:100043434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to ribosomal protein L34 pseudo : _no_value transcript_id : XR_034714.1

name	LOC631266 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268752 GeneID:631266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 10 Proteins product : similar to ribosomal protein L7 pseudo : _no_value transcript_id : XR_034756.1

clone name	MSMg01-394E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297J06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-340N13.b	B6Ng01-340N13.g
ACC	GA124415	GA124416
length	1,194	1,153
definition	B6Ng01-340N13.b	B6Ng01-340N13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(32,823,475 - 32,824,692)	(32,712,180 - 32,713,323)
sequence	gaattcctatgcacaatatctttattattgttatcctatatatagatgta tttagatacataaacaccattgtcttacaaatacctacaatatttaggac agcaacatgatgtgaagatttgcacaagtagcctacactatatgggtttg tgctgagtcctgctccatctttctcagggttatggctgagtctcaagggt ctatcccagggccaatggagaaggtatacagcctacgtcagagatagcca ccttggcttgcgaagatgaatgttctctggtggtattaatttcagcccca gggaccatcatcagggaaggtctcaaccgggacttaggggtgtctaggca acattgaagcctgttagttgtaattgacaacttgacagggcctctactca cctgagaagggagtctcagttgcatggtactgccagatcagagtggtctg tgggcacatctttgggggactgtcttaattgttagttgatttagaagcac ccagccattctacctgtcaccattttctgcacagatagttctggactgta tttttcaaaagctagctaaacatgtgcttgagagtgagcaaatgggcagt gtttctccacgctttctgtctcaagttcctgctggagttcctaccttgac taccctcaaacaaactttttcctcctgaggtcacttttggtcagtgtttt atcacagcaacagaatgaaacaaaacttggataggtctgcagttccaact gtgcaaaaggtctgcagagcagggactagtcaactccaggacaagagggg accactaattctctaggagggcagaaactcctacctgtgaggccccatgc tctcaccaacatcaccctgcgtatgatgtcactgatgtgtacagatgttg tgagcttcggtgtttgcaagtgaagcaactgagaccgagtcacccaaagg caagacagacttggtcaaatctaagcacggggtcaaggaatgctacggag gtgaagagacactcttattttcagtgggcacagactcaatggtcattctt agggagactgacagcttaagtaaaagtgcttcagacaagaggcagagaac aactcataacttcttctgcttcatgggttgtaggaaggaatatccgagat tacctaggcaacgtgtactcggtatatggattcacgaaaaatgg	gaattctgggatagagtcaggtgcaggaaaagatttcaccctggactcag aggagatggacatatgaaactgaggagaggtcatataggttacaagctgg tcaaggaatgagaaaaagcttatggcttaagctttattcaaaactaagtc tcagagctgttattttgggagctggactatggctggtaaagcctgtggtt acagacaggccccaggatttcaggaagttatttatccttggtcaagtagg gcttataagttacaggcatttctgttttacagattttgtgagtaatttaa acttaaaatatagctttagccaccatagtcagaatgttccattcagatct ggttacagtgatttagggattttctaatccaggattccaaactcctccac ataccttcagcgaatcagacccaagttcctcctaatcacagggtcaggtt attacaccaatgacatcactcctcatacaaatcttctgcattcattacct atctctcctcagtgaggaaatagctggaaaaataagttgagcaaggaagg gattcccttggctcacagttgaagggtccagtctctcatggtgggaaaat catgacggcaggaacatgaggcagctggtcacatgatgtcttaagtgagg aagcaaagagatttgtgggtggtaattcaggtcattttcaaatttttgat tagctggggaacatagtcctggaatgaagttggccacattcagagtgggt ctttgctctaagttcagcctttctgacagactcttatagacactcccaga agtcatcttcccgttgagattgtggatccagaaagatgggcagtgatgat tgaccatttgtgactattacaacaggaacttggcatattttttctgaaga cattgacatatgtccctgcatttatcttattatatgtagcccaggttgac cttgagttttattcctcttgcatcaccctcccaaatggcctgattatagg tgtaccctttaatttattttatagcttaggaagttgtaaaaaattggtgt ctgttgatttatggggttgcagaccattgtctattggcccttagattgct ggtagattccagacacgatgctgagctgttgtttcaaatcagcagatttc ctt
quality values	Open. Hide. 62 49 20 41 62 62 62 62 62 62 62 47 42 54 33 62 62 62 49 62 62 62 59 62 59 59 62 59 51 59 40 40 34 44 28 45 46 43 62 56 62 62 62 59 54 62 59 59 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 58 58 58 58 58 58 58 58 52 54 58 54 58 58 58 58 58 58 58 58 54 58 54 58 54 58 58 58 58 58 54 58 58 58 58 48 58 58 58 47 54 58 58 58 58 52 52 58 58 58 58 58 58 58 54 58 54 52 58 58 58 54 58 58 54 58 58 58 58 58 58 46 58 52 58 58 58 49 58 54 58 49 50 58 58 58 58 58 58 46 58 48 58 51 54 53 53 58 50 58 49 58 58 58 58 54 58 58 53 53 51 49 50 51 58 51 51 48 48 51 58 44 51 52 58 51 46 51 52 50 51 51 52 58 58 51 58 54 41 47 53 53 54 50 54 51 49 39 58 43 49 40 58 58 49 47 58 58 58 53 41 51 51 50 51 50 52 39 17 58 39 42 41 50 51 58 58 43 51 39 32 47 40 52 50 58 39 54 54 53 45 47 39 32 53 53 42 41 29 32 32 25 45 54 30 35 52 13 5 5 12 11 53 50 49 35 52 53 52 42 27 31 35 49 54 40 45 53 52 39 28 30 51 52 38 53 29 45 39 52 40 45 47 35 26 54 54 18 13 23 26 40 52 42 40 29 34 53 29 42 42 27 54 32 26 31 32 31 37 42 37 29 32 31 51 26 40 28 20 33 35 23 27 27 33 33 16 51 51 32 29 13 38 29 35 40 33 31 37 41 40 39 31 37 31 13 45 33 7 46 27 28 31 34 51 51 31 30 43 37 42 36 31 18 30 27 31 31 31 30 13 30 16 51 41 18 16 34 37 31 42 34 36 31 25 30 28 46 46 32 33 42 32 27 31 46 36 34 33 32 32 34 32 30 38 38 29 31 23 32 16 30 31 38 36 33 31 27 30 35 25 33 25 35 26 14 31 27 32 32 26 31 31 31 31 31 30 29 9 25 15 28 22 36 24 25 25 16 29 26 30 31 21 32 21 31 23 13 33 34 34 42 13 38 21 22 14 14 13 11 6 8 12 30 38 17 37 31 13 30 26 23 20 24 24 5 16 22 34 22 21 25 14 21 11 11 33 44 34 33 32 27 19 4 4 5 17 29 23 33 32 30 30 24 18 10 19 24 13 21 24 34 12 34 6 10 25 25 22 22 31 31 32 33 17 21 32 14 12 7 13 17 32 21 14 25 7 8 6 5 5 14 10 11 21 9 38 21 10 11 3 4 18 8 6 4 8 11 15 24 20 21 11 21 7 6 7 13 7 17 19 7 30 10 30 7 30 14 24 8 6 14 9 7 11 21 16 12 14 7 19 20 40 38 19 4 5 12 6 8 16 8 4 3 3 4 7 20 10 25 6 20 12 12 24 13 3 3 5 5 10 15 12 7 21 16 13 17 15 6 4 5 10 5 8 23 7 11 9 14 12 16 6 4 11 25 21 7 8 13 8 9 15 10 4 2 3 14 9 16 5 6 9 7 16 1 2 1 6 4 15 3 3 3 1 2 6 14 4 2 4 5 4 7 11 1 4 3 1 4 5 6 8 8 5 12 18 7 20 9 2 1 3 6 4 7 8 20 25 17 17 4 6 22	Open. Hide. 62 47 51 44 62 62 54 56 56 45 15 22 28 27 38 32 32 43 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 62 62 62 59 62 59 59 62 62 59 62 62 62 54 54 54 54 59 62 54 59 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 47 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 62 56 62 56 46 37 37 46 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 52 54 54 54 58 58 58 54 58 58 58 58 54 54 48 54 58 58 58 58 58 58 58 45 46 54 54 48 54 54 58 58 58 58 58 58 58 58 58 54 54 58 58 39 37 54 52 52 47 54 54 58 58 54 58 54 52 54 54 54 58 58 58 58 54 41 58 54 42 52 44 43 54 58 58 58 54 58 54 52 54 58 58 51 58 58 49 58 58 58 50 50 52 50 49 58 49 48 48 58 50 52 51 58 58 47 47 46 54 54 49 35 58 37 50 48 49 51 58 58 40 50 37 47 37 52 58 46 37 54 53 47 58 50 52 51 49 51 53 53 40 50 38 36 41 48 40 53 58 53 58 46 37 16 58 54 51 49 58 58 51 39 53 54 32 58 34 28 49 41 35 39 58 40 41 39 50 36 36 22 50 40 58 39 41 58 49 58 58 41 35 23 49 52 33 39 41 45 58 58 40 51 40 32 32 42 42 32 31 29 32 42 51 29 33 32 32 50 35 46 34 40 53 51 44 26 36 32 40 24 52 53 40 34 35 54 31 32 51 54 41 25 39 37 54 53 47 28 39 40 40 31 47 34 32 44 40 34 33 54 35 19 54 31 32 32 31 33 23 31 32 41 22 42 31 19 51 33 37 37 32 37 31 18 31 24 17 21 31 25 29 31 29 24 31 33 24 37 45 42 22 11 54 11 35 17 31 32 37 18 15 8 51 45 28 37 27 30 24 31 31 22 30 34 40 28 31 28 16 13 53 31 24 22 30 25 22 31 31 31 33 38 28 32 24 29 17 14 7 47 8 9 13 31 31 26 28 28 28 37 25 25 18 33 33 18 9 42 18 33 21 20 44 42 32 26 22 14 9 6 24 14 8 6 7 9 30 31 33 32 25 31 22 18 17 7 18 26 23 20 31 25 31 37 34 17 41 6 13 36 18 10 13 46 31 30 31 20 10 9 21 18 32 23 22 19 31 42 14 30 38 31 46 25 18 23 18 7 16 27 8 7 13 9 27 31 31 21 37 48 48 24 31 26 31 29 32 32 31 29 15 32 25 21 19 48 10 11 44 16 25 23 46 31 10 41 38 20 31 26 22 24 16 36 32 31 31 18 15 8 22 10 9 17 21 36 17 36 37 21 42 16 11 31 37 42 24 14 11 24 29 23 20 25 18 21 24 30 32 30 11 19 17 25 9 14 12 7 11 31 34 24 9 33 8 7 33 22 16 5 4 4 7 27 27 10 6 6 8 6 15 15 16 18 17 17 47 17 11 6 9 4 6 5 8 9 10 24 11 11 27 16 11 18 6 6 10 28 7 9 25 21 6 5 4 3 13 13 7 6 18 17 12 14 3 3 23 4 5 20 7 21 6 6 12 6 12 6 10 26 5 6 12 27 7 14 5 9 8 13 9 6 10 4 19 21 6 5 13 3 9 13 7 5 7 8 6 4 7 22 8 20 8 10 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_32823475_32824692
seq2: B6Ng01-340N13.b_49_1242 (reverse)

seq1  CCATTTTTCTGTCAATCCATATCAGGGTTTCCATGTTTGCCTGGGGGTAA  50
      ||||||||| || ||||||||| |  |  | || | ||||||   |||||
seq2  CCATTTTTC-GTGAATCCATAT-ACCGAGTACACG-TTGCCT--AGGTAA  45

seq1  TCTCTGGTATTCCTCTCCTACCACCCATGAAGCAGGAG-AGTTATGGGTT  99
      |||| | ||||||| |||||| ||||||||||||| || ||||||| |||
seq2  TCTCGGATATTCCT-TCCTACAACCCATGAAGCAGAAGAAGTTATGAGTT  94

seq1  GTCTTCCTGCCTCTTGTTCCTGAAGCACTTTTTACTTAAAAGCTGTCAGT  149
      || |  |||||||||||  ||||||||| ||||||||  |||||||||||
seq2  GT-TCTCTGCCTCTTGT--CTGAAGCAC-TTTTACTT--AAGCTGTCAGT  138

seq1  TCTTCCCTAAGATGGACCATTGAGTCCTGTTGCCCAACTG-AGATAAGAG  198
         |||||||||  ||||||||||| ||| ||||| |||| | |||||||
seq2  --CTCCCTAAGAATGACCATTGAGT-CTG-TGCCC-ACTGAAAATAAGAG  183

seq1  TTGTCTCTTCACCCTCCCGTAAGCATTCCTTGACCCCGTGCCTTAGATTT  248
       ||||||||||||   |||| ||||||||||||||||||| |||||| ||
seq2  -TGTCTCTTCACC--TCCGT-AGCATTCCTTGACCCCGTG-CTTAGA-TT  227

seq1  TGACCAAGTCTGTTCTTGCCTTTGGGTGACTCGGTCTCAGTTGCTTCACT  298
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  TGACCAAGTCTG-TCTTGCCTTTGGGTGACTCGGTCTCAGTTGCTTCACT  276

seq1  TGCAAACACCGAAGCTCACAACATCTGTACACATCAGTGACATCATACGC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAACACCGAAGCTCACAACATCTGTACACATCAGTGACATCATACGC  326

seq1  AGGGTGATGTTTGGTGAGAGCATGGGGCCTCACAGGTAGGAGTTTCTGCC  398
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTGATG-TTGGTGAGAGCATGGGGCCTCACAGGTAGGAGTTTCTGCC  375

seq1  CTCCTAGAGAATTAGTGGTCCCCTCTTGTCCTGGAGTTGACTAGTCCCTG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTAGAGAATTAGTGGTCCCCTCTTGTCCTGGAGTTGACTAGTCCCTG  425

seq1  CTCTGCAGACCTTTTGCACAGTTGGAACTGCAGACCTATCCAAGTTTTGT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  CTCTGCAGACCTTTTGCACAGTTGGAACTGCAGACCTATCCAAGTTTTG-  474

seq1  TTTCATTCTGTTGCTGTGATAAAACACTGACCAAAAGTGACCTCAGGAGG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCATTCTGTTGCTGTGATAAAACACTGACCAAAAGTGACCTCAGGAGG  524

seq1  AAAAAGTTTGTTTGAGGGTAGTCAAGGTAGGAACTCCAGCAGGAACTTGA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGTTTGTTTGAGGGTAGTCAAGGTAGGAACTCCAGCAGGAACTTGA  574

seq1  GACAGAAAGCGTGGAGAAACACTGCCCATTTGCTCACTCTCAAGCACATG  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGAAAGCGTGGAGAAACACTGCCCATTTGCTCACTCTCAAGCACATG  624

seq1  TTTAGCTAGCTTTTGAAAAATACAGTCCAGAACTATCTGTGCAGAAAATG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGCTAGCTTTTGAAAAATACAGTCCAGAACTATCTGTGCAGAAAATG  674

seq1  GTGACAGGTAGAATGGCTGGGTGCTTCTAAATCAACTAACAATTAAGACA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACAGGTAGAATGGCTGGGTGCTTCTAAATCAACTAACAATTAAGACA  724

seq1  GTCCCCCAAAGATGTGCCCACAGACCACTCTGATCTGGCAGTACCATGCA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCCCAAAGATGTGCCCACAGACCACTCTGATCTGGCAGTACCATGCA  774

seq1  ACTGAGACTCCCTTCTCAGGTGAGTAGAGGCCCTGTCAAGTTGTCAATTA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGACTCCCTTCTCAGGTGAGTAGAGGCCCTGTCAAGTTGTCAATTA  824

seq1  CAACTAACAGGCTTCAATGTTGCCTAGACACCCCTAAGTCCCGGTTGAGA  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTAACAGGCTTCAATGTTGCCTAGACACCCCTAAGTCCCGGTTGAGA  874

seq1  CCTTCCCTGATGATGGTCCCTGGGGCTGAAATTAATACCACCAGAGAACA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCCCTGATGATGGTCCCTGGGGCTGAAATTAATACCACCAGAGAACA  924

seq1  TTCATCTTCGCAAGCCAAGGTGGCTATCTCTGACGTAGGCTGTATACCTT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATCTTCGCAAGCCAAGGTGGCTATCTCTGACGTAGGCTGTATACCTT  974

seq1  CTCCATTGGCCCTGGGATAGACCCTTGAGACTCAGCCATAACCCTGAGAA  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCATTGGCCCTGGGATAGACCCTTGAGACTCAGCCATAACCCTGAGAA  1024

seq1  AGATGGAGCAGGACTCAGCACAAACCCATATAGTGTAGGCTACTTGTGCA  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGGAGCAGGACTCAGCACAAACCCATATAGTGTAGGCTACTTGTGCA  1074

seq1  AATCTTCACATCATGTTGCTGTCCTAAATATTGTAGGTATTTGTAAGACA  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTTCACATCATGTTGCTGTCCTAAATATTGTAGGTATTTGTAAGACA  1124

seq1  ATGGTGTTTATGTATCTAAATACATCTATATATAGGATAACAATAATAAA  1198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTGTTTATGTATCTAAATACATCTATATATAGGATAACAATAATAAA  1174

seq1  GATATTGTGCATAGGAATTC  1218
      ||||||||||||||||||||
seq2  GATATTGTGCATAGGAATTC  1194

seq1: chr17_32712180_32713323
seq2: B6Ng01-340N13.g_69_1221

seq1  GAATTCTGGGATAGAGTCAGGTGCAGGAAAAGATTTCACCCTGGACTCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGGGATAGAGTCAGGTGCAGGAAAAGATTTCACCCTGGACTCAG  50

seq1  AGGAGATGGACATATGAAACTGAGGAGAGGTCATATAGGTTACAAGCTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGATGGACATATGAAACTGAGGAGAGGTCATATAGGTTACAAGCTGG  100

seq1  TCAAGGAATGAGAAAAAGCTTATGGCTTAAGCTTTATTCAAAACTAAGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGAATGAGAAAAAGCTTATGGCTTAAGCTTTATTCAAAACTAAGTC  150

seq1  TCAGAGCTGTTATTTTGGGAGCTGGACTATGGCTGGTAAAGCCTGTGGTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAGCTGTTATTTTGGGAGCTGGACTATGGCTGGTAAAGCCTGTGGTT  200

seq1  ACAGACAGGCCCCAGGATTTCAGGAAGTTATTTATCCTTGGTCAAGTAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGACAGGCCCCAGGATTTCAGGAAGTTATTTATCCTTGGTCAAGTAGG  250

seq1  GCTTATAAGTTACAGGCATTTCTGTTTTACAGATTTTGTGAGTAATTTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTATAAGTTACAGGCATTTCTGTTTTACAGATTTTGTGAGTAATTTAA  300

seq1  ACTTAAAATATAGCTTTAGCCACCATAGTCAGAATGTTCCATTCAGATCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAAAATATAGCTTTAGCCACCATAGTCAGAATGTTCCATTCAGATCT  350

seq1  GGTTACAGTGATTTAGGGATTTTCTAATCCAGGATTCCAAACTCCTCCAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTACAGTGATTTAGGGATTTTCTAATCCAGGATTCCAAACTCCTCCAC  400

seq1  ATACCTTCAGCGAATCAGACCCAAGTTCCTCCTAATCACAGGGTCAGGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCTTCAGCGAATCAGACCCAAGTTCCTCCTAATCACAGGGTCAGGTT  450

seq1  ATTACACCAATGACATCACTCCTCATACAAATCTTCTGCATTCATTACCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACACCAATGACATCACTCCTCATACAAATCTTCTGCATTCATTACCT  500

seq1  ATCTCTCCTCAGTGAGGAAATAGCTGGAAAAATAAGTTGAGCAAGGAAGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCTCCTCAGTGAGGAAATAGCTGGAAAAATAAGTTGAGCAAGGAAGG  550

seq1  GATTCCCTTGGCTCACAGTTGAAGGGTCCAGTCTCTCATGGTGGGAAAAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCCCTTGGCTCACAGTTGAAGGGTCCAGTCTCTCATGGTGGGAAAAT  600

seq1  CATGACGGCAGGAACATGAGGCAGCTGGTCACATGATGTCTTAAGTGAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGACGGCAGGAACATGAGGCAGCTGGTCACATGATGTCTTAAGTGAGG  650

seq1  AAGCAAAGAGATTTGTGGGTGGTAATTCAGGTCATTTTCAAATTTTTGAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAAAGAGATTTGTGGGTGGTAATTCAGGTCATTTTCAAATTTTTGAT  700

seq1  TAGCTGGGGAACATAGTCCTGGAATGAAGTTGGCCACATTCAGAGTGGGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTGGGGAACATAGTCCTGGAATGAAGTTGGCCACATTCAGAGTGGGT  750

seq1  CTTTGCTCTAAGTTCAGCCTTTCTGACAGACTCTTATAGACACTCCCAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGCTCTAAGTTCAGCCTTTCTGACAGACTCTTATAGACACTCCCAGA  800

seq1  AGTCATCTT-CCGTTGAGATTGTGGATCCAGAAAGAT-GGCAGTGATGAT  848
      ||||||||| ||||||||||||||||||||||||||| ||||||||||||
seq2  AGTCATCTTCCCGTTGAGATTGTGGATCCAGAAAGATGGGCAGTGATGAT  850

seq1  TGACCA-TTGTGACTATTACAACAGGAACTTGGCATA-TTTATCTGAAGA  896
      |||||| |||||||||||||||||||||||||||||| ||| ||||||||
seq2  TGACCATTTGTGACTATTACAACAGGAACTTGGCATATTTTTTCTGAAGA  900

seq1  CA-TGACATATGT-CCTGCATTTATCTTATTATATGTAGCCCAGGTTGAC  944
      || |||||||||| ||||||||||||||||||||||||||||||||||||
seq2  CATTGACATATGTCCCTGCATTTATCTTATTATATGTAGCCCAGGTTGAC  950

seq1  CTTGAGTTTTATTCCTCTTGCATCCACCTCCCAAATGGCCTGATTATAGG  994
      ||||||||||||||||||||||||  ||||||||||||||||||||||||
seq2  CTTGAGTTTTATTCCTCTTGCATCACCCTCCCAAATGGCCTGATTATAGG  1000

seq1  TGTAACCCTTAATTTA-TTTATAGCTTAGGAAGTTGTAAAAGAAATTGGT  1043
      |||| || |||||||| |||||||||||||||||||||||  ||||||||
seq2  TGTACCCTTTAATTTATTTTATAGCTTAGGAAGTTGTAAA--AAATTGGT  1048

seq1  GTCTG-TGA-TTATGGGGTTGGCAAGACCAATGTCTA-TGGCCC-TAGAT  1089
      ||||| ||| |||||||||||   |||||| |||||| |||||| |||||
seq2  GTCTGTTGATTTATGGGGTTG--CAGACCATTGTCTATTGGCCCTTAGAT  1096

seq1  GCCTGGTAGGATTCCAGACA-GATGCTGAAGCTGTGTTTTCAAAT---CA  1135
        |||||| ||||||||||| ||||||| ||||||  ||||||||   ||
seq2  TGCTGGTA-GATTCCAGACACGATGCTG-AGCTGTTGTTTCAAATCAGCA  1144

seq1  GAGTTCCTT  1144
      || ||||||
seq2  GATTTCCTT  1153

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information