MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-095I24
Chromosome	17 (Build37)
Map Location	36,910,077 - 36,910,393
singlet/doublet	singlet
Overlap gene	H2-M10.5
Upstream gene	Ier3, Flot1, Tubb5, Mdc1, Nrm, 2310014H01Rik, Dhx16, 2310061I04Rik, 2610110G12Rik, Mrps18b, LOC100043673, Ppp1r10, LOC100043674, LOC667766, Abcf1, Prr3, Gna-rs1, H2-T24, H2-T23, H2-T22, EG547347, LOC667782, H2-Bl, EG667792, C920025E04Rik, H2-T10, LOC630294, LOC672718, ENSMUSG00000073403, LOC675325, LOC626268, EG667977, LOC625785, H2-T3, LOC100043127, EG667827, LOC435525, LOC677333, LOC100043134, LOC625881, Rpp21, Trim39, H2-M10.2, H2-M10.1, H2-M10.3, Gm318, LOC100043140, LOC674152, LOC383240, LOC224752, H2-M10.4, H2-M11, LOC667896, H2-M9, LOC620340, H2-M1, LOC667912, LOC100043158, LOC667915
Downstream gene	H2-M10.6, Trim26, Trim15, Trim10, LOC100043164, Trim40, Trim31, Ppp1r11, Znrd1, 1700022C21Rik, H2-M6-ps, 2410137M14Rik, H2-M4-ps, D130003B22Rik, Zfp57, Mog, Gabbr1, Olfr90, Olfr91, Olfr92, EG224763, LOC667973, Olfr93, Olfr753-ps1, LOC630355, Ubd, Olfr94, Olfr95, Olfr96, Olfr97, Olfr754-ps1, Olfr98, H2-M3, Olfr755-ps1, Olfr99, Olfr756-ps1, Olfr101, Olfr102, Olfr103, Olfr104, GA_x5J8B7W5KGR-1115818-1115257, Olfr105, Olfr758-ps1, Olfr106, Olfr107, Olfr759-ps1, Olfr108, Olfr760-ps1, Olfr109, H2-M2, Olfr110, Olfr111, Olfr112, Olfr113, Olfr114, Olfr115, Olfr116, Olfr117, Olfr118, Olfr119, Scocp, Olfr120, Olfr1558-ps1, Olfr121, Olfr122
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ier3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15937 MGI:104814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flot1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14251 MGI:1100500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22154 MGI:107812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240087 MGI:3525201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106582 MGI:2146855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310014H01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76448 MGI:1923698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 84 ESTs, 1 Protein

name	Dhx16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69192 MGI:1916442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310061I04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69662 MGI:1916912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 82 ESTs, 5 Proteins

name	2610110G12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73242 MGI:1913869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps18b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66973 MGI:1914223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043673 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs

name	Ppp1r10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52040 MGI:1289273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043674 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 268 ESTs, 3 Proteins

name	LOC667766 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 5 Proteins pseudo : _no_value

name	Abcf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224742 MGI:1351658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75210 MGI:1922460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gna-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14670 MGI:95764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-T24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15042 MGI:95958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-T23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15040 MGI:95957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-T22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15039 MGI:95956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG547347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547347 MGI:3646212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667782 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 62 Proteins pseudo : _no_value

name	H2-Bl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14963 MGI:892004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667792 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667792 MGI:3648635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 94 Proteins pseudo : _no_value

name	C920025E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667803 MGI:2442805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 24 ESTs, 160 Proteins

name	H2-T10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15024 MGI:95942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC630294 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 77 Proteins pseudo : _no_value

name	LOC672718 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 112 Proteins pseudo : _no_value

name	ENSMUSG00000073403 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69717 MGI:3702919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 73 Proteins

name	LOC675325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC626268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626268
definition	note : RIKEN cDNA 6330407G11 pseudogene pseudo : _no_value

name	EG667977 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667977 MGI:3704134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625785 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625785
definition	note : RIKEN cDNA 6330407G11 pseudogene pseudo : _no_value

name	H2-T3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15043 MGI:95959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG667827 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667827 MGI:3646857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC435525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins pseudo : _no_value

name	LOC677333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 18 Proteins pseudo : _no_value

name	LOC100043134 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC625881 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Rpp21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67676 MGI:1914926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79263 MGI:1890659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M10.2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333715 MGI:1276525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M10.1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14985 MGI:1276522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M10.3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110696 MGI:1276524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm318 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545204 MGI:2685164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins

name	LOC100043140 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 Proteins pseudo : _no_value

name	LOC674152 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC383240 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC224752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:224752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	H2-M10.4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224753 MGI:1276527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224754 MGI:2676637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667896 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667896
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	H2-M9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14997 MGI:1276570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620340 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	H2-M1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224756 MGI:95913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100043158 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	H2-M10.5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224761 MGI:1276526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M10.6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399549 MGI:2687364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22670 MGI:1337056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69097 MGI:1916347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19824 MGI:1338757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043164 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Trim40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195359 MGI:2684881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224762 MGI:2385051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76497 MGI:1923747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znrd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66136 MGI:1913386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76416 MGI:1923666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M6-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14994 MGI:95918
definition	gene_synonym : H-2M6; H2-M6 note : histocompatibility 2, M region locus 6, pseudogene pseudo : _no_value

name	2410137M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76797 MGI:1924047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M4-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14992 MGI:95916
definition	gene_synonym : H-2M4; H2-M4 note : histocompatibility 2, M region locus 4, pseudogene pseudo : _no_value

name	D130003B22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240095 MGI:3036265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 144 Proteins

name	Zfp57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22715 MGI:99204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17441 MGI:97435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabbr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54393 MGI:1860139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr90 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258469 MGI:2177473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr91 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258470 MGI:2177474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr92 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258448 MGI:2177475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG224763 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224763 MGI:3644619
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	LOC667973 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein pseudo : _no_value

name	Olfr93 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258051 MGI:2177476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr753-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258052 MGI:3030587
definition	gene_synonym : MOR256-38; Olfr92-L note : olfactory receptor 753, pseudogene 1 pseudo : _no_value

name	LOC630355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ubd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24108 MGI:1344410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr94 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258219 MGI:2177477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr95 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258506 MGI:2177478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr96 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258507 MGI:2177479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258505 MGI:2177480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr754-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258050 MGI:3030588
definition	gene_synonym : MOR121-2P note : olfactory receptor 754, pseudogene 1 pseudo : _no_value

name	Olfr98 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258503 MGI:2177481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14991 MGI:95915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr755-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258049 MGI:3030589
definition	gene_synonym : MOR121-3P note : olfactory receptor 755, pseudogene 1 pseudo : _no_value

name	Olfr99 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258508 MGI:2177482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr756-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404420 MGI:3030590
definition	note : olfactory receptor 756, pseudogene 1 pseudo : _no_value

name	Olfr101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258831 MGI:2177484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258218 MGI:2177485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258830 MGI:2177486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257948 MGI:2177487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W5KGR-1115818-1115257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257807
definition	note : olfactory receptor GA_x5J8B7W5KGR-1115818-1115257 pseudo : _no_value

name	Olfr105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257893 MGI:2177488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr758-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404422 MGI:3030592
definition	note : olfactory receptor 758, pseudogene 1 pseudo : _no_value

name	Olfr106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257925 MGI:2177489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258504 MGI:2177490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr759-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258048 MGI:3030593
definition	gene_synonym : MOR121-4P note : olfactory receptor 759, pseudogene 1 pseudo : _no_value

name	Olfr108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258457 MGI:2177491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr760-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404423 MGI:3030594
definition	gene_synonym : MOR121-5_p note : olfactory receptor 760, pseudogene 1 pseudo : _no_value

name	Olfr109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258832 MGI:2177492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14990 MGI:95914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258325 MGI:2177493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr111 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545205 MGI:2177494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258096 MGI:2177495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258286 MGI:2177496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258284 MGI:2177497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257908 MGI:2177498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258625 MGI:2177499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258263 MGI:2177500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr118 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404308 MGI:2177501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258095 MGI:2177502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scocp (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654468
definition	note : Scoc pseudogene pseudo : _no_value

name	Olfr120 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258624 MGI:2177503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1558-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257907 MGI:3031392
definition	gene_synonym : MOR263-11 note : olfactory receptor 1558, pseudogene 1 pseudo : _no_value

name	Olfr121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258622 MGI:2177504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr122 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258285 MGI:2177505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ier3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130957 GeneID:15937 MGI:104814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immediate early response 3 transcript_id : NM_133662.2

name	Flot1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131036 GeneID:14251 MGI:1100500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flotillin 1 transcript_id : NM_008027.2

name	Tubb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374674 GeneID:22154 MGI:107812
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, beta 5 transcript_id : NM_011655.4

name	Mdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:132626692 GeneID:240087 MGI:3525201
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of DNA damage checkpoint 1 transcript_id : NM_001010833.2

name	Nrm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365394 GeneID:106582 MGI:2146855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nurim (nuclear envelope membrane protein) transcript_id : NM_134122.2

name	2310014H01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268674 GeneID:76448 MGI:1923698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 84 ESTs, 1 Protein product : RIKEN cDNA 2310014H01 gene, transcript variant 3 transcript_id : XM_001003622.2

name	Dhx16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794425 GeneID:69192 MGI:1916442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 16 transcript_id : NM_026987.1

name	2310061I04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401927 GeneID:69662 MGI:1916912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 82 ESTs, 5 Proteins product : RIKEN cDNA 2310061I04 gene, transcript variant 1 transcript_id : XM_128627.9

name	2610110G12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353440 GeneID:73242 MGI:1913869
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610110G12 gene transcript_id : NM_028476.3

name	Mrps18b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956151 GeneID:66973 MGI:1914223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S18B transcript_id : NM_025878.1

name	LOC100043673 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268808 GeneID:100043673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs product : hypothetical protein LOC100043673 transcript_id : XM_001480942.1

name	Ppp1r10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30725839 GeneID:52040 MGI:1289273
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory subunit 10 transcript_id : NM_175934.2

name	LOC100043674 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268810 GeneID:100043674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 268 ESTs, 3 Proteins product : similar to RBX1 protein transcript_id : XM_001480943.1

name	Abcf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930334 GeneID:224742 MGI:1351658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family F (GCN20), member 1 transcript_id : NM_013854.1

name	Prr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328353 GeneID:75210 MGI:1922460
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich polypeptide 3 transcript_id : NM_145487.2

name	Gna-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937360 GeneID:14670 MGI:95764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, related sequence 1 transcript_id : NM_008136.2

name	H2-T24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144953908 GeneID:15042 MGI:95958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, T region locus 24 transcript_id : NM_008207.3

name	H2-T23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803360 GeneID:15040 MGI:95957
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, T region locus 23 transcript_id : NM_010398.2

name	H2-T22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253707 GeneID:15039 MGI:95956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, T region locus 22 transcript_id : NM_010397.4

name	EG547347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370648 GeneID:547347 MGI:3646212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG547347 transcript_id : NM_001034909.2

name	H2-Bl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680144 GeneID:14963 MGI:892004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, blastocyst transcript_id : NM_008199.1

name	C920025E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401935 GeneID:667803 MGI:2442805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 24 ESTs, 160 Proteins product : RIKEN cDNA C920025E04 gene transcript_id : XM_992574.1

name	H2-T10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262135 GeneID:15024 MGI:95942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, T region locus 10 transcript_id : NM_010395.5

name	ENSMUSG00000073403 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268812 GeneID:69717 MGI:3702919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 73 Proteins product : predicted gene, ENSMUSG00000073403, transcript variant 9 transcript_id : XM_001003852.2

name	LOC675325 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268814 GeneID:675325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to LOC637119 protein transcript_id : XM_001480965.1

name	EG667977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486637 GeneID:667977 MGI:3704134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG667977 transcript_id : NM_001081032.1

name	H2-T3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387477 GeneID:15043 MGI:95959
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, T region locus 3 transcript_id : NM_008208.3

name	Rpp21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385016 GeneID:67676 MGI:1914926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease P 21 subunit (human) transcript_id : NM_026308.2

name	Trim39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13277375 GeneID:79263 MGI:1890659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 39 transcript_id : NM_024468.1

name	H2-M10.2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29244569 GeneID:333715 MGI:1276525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 10.2 transcript_id : NM_177923.1

name	H2-M10.1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328212 GeneID:14985 MGI:1276522
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 10.1 transcript_id : NM_013544.2

name	H2-M10.3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130960 GeneID:110696 MGI:1276524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 10.3 transcript_id : NM_201608.2

name	Gm318 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401942 GeneID:545204 MGI:2685164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins product : gene model 318, (NCBI) transcript_id : XM_619462.3

name	H2-M10.4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29244029 GeneID:224753 MGI:1276527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 10.4 transcript_id : NM_177634.1

name	H2-M11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29244031 GeneID:224754 MGI:2676637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 11 transcript_id : NM_177635.1

name	H2-M9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680148 GeneID:14997 MGI:1276570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 9 transcript_id : NM_008205.1

name	H2-M1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226229 GeneID:224756 MGI:95913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 1 transcript_id : NM_177636.2

name	H2-M10.5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842390 GeneID:224761 MGI:1276526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 10.5 transcript_id : NM_177637.3

name	H2-M10.6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475547 GeneID:399549 MGI:2687364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 10.6 transcript_id : NM_201611.1

name	Trim26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485540 GeneID:22670 MGI:1337056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 26 transcript_id : NM_001025599.2

name	Trim15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131215 GeneID:69097 MGI:1916347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 15 transcript_id : NM_001024134.2

name	Trim10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755339 GeneID:19824 MGI:1338757
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 10 transcript_id : NM_011280.1

name	Trim40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802270 GeneID:195359 MGI:2684881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 40 transcript_id : NM_001033235.2

name	Trim31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130248 GeneID:224762 MGI:2385051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 31 transcript_id : NM_146077.2

name	Ppp1r11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18390326 GeneID:76497 MGI:1923747
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 11 transcript_id : NM_029632.1

name	Znrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378639 GeneID:66136 MGI:1913386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc ribbon domain containing, 1 transcript_id : NM_023162.4

name	1700022C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095008 GeneID:76416 MGI:1923666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700022C21 gene transcript_id : NM_029602.1

name	2410137M14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369029 GeneID:76797 MGI:1924047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410137M14 gene transcript_id : NM_029747.2

name	D130003B22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268697 GeneID:240095 MGI:3036265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 144 Proteins product : RIKEN cDNA D130003B22 gene transcript_id : XM_993503.2

name	Zfp57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000699 GeneID:22715 MGI:99204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 57 transcript_id : NM_001013745.1

name	Zfp57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328160 GeneID:22715 MGI:99204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 57 transcript_id : NM_009559.2

name	Mog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199770 GeneID:17441 MGI:97435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin oligodendrocyte glycoprotein transcript_id : NM_010814.2

name	Gabbr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131888528 GeneID:54393 MGI:1860139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA-B) receptor, 1 transcript_id : NM_019439.3

name	Olfr90 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238945 GeneID:258469 MGI:2177473
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 90 transcript_id : NM_146477.1

name	Olfr91 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238943 GeneID:258470 MGI:2177474
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 91 transcript_id : NM_182714.1

name	Olfr92 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238933 GeneID:258448 MGI:2177475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 92 transcript_id : NM_146456.1

name	EG224763 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268699 GeneID:224763 MGI:3644619
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG224763 transcript_id : XM_139937.3

name	Olfr93 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801391 GeneID:258051 MGI:2177476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 93 transcript_id : NM_001011813.1

name	Ubd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13194204 GeneID:24108 MGI:1344410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin D transcript_id : NM_023137.2

name	Olfr94 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372121 GeneID:258219 MGI:2177477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 94 transcript_id : NM_001011518.1

name	Olfr95 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238909 GeneID:258506 MGI:2177478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 95 transcript_id : NM_146513.1

name	Olfr96 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239319 GeneID:258507 MGI:2177479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 96 transcript_id : NM_146514.1

name	Olfr97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239263 GeneID:258505 MGI:2177480
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 97 transcript_id : NM_146512.1

name	Olfr98 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239259 GeneID:258503 MGI:2177481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 98 transcript_id : NM_146510.1

name	H2-M3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074554 GeneID:14991 MGI:95915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 3 transcript_id : NM_013819.2

name	Olfr99 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239261 GeneID:258508 MGI:2177482
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 99 transcript_id : NM_146515.1

name	Olfr101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129194 GeneID:258831 MGI:2177484
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 101 transcript_id : NM_146834.1

name	Olfr102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801499 GeneID:258218 MGI:2177485
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 102 transcript_id : NM_001011721.1

name	Olfr103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129192 GeneID:258830 MGI:2177486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 103 transcript_id : NM_146833.1

name	Olfr104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801335 GeneID:257948 MGI:2177487
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 104 transcript_id : NM_001011783.1

name	Olfr105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801281 GeneID:257893 MGI:2177488
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 105 transcript_id : NM_001011744.1

name	Olfr106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801311 GeneID:257925 MGI:2177489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 106 transcript_id : NM_001011764.1

name	Olfr107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239257 GeneID:258504 MGI:2177490
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 107 transcript_id : NM_146511.1

name	Olfr108 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239253 GeneID:258457 MGI:2177491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 108 transcript_id : NM_146465.1

name	Olfr109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129188 GeneID:258832 MGI:2177492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 109 transcript_id : NM_146835.1

name	H2-M2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130900 GeneID:14990 MGI:95914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 2 transcript_id : NM_008204.2

name	Olfr110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129642 GeneID:258325 MGI:2177493
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 110 transcript_id : NM_146328.1

name	Olfr111 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794757 GeneID:545205 MGI:2177494
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 111 transcript_id : NM_001005485.1

name	Olfr112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665723 GeneID:258096 MGI:2177495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 112 transcript_id : NM_001013575.3

name	Olfr113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129710 GeneID:258286 MGI:2177496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 113 transcript_id : NM_146289.1

name	Olfr114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129714 GeneID:258284 MGI:2177497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 114 transcript_id : NM_146287.1

name	Olfr115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801293 GeneID:257908 MGI:2177498
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 115 transcript_id : NM_001011753.1

name	Olfr116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239075 GeneID:258625 MGI:2177499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 116 transcript_id : NM_146632.1

name	Olfr117 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391062 GeneID:258263 MGI:2177500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 117 transcript_id : NM_207155.1

name	Olfr118 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523371 GeneID:404308 MGI:2177501
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 118 transcript_id : NM_213721.1

name	Olfr119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801423 GeneID:258095 MGI:2177502
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 119 transcript_id : NM_001011830.1

name	Olfr120 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238907 GeneID:258624 MGI:2177503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 120 transcript_id : NM_146631.1

name	Olfr121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593001 GeneID:258622 MGI:2177504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 121 transcript_id : NM_146629.2

name	Olfr122 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953212 GeneID:258285 MGI:2177505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 122 transcript_id : NM_146288.2

name	Ier3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526808 CCDS:CCDS28704.1 GeneID:15937 MGI:104814
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : cAMP inducible gene 3 product : immediate early response 3 protein_id : NP_598423.1

name	Flot1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679809 CCDS:CCDS28705.1 GeneID:14251 MGI:1100500
definition	GO_component : GO:0016600 - flotillin complex [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : flotillin-1 product : flotillin 1 protein_id : NP_032053.1

name	Tubb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106439 CCDS:CCDS28706.1 GeneID:22154 MGI:107812
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005874 - microtubule [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA]; GO:0045298 - tubulin [Evidence NAS] [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence NAS] [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IDA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IDA]; GO:0051227 - mitotic spindle assembly [Evidence IDA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, beta 5 protein_id : NP_035785.1

name	Mdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:132626693 GeneID:240087 MGI:3525201
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : mediation of DNA damage checkpoint 1 product : mediator of DNA damage checkpoint 1 protein_id : NP_001010833.2

name	Nrm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527352 CCDS:CCDS28708.1 GeneID:106582 MGI:2146855
definition	GO_component : GO:0005637 - nuclear inner membrane [Evidence TAS]; GO:0005652 - nuclear lamina [Evidence TAS] codon_start : 1 product : nurim protein_id : NP_598883.1

name	2310014H01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401946 GeneID:76448 MGI:1923698
definition	codon_start : 1 product : hypothetical protein LOC76448 isoform 3 protein_id : XP_001003622.1

name	Dhx16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794426 CCDS:CCDS28710.1 GeneID:69192 MGI:1916442
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16 product : DEAH (Asp-Glu-Ala-His) box polypeptide 16 protein_id : NP_081263.1

name	2310061I04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82993370 GeneID:69662 MGI:1916912
definition	codon_start : 1 product : hypothetical protein LOC69662 isoform 1 protein_id : XP_128627.7

name	2610110G12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754164 CCDS:CCDS28711.1 GeneID:73242 MGI:1913869
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73242 protein_id : NP_082752.2

name	Mrps18b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956152 CCDS:CCDS28712.1 GeneID:66973 MGI:1914223
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S18B protein_id : NP_080154.1

name	LOC100043673 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268809 GeneID:100043673
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480992.1

name	Ppp1r10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28565277 GeneID:52040 MGI:1289273
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : HLA-C adjacent transcript 53 product : protein phosphatase I protein_id : NP_787948.1

name	LOC100043674 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268811 GeneID:100043674
definition	codon_start : 1 product : similar to RBX1 protein protein_id : XP_001480993.1

name	Abcf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930335 CCDS:CCDS28713.1 GeneID:224742 MGI:1351658
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family F (GCN20), member 1 protein_id : NP_038882.1

name	Prr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328354 CCDS:CCDS28714.1 GeneID:75210 MGI:1922460
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : proline-rich protein 3 protein_id : NP_663462.2

name	Gna-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937361 GeneID:14670 MGI:95764
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein, related sequence 1 protein_id : NP_032162.2

name	H2-T24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144953909 GeneID:15042 MGI:95958
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : histocompatibility 2, T region locus 24 protein_id : NP_032233.2

name	H2-T23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754148 CCDS:CCDS28715.1 GeneID:15040 MGI:95957
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0019883 - antigen processing and presentation of endogenous antigen [Evidence IEA]; GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : MHC class I antigen Qa1 product : histocompatibility 2, T region locus 23 protein_id : NP_034528.1

name	H2-T22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754146 GeneID:15039 MGI:95956
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : histocompatibility 2, T region locus 22 protein_id : NP_034527.1

name	EG547347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77861903 GeneID:547347 MGI:3646212
definition	codon_start : 1 exception : unclassified translation discrepancy product : H2-GS14-2 antigen protein_id : NP_001030081.1

name	H2-Bl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680145 GeneID:14963 MGI:892004
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0042612 - MHC class I protein complex [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0042270 - protection from natural killer cell mediated cytotoxicity [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy note : blastocyst MHC; H2 blastocyst; MHC class I antigen; MHC class I antigen splice variant Bl.1 product : histocompatibility 2, blastocyst protein_id : NP_032225.1

name	C920025E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401936 GeneID:667803 MGI:2442805
definition	codon_start : 1 product : RIKEN cDNA C920025E04 protein_id : XP_997668.1

name	H2-T10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262136 GeneID:15024 MGI:95942
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : histocompatibility 2, T region locus 10 protein_id : NP_034525.2

name	ENSMUSG00000073403 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268813 GeneID:69717 MGI:3702919
definition	codon_start : 1 product : hypothetical protein LOC69717 isoform 9 protein_id : XP_001003852.2

name	LOC675325 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268815 GeneID:675325
definition	codon_start : 1 product : similar to LOC637119 protein protein_id : XP_001481015.1

name	EG667977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486638 GeneID:667977 MGI:3704134
definition	codon_start : 1 note : MHC class I like protein GS17 product : hypothetical protein LOC667977 protein_id : NP_001074501.1

name	H2-T3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542929 CCDS:CCDS28718.1 GeneID:15043 MGI:95959
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0019883 - antigen processing and presentation of endogenous antigen [Evidence IEA]; GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MHC-TLA-T13a; MHC c5/g1L protein product : histocompatibility 2, T region locus 3 protein_id : NP_032234.2

name	Rpp21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385804 CCDS:CCDS28719.1 GeneID:67676 MGI:1914926
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004526 - ribonuclease P activity [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : ribonuclease P 21kDa subunit protein_id : NP_080584.1

name	Trim39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277376 GeneID:79263 MGI:1890659
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ring finger protein 23; RING-B box-coiled coil-B30.2; RING-B box-coiled-coil-B30.2 product : tripartite motif protein 39 protein_id : NP_077788.1

name	H2-M10.2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244570 CCDS:CCDS28720.1 GeneID:333715 MGI:1276525
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : major histocompatibility complex class Ib M10.1 product : histocompatibility 2, M region locus 10.2 protein_id : NP_808591.1

name	H2-M10.1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328213 CCDS:CCDS28721.1 GeneID:14985 MGI:1276522
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : histocompatibility 2, M region locus 10.1 protein_id : NP_038572.2

name	H2-M10.3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475538 CCDS:CCDS28722.1 GeneID:110696 MGI:1276524
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : histocompatibility 2, M region locus 10.3 protein_id : NP_963902.1

name	Gm318 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63706033 GeneID:545204 MGI:2685164
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619462.1

name	H2-M10.4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244030 CCDS:CCDS28723.1 GeneID:224753 MGI:1276527
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : major histocompatibility complex class Ib M10.5 product : histocompatibility 2, M region locus 10.4 protein_id : NP_808302.1

name	H2-M11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244032 GeneID:224754 MGI:2676637
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : histocompatibility 2, M region locus 11 protein_id : NP_808303.1

name	H2-M9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680149 CCDS:CCDS28724.1 GeneID:14997 MGI:1276570
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : histocompatibility 2, M region locus 9 protein_id : NP_032231.1

name	H2-M1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226230 GeneID:224756 MGI:95913
definition	GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : histocompatibility 2, M region locus 1 protein_id : NP_808304.2

name	H2-M10.5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842391 CCDS:CCDS28725.1 GeneID:224761 MGI:1276526
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : histocompatibility 2, M region locus 10.5 protein_id : NP_808305.2

name	H2-M10.6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475548 CCDS:CCDS28726.1 GeneID:399549 MGI:2687364
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 product : histocompatibility 2, M region locus 10.6 protein_id : NP_963905.1

name	Trim26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485541 GeneID:22670 MGI:1337056
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; tripartite motif protein TRIM26; zinc finger protein 173 product : tripartite motif protein 26 isoform a protein_id : NP_001020770.2

name	Trim15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66571295 GeneID:69097 MGI:1916347
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : tripartite motif protein 15 protein_id : NP_001019305.1

name	Trim10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755340 GeneID:19824 MGI:1338757
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ring finger protein 9 product : tripartite motif protein 10 protein_id : NP_035410.1

name	Trim40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794619 CCDS:CCDS28727.1 GeneID:195359 MGI:2684881
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : ring finger RNF35 product : tripartite motif-containing 40 protein_id : NP_001028407.1

name	Trim31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122567 CCDS:CCDS28728.1 GeneID:224762 MGI:2385051
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : tripartite motif-containing 31 protein_id : NP_666189.1

name	Ppp1r11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18390327 CCDS:CCDS28729.1 GeneID:76497 MGI:1923747
definition	GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] [Evidence IDA] codon_start : 1 note : t-complex testis-expressed 5 product : protein phosphatase 1, regulatory (inhibitor) subunit 11 protein_id : NP_083908.1

name	Znrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963545 CCDS:CCDS28730.1 GeneID:66136 MGI:1913386
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : nuclear RNA polymerase I small specific subunit protein_id : NP_075651.1

name	1700022C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095009 CCDS:CCDS28731.1 GeneID:76416 MGI:1923666
definition	codon_start : 1 product : hypothetical protein LOC76416 protein_id : NP_083878.1

name	2410137M14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746171 GeneID:76797 MGI:1924047
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : novel Immunoglobulin C1 type protein (2410137M14Rik) product : hypothetical protein LOC76797 protein_id : NP_084023.1

name	D130003B22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268698 GeneID:240095 MGI:3036265
definition	codon_start : 1 product : hypothetical protein LOC240095 protein_id : XP_998597.2

name	Zfp57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000700 CCDS:CCDS28733.1 GeneID:22715 MGI:99204
definition	GO_component : GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : zinc finger protein 57 protein_id : NP_001013767.1

name	Zfp57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328161 CCDS:CCDS28733.1 GeneID:22715 MGI:99204
definition	GO_component : GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : zinc finger protein 57 protein_id : NP_033585.2

name	Mog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199771 CCDS:CCDS28734.1 GeneID:17441 MGI:97435
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : myelin oligodendrocyte glycoprotein protein_id : NP_034944.2

name	Gabbr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131888529 GeneID:54393 MGI:1860139
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004965 - GABA-B receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GABA-BR1b receptor; bM573K1.1.1 (gamma-aminobutyric acid (GABA) B receptor, 1a) product : gamma-aminobutyric acid (GABA-B) receptor, 1 protein_id : NP_062312.3

name	Olfr90 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238946 CCDS:CCDS28735.1 GeneID:258469 MGI:2177473
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1526227-1525295; olfactory receptor MOR256-21 product : olfactory receptor 90 protein_id : NP_666688.1

name	Olfr91 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238944 GeneID:258470 MGI:2177474
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1533927-1532989; olfactory receptor MOR256-20; bM573K1.3 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) protein); G-protein coupled receptor product : olfactory receptor 91 protein_id : NP_874373.1

name	Olfr92 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238934 GeneID:258448 MGI:2177475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PSCP-1552066-1551128; olfactory receptor MOR256-29 product : olfactory receptor 92 protein_id : NP_666667.1

name	EG224763 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268700 GeneID:224763 MGI:3644619
definition	codon_start : 1 product : similar to bM573K1.5 (novel Ulp1 protease family member) protein_id : XP_139937.3

name	Olfr93 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801392 CCDS:CCDS28736.1 GeneID:258051 MGI:2177476
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1592036-1591098; olfactory receptor MOR256-39P product : olfactory receptor 93 protein_id : NP_001011813.1

name	Ubd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963519 CCDS:CCDS28737.1 GeneID:24108 MGI:1344410
definition	GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : Diubiquitin product : ubiquitin D protein_id : NP_075626.1

name	Olfr94 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372122 CCDS:CCDS28738.1 GeneID:258219 MGI:2177477
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1637650-1636712; olfactory receptor MOR256-32P product : olfactory receptor 94 protein_id : NP_001011518.1

name	Olfr95 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238910 CCDS:CCDS28739.1 GeneID:258506 MGI:2177478
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1651760-1650822; olfactory receptor MOR263-6 product : olfactory receptor 95 protein_id : NP_666724.1

name	Olfr96 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239320 CCDS:CCDS28740.1 GeneID:258507 MGI:2177479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1665046-1665987; olfactory receptor MOR121-1 product : olfactory receptor 96 protein_id : NP_666725.1

name	Olfr97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239264 CCDS:CCDS28741.1 GeneID:258505 MGI:2177480
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1672287-1671355; olfactory receptor MOR156-2 product : olfactory receptor 97 protein_id : NP_666723.1

name	Olfr98 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239260 CCDS:CCDS28742.1 GeneID:258503 MGI:2177481
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1703582-1702653; olfactory receptor MOR156-4 product : olfactory receptor 98 protein_id : NP_666721.1

name	H2-M3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305129 GeneID:14991 MGI:95915
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : MHC class I-b antigen M3 product : histocompatibility 2, M region locus 3 protein_id : NP_038847.1

name	Olfr99 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239262 CCDS:CCDS28743.1 GeneID:258508 MGI:2177482
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1720261-1719344; olfactory receptor MOR156-1 product : olfactory receptor 99 protein_id : NP_666726.1

name	Olfr101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129195 CCDS:CCDS28744.1 GeneID:258831 MGI:2177484
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1761617-1760691; olfactory receptor MOR250-2 product : olfactory receptor 101 protein_id : NP_667045.1

name	Olfr102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801500 CCDS:CCDS28745.1 GeneID:258218 MGI:2177485
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1775063-1774137; olfactory receptor MOR250-4 product : olfactory receptor 102 protein_id : NP_001011721.1

name	Olfr103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129193 CCDS:CCDS28746.1 GeneID:258830 MGI:2177486
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1798423-1797482; olfactory receptor MOR250-3 product : olfactory receptor 103 protein_id : NP_667044.1

name	Olfr104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801336 CCDS:CCDS28747.1 GeneID:257948 MGI:2177487
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1823235-1824161; olfactory receptor MOR250-5 product : olfactory receptor 104 protein_id : NP_001011783.1

name	Olfr105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801282 CCDS:CCDS28748.1 GeneID:257893 MGI:2177488
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1843460-1844386; olfactory receptor MOR250-7 product : olfactory receptor 105 protein_id : NP_001011744.1

name	Olfr106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801312 CCDS:CCDS28749.1 GeneID:257925 MGI:2177489
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1855511-1856437; olfactory receptor MOR250-6 product : olfactory receptor 106 protein_id : NP_001011764.1

name	Olfr107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239258 CCDS:CCDS28750.1 GeneID:258504 MGI:2177490
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1867165-1868094; olfactory receptor MOR156-3 product : olfactory receptor 107 protein_id : NP_666722.1

name	Olfr108 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239254 CCDS:CCDS28751.1 GeneID:258457 MGI:2177491
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1893605-1894534; olfactory receptor MOR156-5 product : olfactory receptor 108 protein_id : NP_666676.1

name	Olfr109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129189 CCDS:CCDS28752.1 GeneID:258832 MGI:2177492
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1914078-1915022; olfactory receptor MOR250-1 product : olfactory receptor 109 protein_id : NP_667046.1

name	H2-M2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47887011 CCDS:CCDS28753.1 GeneID:14990 MGI:95914
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : histocompatibility 2, M region locus 2 protein_id : NP_032230.1

name	Olfr110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129643 CCDS:CCDS28754.1 GeneID:258325 MGI:2177493
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1956307-1957260; olfactory receptor MOR249-2 product : olfactory receptor 110 protein_id : NP_666440.1

name	Olfr111 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794758 CCDS:CCDS28755.1 GeneID:545205 MGI:2177494
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1989071-1990024; olfactory receptor MOR249-1P product : olfactory receptor 111 protein_id : NP_001005485.1

name	Olfr112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73663902 CCDS:CCDS28756.1 GeneID:258096 MGI:2177495
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2023769-2022807 product : olfactory receptor 112 protein_id : NP_001013593.2

name	Olfr113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129711 GeneID:258286 MGI:2177496
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2034880-2033942; olfactory receptor MOR218-9 product : olfactory receptor 113 protein_id : NP_666401.1

name	Olfr114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129715 CCDS:CCDS28757.1 GeneID:258284 MGI:2177497
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2049802-2048870; olfactory receptor MOR218-10 product : olfactory receptor 114 protein_id : NP_666399.1

name	Olfr115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801294 GeneID:257908 MGI:2177498
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2070203-2069271; olfactory receptor MOR218-11P product : olfactory receptor 115 protein_id : NP_001011753.1

name	Olfr116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239076 CCDS:CCDS28758.1 GeneID:258625 MGI:2177499
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2084102-2083137; olfactory receptor MOR218-2 product : olfactory receptor 116 protein_id : NP_666843.1

name	Olfr117 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391063 CCDS:CCDS28759.1 GeneID:258263 MGI:2177500
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2119438-2118485; olfactory receptor MOR256-33 product : olfactory receptor 117 protein_id : NP_997038.1

name	Olfr118 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523372 CCDS:CCDS28760.1 GeneID:404308 MGI:2177501
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2131124-2132089; GA_x5J8B7TYMFE-883-533; GA_x5J8B7TVMCU-697-290 product : olfactory receptor 118 protein_id : NP_998886.1

name	Olfr119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801424 CCDS:CCDS28761.1 GeneID:258095 MGI:2177502
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2159633-2160598; olfactory receptor MOR263-7 product : olfactory receptor 119 protein_id : NP_001011830.1

name	Olfr120 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238908 CCDS:CCDS28762.1 GeneID:258624 MGI:2177503
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2184981-2185946; olfactory receptor MOR263-3 product : olfactory receptor 120 protein_id : NP_666842.1

name	Olfr121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593002 CCDS:CCDS28763.1 GeneID:258622 MGI:2177504
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2211113-2212078; olfactory receptor MOR263-4 product : olfactory receptor 121 protein_id : NP_666840.2

name	Olfr122 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953213 CCDS:CCDS28764.1 GeneID:258285 MGI:2177505
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2230932-2231897; olfactory receptor MOR263-10 product : olfactory receptor 122 protein_id : NP_666400.2

name	LOC100043127 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043127
definition	number : 1 pseudo : _no_value

name	EG667827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667827
definition	number : 8 pseudo : _no_value

name	EG667827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667827
definition	number : 7 pseudo : _no_value

name	EG667827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667827
definition	number : 6 pseudo : _no_value

name	EG667827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667827
definition	number : 5 pseudo : _no_value

name	EG667827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667827
definition	number : 4 pseudo : _no_value

name	EG667827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667827
definition	number : 3 pseudo : _no_value

name	EG667827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667827
definition	number : 2 pseudo : _no_value

name	EG667827 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667827
definition	number : 1 pseudo : _no_value

name	LOC435525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435525
definition	number : 8 pseudo : _no_value

name	LOC435525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435525
definition	number : 7 pseudo : _no_value

name	LOC435525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435525
definition	number : 6 pseudo : _no_value

name	LOC435525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435525
definition	number : 5 pseudo : _no_value

name	LOC435525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435525
definition	number : 4 pseudo : _no_value

name	LOC435525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435525
definition	number : 3 pseudo : _no_value

name	LOC435525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435525
definition	number : 2 pseudo : _no_value

name	LOC435525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435525
definition	number : 1 pseudo : _no_value

name	LOC100043134 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043134
definition	number : 1 pseudo : _no_value

name	LOC625881 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625881
definition	number : 1 pseudo : _no_value

name	LOC100043140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043140
definition	number : 6 pseudo : _no_value

name	LOC100043140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043140
definition	number : 5 pseudo : _no_value

name	LOC100043140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043140
definition	number : 4 pseudo : _no_value

name	LOC100043140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043140
definition	number : 3 pseudo : _no_value

name	LOC100043140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043140
definition	number : 2 pseudo : _no_value

name	LOC100043140 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043140
definition	number : 1 pseudo : _no_value

name	LOC674152 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674152
definition	number : 1 pseudo : _no_value

name	LOC383240 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383240
definition	number : 2 pseudo : _no_value

name	LOC383240 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383240
definition	number : 1 pseudo : _no_value

name	LOC224752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224752
definition	number : 2 pseudo : _no_value

name	LOC224752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224752
definition	number : 1 pseudo : _no_value

name	LOC667896 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667896
definition	number : 1 pseudo : _no_value

name	LOC667896 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667896
definition	number : 2 pseudo : _no_value

name	LOC667896 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667896
definition	number : 3 pseudo : _no_value

name	LOC667896 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667896
definition	number : 4 pseudo : _no_value

name	LOC667896 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667896
definition	number : 5 pseudo : _no_value

name	LOC667896 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667896
definition	number : 6 pseudo : _no_value

name	LOC620340 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620340
definition	number : 1 pseudo : _no_value

name	LOC667912 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667912
definition	number : 6 pseudo : _no_value

name	LOC667912 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667912
definition	number : 5 pseudo : _no_value

name	LOC667912 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667912
definition	number : 4 pseudo : _no_value

name	LOC667912 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667912
definition	number : 3 pseudo : _no_value

name	LOC667912 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667912
definition	number : 2 pseudo : _no_value

name	LOC667912 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667912
definition	number : 1 pseudo : _no_value

name	LOC100043158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043158
definition	number : 1 pseudo : _no_value

name	LOC100043158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043158
definition	number : 2 pseudo : _no_value

name	LOC100043158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043158
definition	number : 3 pseudo : _no_value

name	LOC100043158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043158
definition	number : 4 pseudo : _no_value

name	LOC100043158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043158
definition	number : 5 pseudo : _no_value

name	LOC100043158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043158
definition	number : 6 pseudo : _no_value

name	LOC100043158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043158
definition	number : 7 pseudo : _no_value

name	LOC100043158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043158
definition	number : 8 pseudo : _no_value

name	LOC100043164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043164
definition	number : 1 pseudo : _no_value

name	LOC100043164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043164
definition	number : 2 pseudo : _no_value

name	LOC630355 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630355
definition	number : 1 pseudo : _no_value

name	LOC630355 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630355
definition	number : 2 pseudo : _no_value

name	H2-M6-ps (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : H-2M6; H2-M6 note : contains intron 3, exon 4, intron 4 pseudo : _no_value

name	LOC667766 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268675 GeneID:667766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 5 Proteins product : similar to putative protein phosphatase 1 nuclear targeting subunit pseudo : _no_value transcript_id : XR_034231.1

name	LOC667782 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268676 GeneID:667782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 62 Proteins product : similar to HLA-G protein pseudo : _no_value transcript_id : XR_002074.2

name	EG667792 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268677 GeneID:667792 MGI:3648635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 94 Proteins product : predicted gene, EG667792 pseudo : _no_value transcript_id : XR_034251.1

name	LOC630294 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268678 GeneID:630294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 77 Proteins product : similar to MHC class I antigen pseudo : _no_value transcript_id : XR_034252.1

name	LOC672718 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268679 GeneID:672718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 112 Proteins product : similar to HLA-G protein pseudo : _no_value transcript_id : XR_034258.1

name	LOC677333 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268680 GeneID:677333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 18 Proteins product : similar to histone H3 pseudo : _no_value transcript_id : XR_034279.1

name	LOC667915 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268691 GeneID:667915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to armadillo repeat-containing X-linked protein 5 pseudo : _no_value transcript_id : XR_034307.1

name	LOC667973 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268825 GeneID:667973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : hypothetical LOC667973 pseudo : _no_value transcript_id : XR_034941.1

clone name	MSMg01-157M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084G20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-356J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-307E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471P10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-278N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-070F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-499G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176L20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-110F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353J02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-152L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-333I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-463M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448A21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-113K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403N15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-057H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298H18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480K14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-422H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-445F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-482D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315D04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-188O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413G10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-388K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099M22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-144C03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-397C06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-323I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-519L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338L09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-251I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303H03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-095I24.T7 (MSMg01no095_i24.b1)	MSMg01-095I24.TJ (MSMg01no095_i24.g1)
ACC	AG312446	AG312447
length	711	717
length of high quality (start - end)	321 (43 - 363)	286 (72 - 357)
definition	CHROMAT_FILE: MSMg01no095_i24.b1 PHD_FILE: MSMg01no095_i24.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:51:37 2005	CHROMAT_FILE: MSMg01no095_i24.g1 PHD_FILE: MSMg01no095_i24.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:51:37 2005
singlet/doublet	singlet	---
BLAST hit	plural	no hit data
sequence	CATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAAT TCGCCTGTCTACCTGTGACAATTCCGCAACGCTTGCTGTCTCACTGGCCC AATATGTCATTGGCACCTGCTCCATCCATGCAACCCGAGGTAGCAAAACT GCAATTGGTTCTTTGCTGTCATATCTCTGATACTCTATAGAGTCTACATA GCCAATGTGGATGAACCGGGAATTAACCATGCCAGGCTCCAAAATCACAG CGTTGAAAGTCTGCAGCCAGTGTGAGCCTGTGGGTGATGCACATTGAAAT GCTGACTCTTTATCGTGGACTCAGAGCAGGTTGGTAGGGAACAGAGCAGG GGTGGTGGTATGCTTATGGACCTGACGTGCAGGAGAGGGTCAGGGGTGAT CCAGCTAGGGGATCAGCGAGGGTCTGGTTAGGCAAGGGAGAAGATGCAGA AATGAGGATTCCAGGTGCTATTTCCTGCTCCCCAAAAGGCCAATTCCCTC CAGTCCCACACCCACCTGCACAATACTGGTTCAGGTCCATGGCCACCAAG AGGAGGAGGAGTGTGCAGCATCCAGGGTTCCTCATCCTCTCTGATGAGTG GAGTCTCAATCAGGACTAGTCTGTCTTTACTTTATAACCTGATGTGCCTG ATGCTGATTGGCTTCTCTTAAATTTCCCAAAGGCCGTGACGTAGACCTGA AGCGGTGGGTC	AATGATGTGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXTCTGCTTAACTGTGTACACCATTTTTAAT TGGGTCATTTGTGTTGGTGTCTAAATTCTTGAATTTGTAGAAATTTTGGA TATTAATACTTTGTCCAATGTAGGGATGGTGAAGATCCTTTCCCAATCTA TAGGCTATTGTTGTGTCCTATTGGCAGTGTCTTTTACCTTACAGGACCTT TTCAGTTTCAAGAAGTCCCACTAATTGATTGTTGATTGTATGGATTGTAT GGATCTCTTTGCATTTTTCTACAGGCAGACATCCATTTAGTACTGCACCA TTTGGTGAAGATTCTTTCTTTCCTACATGGCATAATTTTGAGTATTTTAG TAAAAATCAGGTGTCCATAATTGTATGTGTTTATTTCAGGGTCGTTGATT CAATTCCATTGATCAACATGACTGTTTCTATGCCAATACCATGAAGTTTT GATTACTCTTGCTCTGCAGTACAGCTTGAGGTCAGGGATGGTGATATTCC CAGAAGTTCTTTTATTGCTCTGCATTATTTTAGCAATTCTGGGTTTTTTA TTATGCTATATAAAGTTGAGAATTGTTCTTTCAATGCCTGGAAAGAATTA CACTGTAATTTTTTGATGAGAATTGCATTGGATCTGTAGATTTCCTTCTG TAAGATGGCCATTTCCA
quality values	Open. Hide. 7 8 7 9 9 19 28 29 30 20 16 12 10 10 16 18 13 8 8 8 21 21 23 19 10 10 10 19 19 17 8 8 8 8 15 28 36 28 29 22 17 17 25 27 39 39 39 53 53 47 53 47 40 40 30 40 33 43 40 33 30 28 22 29 24 40 26 42 41 41 41 43 50 50 50 47 47 47 48 48 47 46 43 47 43 41 41 41 48 33 40 29 38 29 27 32 44 43 47 57 57 57 50 48 48 47 48 48 48 47 48 47 48 48 57 57 50 57 54 54 50 50 41 41 41 50 50 50 50 50 50 50 50 50 57 57 57 57 59 59 68 57 57 57 57 57 57 50 50 50 50 50 52 52 52 50 47 57 57 57 57 57 57 57 57 57 57 52 52 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 43 43 39 43 43 57 57 57 57 57 57 52 52 52 57 52 57 57 57 57 57 57 57 57 57 57 57 59 57 57 57 57 68 57 57 52 52 52 52 52 52 52 52 57 52 59 57 57 52 52 57 57 57 57 57 57 57 57 57 57 59 59 57 59 57 57 57 57 52 52 50 43 35 28 31 43 43 57 48 48 48 50 50 57 57 57 50 57 50 43 43 43 43 42 43 42 57 54 57 57 54 57 57 57 57 57 57 48 48 48 57 57 59 59 59 59 59 59 59 59 59 59 59 41 39 35 44 44 44 32 27 18 17 17 22 29 32 41 41 43 43 43 43 59 47 43 39 39 39 47 43 48 48 43 43 40 39 39 43 43 48 48 59 47 47 34 34 18 21 16 10 10 10 15 17 16 15 15 19 20 14 16 15 11 11 12 14 15 19 22 22 36 39 43 36 43 33 37 28 33 32 40 40 48 57 48 42 43 43 43 43 43 43 43 54 57 54 59 54 42 42 42 39 43 46 46 54 57 48 48 42 34 30 29 23 20 18 15 15 15 18 24 30 28 28 23 34 40 33 33 39 31 37 31 31 23 28 32 32 32 35 29 40 25 25 23 32 32 39 39 43 43 48 48 48 46 43 43 41 41 41 39 36 27 33 28 34 34 40 33 33 33 33 33 43 39 48 43 43 39 43 39 43 57 39 43 43 37 37 36 33 39 35 35 37 37 39 39 39 36 37 36 39 31 37 39 41 37 31 33 33 33 33 37 37 32 26 31 30 30 25 17 17 19 19 23 28 28 30 30 24 25 25 27 37 26 28 20 32 32 37 37 36 36 36 43 39 40 40 39 39 35 35 28 28 28 30 30 37 30 33 31 27 28 28 35 39 21 17 12 19 20 29 32 46 41 41 37 37 37 37 34 24 19 19 17 21 21 27 32 34 22 19 9 13 8 9 9 10 13 10 20 18 21 12 12 11 12 12 16 22 11 11 11 23 28 34 34 25 23 16 23 19 28 22 21 21 23 17 17 19 19 10 9 9 9 9 9 13 17 15 10 10 8 12 11 10 13 8 14 14 13 24 15 17 16 21 14 15 15 19 19 23 22 11 11 9 9 11 16 16 12 9 9 8 10 9 11 11 18 12 11 11 11 14 16 17 12 8 8 8 8 10 17 13 11 12 12 12 12	Open. Hide. 7 7 6 6 6 8 8 14 7 7 7 10 19 18 17 14 19 32 33 27 27 27 25 25 39 39 37 37 39 39 25 25 35 35 26 26 12 16 15 23 26 35 35 24 19 19 12 16 17 26 22 43 43 47 47 48 48 48 42 32 42 32 28 28 28 20 42 36 36 41 42 54 54 54 54 50 50 57 57 48 47 48 48 48 48 42 42 41 41 41 42 57 57 57 57 68 68 57 57 57 57 57 57 47 48 47 57 48 50 57 50 50 48 50 37 37 37 50 36 36 22 32 32 33 44 50 57 57 68 57 57 57 57 57 57 57 57 57 57 57 50 50 50 50 48 48 68 50 50 50 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 43 39 33 39 33 39 39 43 57 57 57 57 57 57 57 57 57 57 57 35 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 57 57 57 39 39 39 39 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 52 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 52 52 37 52 52 57 52 54 54 57 57 57 54 54 57 57 52 54 54 59 57 59 59 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 57 59 57 57 59 59 59 57 57 57 57 48 57 48 54 54 57 40 36 28 28 28 25 30 36 32 36 35 35 32 37 32 35 35 42 37 28 25 23 23 28 28 23 28 28 35 39 39 46 46 30 30 24 24 12 23 12 11 11 17 11 11 13 30 30 30 11 10 8 8 8 8 10 9 9 9 9 9 9 9 11 17 23 23 30 32 37 34 47 43 39 39 37 37 30 29 29 23 28 23 28 28 39 32 35 35 35 35 28 28 23 19 28 15 15 14 14 14 18 18 21 21 23 28 19 19 13 12 12 16 24 28 29 32 20 20 15 19 12 9 9 9 9 10 13 17 12 15 11 11 11 12 18 25 18 15 11 21 18 13 15 12 12 13 12 19 19 19 15 12 13 13 15 34 26 23 14 14 23 17 23 19 23 16 11 15 18 15 13 13 15 18 20 11 19 20 23 12 13 8 10 8 8 10 17 26 32 24 22 22 28 25 21 8 8 8 8 10 10 10 10 10 12 12 19 11 12 15 24 25 18 13 12 21 16 20 14 14 12 17 15 8 10 14 26 25 26 30 20 22 9 9 9 10 15 22 36 39 25 30 13 13 15 19 18 16 11 9 13 9 9 9 12 11 11 11 16 19 10 10 10 15 15 21 22 21 16 15 20 11 12 16 18 25 15 17 10 10 10 19 16 18 20 17 17 28 28 25 21 12 10 9 9 10 10 12 8 8 8 8 8 12 9 8 9 15 21 16 15 10 10 8 8 8 7 6 6 6 6 7 9 15 11 11 12 23 17 19 9 8 8 8 8 8 13 19 15 19 18 16 11 9 8 8 8 8 8 8 8 8 8 8 8 9 9 9 13 8 8 8 8 12 13 10 10 10 11 11 10 10 10 10 10 10 10 10 13 8 8 8 9 9 10 16 11 18 18 19 19 11 14 13 15 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no095_i24.b1 MSMg01no095_i24.b1 CHROMAT_FILE:
MSMg01no095_i24.b1 PHD_FILE: MSMg01no095_i24.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:51:37 2005
         (321 letters)



>mm_chr17_36909873_36910593
          Length = 721

 Score =  574 bits (297), Expect = e-168
 Identities = 312/317 (98%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattcgcctgtctacctgtgacaattccgcaacgcttgctgtctcactggcccaatatg 64
           ||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 521 gaattcgtctgtctagctgtgacaattccgcaacgcttgctgtctcactggtccaatatg 462

                                                                       
Query: 65  tcattggcacctgctccatccatgcaacccgaggtagcaaaactgcaattggttctttgc 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 tcattggcacctgctccatccatgcaacccgaggtagcaaaactgcaattggttctttgc 402

                                                                       
Query: 125 tgtcatatctctgatactctatagagtctacatagccaatgtggatgaaccgggaattaa 184
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 401 tgtcatatctctgatactctatagagtctacatagccaatgtggacgaaccgggaattaa 342

                                                                       
Query: 185 ccatgccaggctccaaaatcacagcgttgaaagtctgcagccagtgtgagcctgtgggtg 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 341 ccatgccaggctccaaaatcacagcgttgaaagtctgcagccagtgtgagcctgtgggtg 282

                                                                       
Query: 245 atgcacattgaaatgctgactctttatcgtggactcagagcaggttggtagggaacagag 304
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 281 atgcacattgaaatgctgactctttagcgtggactcagagcaggttggtagggaacagag 222

                            
Query: 305 caggggtggtggtatgc 321
           |||||||||||||||||
Sbjct: 221 caggggtggtggtatgc 205


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 13
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 321
Length of database: 721
Length adjustment: 9
Effective length of query: 312
Effective length of database: 712
Effective search space:   222144
Effective search space used:   222144
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information