MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-384G10
Chromosome	17 (Build37)
Map Location	27,263,801 - 27,264,216
singlet/doublet	singlet
Overlap gene	2900010M23Rik
Upstream gene	Axin1, Pdia2, Arhgdig, Rgs11, Itfg3, LOC100042643, Luc7l, EG383229, EG240055, C230078M08Rik, Dusp1, EG666668, Ergic1, Atp6v0e, A930001N09Rik, Bnip1, Nkx2-5, Kifc1, Phf1, Cuta, Syngap1, Zbtb9, Bak1, Ggnbp1, Itpr3
Downstream gene	Ihpk3, Lemd2, LOC100042713, ENSMUSG00000073430, Grm4, LOC677010, Hmga1, AI413582, Nudt3, Rps10, Pacsin1, Spdef, LOC100042744, D17Wsu92e, EG666682, Snrpc, F830021D11Rik, Taf11, Anks1, Tcp11, 4930526A20Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Axin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12005 MGI:1096327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdia2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69191 MGI:1916441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgdig (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14570 MGI:108430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50782 MGI:1354739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itfg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106581 MGI:2146854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Luc7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66978 MGI:1914228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG383229 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383229 MGI:3649055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG240055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240055 MGI:3643092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230078M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319749 MGI:2442659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19252 MGI:105120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666668 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666668 MGI:3643826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 226 ESTs, 7 Proteins

name	Ergic1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67458 MGI:1914708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11974 MGI:1328318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930001N09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77128 MGI:1924378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bnip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224630 MGI:109328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkx2-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18091 MGI:97350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kifc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16580 MGI:109596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21652 MGI:98647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cuta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67675 MGI:1914925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Syngap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240057 MGI:3039785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins

name	Zbtb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:474156 MGI:1918022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12018 MGI:1097161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggnbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70772 MGI:3055306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itpr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16440 MGI:96624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900010M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67267 MGI:1914517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ihpk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271424 MGI:3045325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lemd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224640 MGI:2385045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042713 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	ENSMUSG00000073430 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038429 MGI:3642687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Grm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268934 MGI:1351341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 597 ESTs, 3 Proteins pseudo : _no_value

name	Hmga1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15361 MGI:96160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	AI413582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106672 MGI:2146839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56409 MGI:1928484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67097 MGI:1914347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pacsin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23969 MGI:1345181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spdef (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30051 MGI:1353422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042744 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D17Wsu92e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224647 MGI:106281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG666682 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666682 MGI:3644037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 164 ESTs, 3 Proteins pseudo : _no_value

name	Snrpc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20630 MGI:109489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F830021D11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224648 MGI:3041238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68776 MGI:1916026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anks1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224650 MGI:2446180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21463 MGI:98544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930526A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622485 MGI:3612449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 mRNAs, 158 ESTs, 3 Proteins

name	Axin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50979283 GeneID:12005 MGI:1096327
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : axin 1 transcript_id : NM_009733.1

name	Pdia2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486723 GeneID:69191 MGI:1916441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein disulfide isomerase associated 2 transcript_id : NM_001081070.1

name	Arhgdig (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130965 GeneID:14570 MGI:108430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GDP dissociation inhibitor (GDI) gamma transcript_id : NM_008113.3

name	Rgs11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486717 GeneID:50782 MGI:1354739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 11 transcript_id : NM_001081069.1

name	Itfg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386504 GeneID:106581 MGI:2146854
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha FG-GAP repeat containing 3 transcript_id : NM_207217.2

name	Luc7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158676 GeneID:66978 MGI:1914228
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Luc7 homolog (S. cerevisiae)-like transcript_id : NM_028190.2

name	Luc7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158673 GeneID:66978 MGI:1914228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Luc7 homolog (S. cerevisiae)-like transcript_id : NM_025881.2

name	EG383229 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401820 GeneID:383229 MGI:3649055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG383229 transcript_id : XM_356935.3

name	EG240055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116566 GeneID:240055 MGI:3643092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG240055 transcript_id : NM_001081656.1

name	C230078M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342547 GeneID:319749 MGI:2442659
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230078M08 gene transcript_id : NM_176995.2

name	Dusp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305422 GeneID:19252 MGI:105120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 1 transcript_id : NM_013642.1

name	EG666668 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401826 GeneID:666668 MGI:3643826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 226 ESTs, 7 Proteins product : predicted gene, EG666668 transcript_id : XM_985281.1

name	Ergic1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129827 GeneID:67458 MGI:1914708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 transcript_id : NM_026170.3

name	Atp6v0e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50659078 GeneID:11974 MGI:1328318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit E transcript_id : NM_025272.2

name	A930001N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794195 GeneID:77128 MGI:1924378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930001N09 gene transcript_id : NM_029870.1

name	Bnip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382697 GeneID:224630 MGI:109328
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2/adenovirus E1B interacting protein 1, NIP1 transcript_id : NM_172149.4

name	Nkx2-5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677926 GeneID:18091 MGI:97350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NK2 transcription factor related, locus 5 (Drosophila) transcript_id : NM_008700.2

name	Kifc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116642892 GeneID:16580 MGI:109596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member C1 transcript_id : NM_053173.2

name	Phf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185927 GeneID:21652 MGI:98647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 1 transcript_id : NM_009343.2

name	Cuta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21702736 GeneID:67675 MGI:1914925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cutA divalent cation tolerance homolog (E. coli) transcript_id : NM_026307.2

name	Cuta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130306 GeneID:67675 MGI:1914925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cutA divalent cation tolerance homolog (E. coli) transcript_id : NM_026948.2

name	Syngap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268701 GeneID:240057 MGI:3039785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : synaptic Ras GTPase activating protein 1 homolog (rat) transcript_id : XM_985548.2

name	Zbtb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607173 GeneID:474156 MGI:1918022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 9 transcript_id : NM_001005916.2

name	Bak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955301 GeneID:12018 MGI:1097161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-antagonist/killer 1 transcript_id : NM_007523.2

name	Ggnbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54400750 GeneID:70772 MGI:3055306
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gametogenetin binding protein 1 transcript_id : NM_027544.1

name	Itpr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61102727 GeneID:16440 MGI:96624
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-triphosphate receptor 3 transcript_id : NM_080553.2

name	2900010M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802405 GeneID:67267 MGI:1914517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900010M23 gene transcript_id : NM_026063.2

name	Ihpk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376092 GeneID:271424 MGI:3045325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol hexaphosphate kinase 3 transcript_id : NM_173027.2

name	Lemd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122562 GeneID:224640 MGI:2385045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LEM domain containing 2 transcript_id : NM_146075.1

name	LOC100042713 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268632 GeneID:100042713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042713 transcript_id : XM_001478663.1

name	ENSMUSG00000073430 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268634 GeneID:100038429 MGI:3642687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, ENSMUSG00000073430 transcript_id : XM_001478670.1

name	Grm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62945391 GeneID:268934 MGI:1351341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, metabotropic 4 transcript_id : NM_001013385.1

name	Hmga1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198322 GeneID:15361 MGI:96160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group AT-hook 1 transcript_id : NM_016660.2

name	Hmga1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198324 GeneID:15361 MGI:96160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group AT-hook 1 transcript_id : NM_001039356.1

name	Hmga1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86198320 GeneID:15361 MGI:96160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group AT-hook 1 transcript_id : NM_001025427.2

name	AI413582 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157526 GeneID:106672 MGI:2146839
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI413582 transcript_id : NM_001002895.2

name	Nudt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892043 GeneID:56409 MGI:1928484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleotide diphosphate linked moiety X)-type motif 3 transcript_id : NM_019837.2

name	Rps10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802751 GeneID:67097 MGI:1914347
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S10 transcript_id : NM_025963.2

name	Pacsin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892741 GeneID:23969 MGI:1345181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C and casein kinase substrate in neurons 1 transcript_id : NM_011861.2

name	Pacsin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802835 GeneID:23969 MGI:1345181
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C and casein kinase substrate in neurons 1 transcript_id : NM_178365.2

name	Spdef (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802606 GeneID:30051 MGI:1353422
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAM pointed domain containing ets transcription factor transcript_id : NM_013891.3

name	LOC100042744 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268636 GeneID:100042744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042744 transcript_id : XM_001478737.1

name	D17Wsu92e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461985 GeneID:224647 MGI:106281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 17, Wayne State University 92, expressed transcript_id : NM_001044719.1

name	D17Wsu92e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461983 GeneID:224647 MGI:106281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 17, Wayne State University 92, expressed transcript_id : NM_001033279.2

name	Snrpc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044893 GeneID:20630 MGI:109489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U1 small nuclear ribonucleoprotein C transcript_id : NM_011432.2

name	F830021D11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107590 GeneID:224648 MGI:3041238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F830021D11 gene transcript_id : NM_001080769.1

name	Taf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802483 GeneID:68776 MGI:1916026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_026836.2

name	Anks1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130667 GeneID:224650 MGI:2446180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SAM domain containing 1 transcript_id : NM_181413.3

name	Tcp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475950 GeneID:21463 MGI:98544
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex protein 11 transcript_id : NM_013687.2

name	Axin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50979284 CCDS:CCDS28547.1 GeneID:12005 MGI:1096327
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016328 - lateral plasma membrane [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0030163 - protein catabolism [Evidence IDA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence IPI] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : axis inhibition product : axin 1 protein_id : NP_033863.1

name	Pdia2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486724 GeneID:69191 MGI:1916441
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003756 - protein disulfide isomerase activity [Evidence TAS]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : protein disulfide isomerase (pancreas) like; protein disulfide isomerase, pancreatic product : protein disulfide isomerase associated 2 protein_id : NP_001074539.1

name	Arhgdig (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679989 CCDS:CCDS28548.1 GeneID:14570 MGI:108430
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005094 - Rho GDP-dissociation inhibitor activity [Evidence IEA] codon_start : 1 note : guanosine diphosphate (GDP) dissociation inhibitor 5, Rho associated product : Rho GDP dissociation inhibitor (GDI) gamma protein_id : NP_032139.1

name	Rgs11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486718 GeneID:50782 MGI:1354739
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS] [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 product : regulator of G-protein signaling 11 protein_id : NP_001074538.1

name	Itfg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402185 GeneID:106581 MGI:2146854
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : integrin alpha FG-GAP repeat containing 3 protein_id : NP_997100.1

name	Luc7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158677 CCDS:CCDS28549.1 GeneID:66978 MGI:1914228
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045843 - negative regulation of striated muscle development [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Luc7 homolog (S. cerevisiae)-like isoform 2 protein_id : NP_082466.2

name	Luc7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536228 CCDS:CCDS28550.1 GeneID:66978 MGI:1914228
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045843 - negative regulation of striated muscle development [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Luc7 homolog (S. cerevisiae)-like isoform 1 protein_id : NP_080157.1

name	EG383229 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401821 GeneID:383229 MGI:3649055
definition	codon_start : 1 product : similar to Hemoglobin subunit alpha (Hemoglobin alpha chain) (Alpha-globin) protein_id : XP_356935.3

name	EG240055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116567 GeneID:240055 MGI:3643092
definition	codon_start : 1 note : neuralized-2 product : neuralized 2 protein_id : NP_001075125.1

name	C230078M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892843 GeneID:319749 MGI:2442659
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319749 protein_id : NP_795969.1

name	Dusp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305423 CCDS:CCDS28552.1 GeneID:19252 MGI:105120
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : protein tyrosine phosphatase, non-receptor type 16 product : dual specificity phosphatase 1 protein_id : NP_038670.1

name	EG666668 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401827 GeneID:666668 MGI:3643826
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990375.1

name	Ergic1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385678 CCDS:CCDS28553.1 GeneID:67458 MGI:1914708
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 protein_id : NP_080446.1

name	Atp6v0e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384606 CCDS:CCDS28554.1 GeneID:11974 MGI:1328318
definition	GO_component : GO:0016020 - membrane [Evidence ISS]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA] GO_process : GO:0015991 - ATP hydrolysis coupled proton transport [Evidence ISS]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting lysosomal (vacuolar proton pump), 9.2 kDa; lysosomal 9kDa; ATPase, H+ transporting, lysosomal 9kD V0 subunit E; ATPase, H+ transporting, V0 subunit product : ATPase, H+ transporting, V0 subunit e protein_id : NP_079548.1

name	A930001N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794196 GeneID:77128 MGI:1924378
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77128 protein_id : NP_084146.1

name	Bnip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098151 CCDS:CCDS28555.1 GeneID:224630 MGI:109328
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence ISS]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0031201 - SNARE complex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS] [Evidence IEA]; GO:0016320 - endoplasmic reticulum membrane fusion [Evidence ISS]; GO:0007029 - endoplasmic reticulum organization and biogenesis [Evidence ISS]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SNARE protein SEC20 product : BCL2/adenovirus E1B 19kDa-interacting protein 1, NIP1 protein_id : NP_742161.3

name	Nkx2-5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679068 CCDS:CCDS28556.1 GeneID:18091 MGI:97350
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0007512 - adult heart development [Evidence IMP]; GO:0048738 - cardiac muscle development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0035050 - embryonic heart tube development [Evidence IGI]; GO:0007507 - heart development [Evidence IMP]; GO:0001947 - heart looping [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Drosophila NK2 transcription factor related, locus 5 product : NK2 transcription factor related, locus 5 protein_id : NP_032726.1

name	Kifc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116642893 GeneID:16580 MGI:109596
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA] [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence ISS] [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : kinesin family member C5A; kinesin-related protein KIFC5A; kinesin family c-terminal 5A; kinesin motor protein KIFC4 product : kinesin family member C1 protein_id : NP_444403.2

name	Phf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185928 GeneID:21652 MGI:98647
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : t-complex testis-expressed 3 product : PHD finger protein 1 protein_id : NP_033369.2

name	Cuta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62198210 CCDS:CCDS28557.1 GeneID:67675 MGI:1914925
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; divalent cation tolerant protein CUTA product : divalent cation tolerant protein CUTA isoform 1 protein_id : NP_080583.3

name	Cuta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62198239 GeneID:67675 MGI:1914925
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; divalent cation tolerant protein CUTA product : divalent cation tolerant protein CUTA isoform 2 protein_id : NP_081224.1

name	Syngap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268702 GeneID:240057 MGI:3039785
definition	codon_start : 1 product : similar to SynGAP-a protein_id : XP_990642.2

name	Zbtb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54400753 GeneID:474156 MGI:1918022
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 9 protein_id : NP_001005916.1

name	Bak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955302 CCDS:CCDS28558.1 GeneID:12018 MGI:1097161
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0008635 - caspase activation via cytochrome c [Evidence IMP] codon_start : 1 note : Bcl2 homologous antagonist/killer product : BCL2-antagonist/killer 1 protein_id : NP_031549.2

name	Ggnbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54400751 CCDS:CCDS28559.1 GeneID:70772 MGI:3055306
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : gametogenin binding protein 1 product : gametogenetin binding protein 1 protein_id : NP_081820.1

name	Itpr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61102728 CCDS:CCDS28560.1 GeneID:16440 MGI:96624
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005220 - inositol 1,4,5-triphosphate-sensitive calcium-release channel activity [Evidence IDA]; GO:0008095 - inositol-1,4,5-triphosphate receptor activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : inositol 1,4,5-triphosphate receptor 3 protein_id : NP_542120.2

name	2900010M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385560 CCDS:CCDS28561.1 GeneID:67267 MGI:1914517
definition	codon_start : 1 product : hypothetical protein LOC67267 protein_id : NP_080339.1

name	Ihpk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370542 CCDS:CCDS28562.1 GeneID:271424 MGI:3045325
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0050517 - inositol hexakisphosphate kinase activity [Evidence IEA]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : inositol hexaphosphate kinase 3 protein_id : NP_766615.1

name	Lemd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122563 GeneID:224640 MGI:2385045
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005635 - nuclear envelope [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : nuclear envelope constituent product : LEM domain containing 2 protein_id : NP_666187.1

name	LOC100042713 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268633 GeneID:100042713
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478713.1

name	ENSMUSG00000073430 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268635 GeneID:100038429 MGI:3642687
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478720.1

name	Grm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945392 CCDS:CCDS28563.1 GeneID:268934 MGI:1351341
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001642 - group III metabotropic glutamate receptor activity [Evidence TAS]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007612 - learning [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP] codon_start : 1 note : G protein-coupled receptor GRM4; G protein-coupled receptor, family C, group 1, member D product : glutamate receptor, metabotropic 4 protein_id : NP_001013403.1

name	Hmga1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909308 CCDS:CCDS28564.1 GeneID:15361 MGI:96160
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence ISS]; GO:0042975 - peroxisome proliferator activated receptor binding [Evidence ISS]; GO:0046965 - retinoid X receptor binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006323 - DNA packaging [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 note : high mobility group protein I product : high mobility group AT-hook 1 protein_id : NP_001020598.1

name	Hmga1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198325 CCDS:CCDS28564.1 GeneID:15361 MGI:96160
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence ISS]; GO:0042975 - peroxisome proliferator activated receptor binding [Evidence ISS]; GO:0046965 - retinoid X receptor binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006323 - DNA packaging [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 note : high mobility group protein I product : high mobility group AT-hook 1 protein_id : NP_001034445.1

name	Hmga1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198323 CCDS:CCDS28564.1 GeneID:15361 MGI:96160
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence ISS]; GO:0042975 - peroxisome proliferator activated receptor binding [Evidence ISS]; GO:0046965 - retinoid X receptor binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006323 - DNA packaging [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 note : high mobility group protein I product : high mobility group AT-hook 1 protein_id : NP_057869.2

name	AI413582 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157527 GeneID:106672 MGI:2146839
definition	codon_start : 1 product : hypothetical protein LOC106672 protein_id : NP_001002895.2

name	Nudt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789933 CCDS:CCDS28566.1 GeneID:56409 MGI:1928484
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : diphosphoinositol polyphosphate phosphohydrolase product : nudix (nucleotide diphosphate linked moiety X)-type motif 3 protein_id : NP_062811.1

name	Rps10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13399310 GeneID:67097 MGI:1914347
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein S10 protein_id : NP_080239.1

name	Pacsin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754974 CCDS:CCDS28567.1 GeneID:23969 MGI:1345181
definition	GO_component : GO:0030137 - COPI-coated vesicle [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005802 - Golgi trans face [Evidence IDA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0045806 - negative regulation of endocytosis [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : Syndapin I product : protein kinase C and casein kinase substrate in neurons 1 protein_id : NP_035991.1

name	Pacsin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559412 CCDS:CCDS28567.1 GeneID:23969 MGI:1345181
definition	GO_component : GO:0030137 - COPI-coated vesicle [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005802 - Golgi trans face [Evidence IDA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0045806 - negative regulation of endocytosis [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : Syndapin I product : protein kinase C and casein kinase substrate in neurons 1 protein_id : NP_848142.1

name	Spdef (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305415 CCDS:CCDS28568.1 GeneID:30051 MGI:1353422
definition	GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : prostate specific ets transcription factor product : SAM pointed domain containing ets transcription factor protein_id : NP_038919.1

name	LOC100042744 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268637 GeneID:100042744
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478787.1

name	D17Wsu92e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461986 GeneID:224647 MGI:106281
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC224647 isoform 2 protein_id : NP_001038184.1

name	D17Wsu92e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461984 CCDS:CCDS28569.1 GeneID:224647 MGI:106281
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC224647 isoform 1 protein_id : NP_001028451.2

name	Snrpc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755596 CCDS:CCDS28570.1 GeneID:20630 MGI:109489
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : U1 small nuclear ribonucleoprotein 1C protein_id : NP_035562.1

name	F830021D11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107591 GeneID:224648 MGI:3041238
definition	codon_start : 1 product : hypothetical protein LOC224648 protein_id : NP_001074238.1

name	Taf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794436 CCDS:CCDS28571.1 GeneID:68776 MGI:1916026
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_081112.1

name	Anks1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088892 GeneID:224650 MGI:2446180
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Odin product : ankyrin repeat and sterile alpha motif domain containing 1 protein_id : NP_852078.1

name	Tcp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305563 GeneID:21463 MGI:98544
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : t-complex protein 11 protein_id : NP_038715.1

name	LOC100042643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042643
definition	number : 1 pseudo : _no_value

name	LOC100042643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042643
definition	number : 2 pseudo : _no_value

name	LOC677010 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268703 GeneID:677010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 597 ESTs, 3 Proteins product : similar to ribosomal protein L30 pseudo : _no_value transcript_id : XR_034529.1

name	EG666682 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94401830 GeneID:666682 MGI:3644037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 164 ESTs, 3 Proteins product : predicted gene, EG666682 pseudo : _no_value transcript_id : XR_002050.1

name	4930526A20Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94401833 GeneID:622485 MGI:3612449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 mRNAs, 158 ESTs, 3 Proteins product : RIKEN cDNA 4930526A20 gene transcript_id : XR_001613.1

clone name	MSMg01-263G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-399H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-088C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146M19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-269D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-202M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-384G10.T7 (MSMg01no384_g10.b1)	MSMg01-384G10.TJ (MSMg01no384_g10.g1)
ACC	AG487846	AG487847
length	764	761
length of high quality (start - end)	502 (35 - 536)	419 (64 - 482)
definition	CHROMAT_FILE: MSMg01no384_g10.b1 PHD_FILE: MSMg01no384_g10.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:26:41 2005	CHROMAT_FILE: MSMg01no384_g10.g1 PHD_FILE: MSMg01no384_g10.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:26:41 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCAGAACT TTTCAGCTGGGGAACGGCGGTAACCCGTAAGTATAGCTTTACGAGGTAAG CCTGGCCTTGAACTTTCTAAGGAAATTCAAGACAGTCTATCAGAAGTAAA GTGGAAAATAGCTTTATAAGGTATGTTTGGCCTTGAACTTTCTCTAGTGT TAGAAGCCCTTTTGTTCCTTTTCACATGTTATCAGGTGATTAAGATAGGG CTAAGGATTCTAGATGAAATTTAGGACAATCTATCAGAAGTAAAGCGGGG AGAGAGAGTAGGAGCAAAGAGAAAATATGGTTCACAAAATAAGTATACAG GCCTTTCCAAGGGTCTTGAACCCGAGGAAAAGTTTAGGTCAGGTAAGAAT ACCTGGGGAGAGATTAGAAGGAAGGAGAAGGAAAAAGAAAAGAAAAAAGA TCAATCAGCAGAGGTTTCTAGGAGAAGGAGCCTATACTCATCACTAGGTG AGCTCAAGGAGCCAGTTCTTAATAGTTCTGAATCAGATGAAAAGGCTATT ANGGCCTGGAAGGCGCTCTCCCGAGCCAGTGAAGCCCCTGGACAATAATG ACAGAGGCAGGCTCTTACCGCCTACAAGGGCTTATTGTCACCCTCGGAGT TGTAAACAAGATTGTAAAGGGGAATTTCGGTTCCTGTTCTGGTCCCCCAA AGGGCTTTCTTAATTTCCAGGGGGGAAATAAGTTCCCTATAAATTTTGGC AGCCCACCTGGGTG	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXAAACGACGGCTTTTTTCTTCCCTCACTTAAGCCCTTT CTTGAAGAGTGAGCATATAAATAAATCAGGGGTTAAGCATTGCAGCGAGG CAGCCTGTGTGTCTTCTGCCTGCATGTCAAACAAGGTCCCAGTTCTCAGC CGGCACAGCCCCAGCCCTGCTTGCCTTTCTACAGATGGTCCCCCTGCTCG GGGTCGGCAGGGGCTGTCCAGGAGGCCAGCGGGGGGGGGCGGGGTGTCTG TGGGTTGACACAGGTGAGCTACATAACTAAGACATTAAAACAGGAAGATG CGTGGGGCTGGCATCTCCCTGACAAGGGCTGGCAGGACAAAGGGTGGCAG CCATGTCCTCCAAGGAGGGTATGTGTGGCACACTGCTGATACTGCTTCCT TTAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCCCGTTTTATCTT TACCCCTCTTTATACCTATACTGATCTTCTTGTAATGTTGCTAGAATTCC ATCTCATTATCTTGAACAGCTTTATTCTCCTTAACTCTTTTCCATCTTTT TTCTTTTTTCCTTTATTTTCCTCTTTTTTATTCTCTCGCCTTATTACACC TTTTATTCTATTCCCCCCCATTTTTAATTATCCACACTAACTATATCTTT GTCTTTCCCTTATTTTCCCTTTTATTTTTCCTCCTTTCTTCCCCAATTTT TTTTTTTATTC
quality values	Open. Hide. 14 14 18 14 12 19 11 9 9 13 14 34 37 46 26 19 17 17 17 19 22 16 11 11 13 19 32 39 59 30 28 22 17 17 27 36 39 39 24 19 19 28 23 23 30 31 31 39 50 50 53 36 35 30 35 35 35 57 57 57 57 53 53 53 50 50 50 57 57 57 54 54 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 50 57 57 47 57 50 57 50 50 54 57 57 57 57 57 57 68 68 68 68 68 68 57 57 57 57 57 57 50 50 50 50 50 50 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 57 57 57 57 59 59 59 59 59 59 57 57 57 57 57 57 59 59 68 68 59 68 68 68 68 68 59 59 57 57 57 59 59 68 68 68 57 57 57 57 57 57 59 59 59 57 52 52 59 59 59 59 59 59 68 68 68 59 59 57 57 57 57 57 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 48 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 57 59 57 57 57 57 57 68 68 68 68 57 57 57 57 48 48 48 48 48 59 59 68 68 68 68 57 57 57 57 57 57 59 57 57 57 57 57 43 50 47 37 37 30 30 39 39 59 48 59 47 59 59 59 44 44 44 39 37 44 44 59 59 59 46 46 43 59 59 59 59 48 48 48 48 47 47 39 40 36 36 39 47 39 39 39 47 37 34 30 30 30 36 36 43 43 46 46 36 39 36 32 32 32 28 26 32 32 29 29 32 39 47 43 36 36 28 28 28 34 34 37 37 36 31 31 36 37 37 37 37 34 28 28 28 30 25 32 30 25 22 28 28 29 24 34 34 36 31 24 28 23 31 25 25 34 37 37 31 25 23 16 11 11 11 13 9 11 10 11 15 12 22 28 28 30 15 16 3 0 3 14 14 20 31 23 29 14 12 12 9 9 10 19 15 16 12 11 11 9 9 11 6 6 6 6 6 6 8 15 9 11 9 9 9 10 9 9 11 11 10 12 9 9 13 17 17 10 10 10 10 13 10 9 9 9 9 10 10 11 9 11 11 10 9 9 8 10 8 9 12 9 10 10 13 9 10 8 10 8 8 8 8 8 10 10 9 10 10 17 6 6 6 6 6 6 8 8 10 10 10 10 10 9 9 9 9 9 10 10 11 11 12 10 10 10 10 16 10 12 10 12 11 13 8 8 8 8 9 8 9 9 12 11 12 11 9 9 9 9 9 11 11 13 6 6 6 6 8 9 11 10 15 11 7 6 6 6 8 6 11 11 9 9 10 11 11 13 16 23 11 10 10 9 9 9 9 9 9 9 11 9 9 10 8 8 8 9 8 8 8 9 9 8 6 6 6 8 11 11 12 12 13 12 11 11 11 9 8 8 8 8	Open. Hide. 6 6 6 8 19 23 28 32 28 28 23 28 28 28 37 37 17 23 9 9 7 7 7 8 15 19 10 12 12 19 21 34 32 29 29 34 23 22 20 33 30 30 43 47 43 25 23 12 9 9 10 10 15 19 34 39 39 19 10 11 16 17 14 16 15 23 36 44 39 41 42 42 50 50 59 59 59 57 53 50 50 50 53 57 50 50 50 50 50 50 53 50 50 53 53 50 50 50 50 42 41 44 44 41 37 36 37 37 37 37 37 37 59 59 59 59 59 59 47 41 41 37 37 33 33 33 32 32 31 37 37 39 39 39 47 59 59 50 50 50 53 53 57 57 57 57 57 57 57 57 57 50 50 53 53 53 59 59 59 68 68 68 68 68 68 68 68 68 68 57 59 59 59 59 68 68 68 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 68 68 68 68 59 59 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 68 68 59 59 57 59 54 57 57 59 59 59 59 59 59 57 57 57 59 59 57 57 57 57 57 57 57 57 68 68 68 68 59 59 57 52 52 52 57 57 57 59 59 57 57 52 57 57 59 59 59 59 59 59 43 43 39 38 38 27 28 24 23 20 35 28 43 44 62 62 62 68 68 68 68 68 68 68 68 57 57 57 57 52 57 57 57 57 57 57 59 59 57 57 68 57 57 57 59 57 57 57 68 68 68 68 59 59 57 57 57 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 52 52 52 52 52 52 59 52 52 52 57 52 52 52 52 52 52 57 57 68 68 68 57 57 52 48 57 59 57 57 48 50 50 57 57 57 57 44 44 43 44 44 57 59 59 59 59 59 57 57 57 48 48 48 57 57 57 57 54 54 57 57 68 68 68 57 59 54 54 54 59 59 68 68 59 59 54 44 44 39 32 35 37 42 43 32 32 23 23 23 28 28 23 28 15 25 12 17 17 32 30 30 14 14 14 21 10 10 10 15 17 10 8 8 8 8 10 10 8 8 6 6 6 8 8 8 8 9 10 10 13 11 11 11 8 8 8 8 9 9 14 9 10 10 13 13 8 8 7 7 8 8 6 6 8 10 13 9 8 8 8 10 8 8 6 6 8 8 8 8 10 8 8 8 8 8 8 8 8 8 9 9 9 9 9 9 9 9 10 13 10 9 8 8 8 8 8 8 10 10 15 16 19 12 12 9 9 10 10 10 8 8 10 10 10 10 8 8 8 8 8 9 9 11 10 9 9 9 9 11 10 10 8 10 8 8 10 8 10 10 8 8 6 6 8 8 6 6 7 8 13 8 8 6 6 8 8 8 8 8 8 9 10 10 8 8 8 9 10 12 12 15 15 19 20 24 16 16 15 15 15 9 10 8 8 8 8 8 9 9 8 8 8 6 6 10 10 10 8 11 8 10 9 9 9 15 19 13 11 10 9 8 8 8 8 8 8 10 8 9 12 11 10 8 8 8 10 8 9 16 24 22 8 8 8 10 12 15 10 6 6 8 8 8 8 13 8 6 6 8 8 17 15 14 21 30 24 22 10 8 8 10 10 14 17 20 15 8 8 6 7 8 8 13 13 18 34 32 10 10 6 6 6 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no384_g10.g1 MSMg01no384_g10.g1 CHROMAT_FILE:
MSMg01no384_g10.g1 PHD_FILE: MSMg01no384_g10.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:26:41 2005
         (419 letters)



>mm_chr17_27263601_27264415
          Length = 815

 Score =  712 bits (368), Expect = 0.0
 Identities = 405/420 (96%), Gaps = 6/420 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaacgacggcttttttcttccctcacttaagccctttcttgaagagtgagcatataaata 60
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 aaacgacggctttttgcttccctcacttaagccctttcttgaagagtgagcatataaata 260

                                                                       
Query: 61  aatcaggggttaagcattgcagcgaggcagcctgtgtgtcttctgcctgcatgtcaaaca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 aatcaggggttaagcattgcagcgaggcagcctgtgtgtcttctgcctgcatgtcaaaca 320

                                                                       
Query: 121 aggtcccagttctcagccggcacagccccagccctgcttgcctttctacagatggtcccc 180
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 321 aggtcccagttctcagccggcacagccccagccctgtttgcctttctacagatggtcccc 380

                                                                       
Query: 181 ctgctcggggtcggcaggggctgtccaggaggccagcgggggggggcggggtgtctgtgg 240
           ||||||||||||||||||||||||||||||||||||||||||    ||||| ||||||||
Sbjct: 381 ctgctcggggtcggcaggggctgtccaggaggccagcggggg----cggggggtctgtgg 436

                                                                       
Query: 241 gttgacacaggtgagctacataactaagacattaaaacaggaagatgcgtggggctggca 300
           ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 437 gttgatacaggtgagctacataactaagacattaaaacaggaagatgcatggggctggca 496

                                                                       
Query: 301 tctccctgacaagggctggcaggacaaagggtggcagccatgtcctccaaggagggtatg 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 497 tctccctgacaagggctggcaggacaaagggtggcagccatgtcctccaaggagggtatg 556

                                                                       
Query: 361 tgtggcacactgctgatactgcttcctttaggtgtgtgt--gtgtgtgtgtgtgtgtgtg 418
           ||||||||||||||||| |||||||||||||||||||||  ||| ||| ||| |||||||
Sbjct: 557 tgtggcacactgctgatgctgcttcctttaggtgtgtgttcgtgcgtgcgtgcgtgtgtg 616


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 13
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 419
Length of database: 815
Length adjustment: 9
Effective length of query: 410
Effective length of database: 806
Effective search space:   330460
Effective search space used:   330460
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information