MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-436B23
Chromosome	17 (Build37)
Map Location	18,950,679 - 18,951,023
singlet/doublet	singlet
Overlap gene	Vmn2r-ps117
Upstream gene	EG626942, 4930546H06Rik, Has1, Fpr1, Fpr-rs2, LOC665183, LOC670250, EG665187, LOC546683, Fprl1, LOC627060, Fpr-rs4, EG637021, EG665210, Vmn2r92, EG665227, EG627132, LOC100041612, Vmn2r95, Vmn2r-ps114, EG433070, Vmn2r-ps115
Downstream gene	LOC100042183, EG627367, EG224552, LOC665344, LOC627466, LOC627476, EG665371, EG665376, EG627537, EG627576, EG224572, EG627618, EG627636, LOC100042273
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG626942 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626942 MGI:3645076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins

name	4930546H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75202 MGI:1922452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Has1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15116 MGI:106590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fpr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14293 MGI:107443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fpr-rs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14289 MGI:1278319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665183 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC670250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG665187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665187 MGI:3644434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 148 ESTs, 6 Proteins pseudo : _no_value

name	LOC546683 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Fprl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14294 MGI:1194495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627060 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Fpr-rs4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14291 MGI:1278317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 Proteins

name	EG637021 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637021 MGI:3643332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	EG665210 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665210 MGI:3645072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Vmn2r92 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG665227 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665227 MGI:3648050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG627132 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627132 MGI:3645591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	LOC100041612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Vmn2r95 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	Vmn2r-ps114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG433070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433070 MGI:3644514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Vmn2r-ps115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100042183 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs

name	EG627367 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627367 MGI:3645271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 16 Proteins

name	EG224552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224552 MGI:3647977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	LOC665344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC627466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC627476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	EG665371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665371 MGI:3644541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG665376 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665376 MGI:3644540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG627537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627537 MGI:3648026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	EG627576 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627576 MGI:3648468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG224572 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224572 MGI:3647786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	EG627618 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627618 MGI:3643811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	EG627636 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627636 MGI:3644032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins

name	LOC100042273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 2 Proteins

name	EG626942 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268496 GeneID:626942 MGI:3645076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins product : predicted gene, EG626942 transcript_id : XM_891564.2

name	4930546H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802652 GeneID:75202 MGI:1922452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930546H06 gene transcript_id : NM_029205.2

name	Has1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680168 GeneID:15116 MGI:106590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronan synthase1 transcript_id : NM_008215.1

name	Fpr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71361679 GeneID:14293 MGI:107443
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formyl peptide receptor 1 transcript_id : NM_013521.2

name	Fpr-rs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50345973 GeneID:14289 MGI:1278319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formyl peptide receptor, related sequence 2 transcript_id : NM_008039.2

name	LOC670250 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268571 GeneID:670250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to mitochondrial ribosomal protein L41 transcript_id : XM_001478218.1

name	Fprl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358929 GeneID:14294 MGI:1194495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formyl peptide receptor-like 1 transcript_id : NM_008042.2

name	EG637021 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268498 GeneID:637021 MGI:3643332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG637021 transcript_id : XM_975323.2

name	EG665210 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268502 GeneID:665210 MGI:3645072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG665210 transcript_id : XM_975359.2

name	Vmn2r92 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268508 GeneID:627111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : vomeronasal receptor Vmn2r92 transcript_id : XM_001476639.1

name	EG665227 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268510 GeneID:665227 MGI:3648050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG665227 transcript_id : XM_975475.2

name	EG627132 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268512 GeneID:627132 MGI:3645591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG627132 transcript_id : XM_891791.3

name	LOC100041612 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268514 GeneID:100041612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to pol protein transcript_id : XM_001476688.1

name	Vmn2r95 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268518 GeneID:328759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : vomeronasal receptor Vmn2r95 transcript_id : XM_001476711.1

name	EG433070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268524 GeneID:433070 MGI:3644514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG433070 transcript_id : XM_484597.5

name	LOC100042183 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268580 GeneID:100042183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs product : hypothetical protein LOC100042183 transcript_id : XM_001478279.1

name	EG627367 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268529 GeneID:627367 MGI:3645271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 16 Proteins product : predicted gene, EG627367 transcript_id : XM_892023.3

name	EG224552 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268531 GeneID:224552 MGI:3647977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG224552 transcript_id : XM_139768.6

name	EG665376 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401676 GeneID:665376 MGI:3644540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG665376 transcript_id : XM_976485.1

name	EG627576 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268535 GeneID:627576 MGI:3648468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG627576 transcript_id : XM_892246.3

name	EG224572 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268538 GeneID:224572 MGI:3647786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG224572 transcript_id : XM_139786.7

name	EG627618 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268540 GeneID:627618 MGI:3643811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG627618 transcript_id : XM_892296.2

name	EG627636 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268542 GeneID:627636 MGI:3644032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : predicted gene, EG627636 transcript_id : XM_892318.2

name	LOC100042273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268588 GeneID:100042273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 2 Proteins product : similar to Crx opposite strand transcript 1 transcript_id : XM_001478305.1

name	EG626942 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268497 GeneID:626942 MGI:3645076
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_896657.2

name	4930546H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037403 GeneID:75202 MGI:1922452
definition	codon_start : 1 product : hypothetical protein LOC75202 protein_id : NP_083481.1

name	Has1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680169 GeneID:15116 MGI:106590
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050501 - hyaluronan synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : hyaluronan synthase1 protein_id : NP_032241.1

name	Fpr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305065 CCDS:CCDS28418.1 GeneID:14293 MGI:107443
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004982 - N-formyl peptide receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : lipoxin A4 receptor product : formyl peptide receptor 1 protein_id : NP_038549.1

name	Fpr-rs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679853 CCDS:CCDS28419.1 GeneID:14289 MGI:1278319
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004943 - C3a anaphylatoxin receptor activity [Evidence IEA]; GO:0004982 - N-formyl peptide receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : lipoxin A4 receptor-like protein product : formyl peptide receptor, related sequence 2 protein_id : NP_032065.1

name	LOC670250 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268572 GeneID:670250
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478268.1

name	Fprl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358930 CCDS:CCDS28420.1 GeneID:14294 MGI:1194495
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004943 - C3a anaphylatoxin receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004982 - N-formyl peptide receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence TAS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : formyl peptide receptor-like 1 protein_id : NP_032068.2

name	EG637021 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268499 GeneID:637021 MGI:3643332
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_980417.2

name	EG665210 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268503 GeneID:665210 MGI:3645072
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_980453.2

name	Vmn2r92 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268509 GeneID:627111
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001476689.1

name	EG665227 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268511 GeneID:665227 MGI:3648050
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_980569.2

name	EG627132 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268513 GeneID:627132 MGI:3645591
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_896884.3

name	LOC100041612 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268515 GeneID:100041612
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001476738.1

name	Vmn2r95 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268519 GeneID:328759
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001476761.1

name	EG433070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268525 GeneID:433070 MGI:3644514
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_484597.5

name	LOC100042183 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268581 GeneID:100042183
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478329.1

name	EG627367 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268530 GeneID:627367 MGI:3645271
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897116.3

name	EG224552 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268532 GeneID:224552 MGI:3647977
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_139768.6

name	EG665376 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401677 GeneID:665376 MGI:3644540
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_981579.1

name	EG627576 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268536 GeneID:627576 MGI:3648468
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897339.3

name	EG224572 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268539 GeneID:224572 MGI:3647786
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_139786.7

name	EG627618 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268541 GeneID:627618 MGI:3643811
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897389.2

name	EG627636 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268543 GeneID:627636 MGI:3644032
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897411.2

name	LOC100042273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268589 GeneID:100042273
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478355.1

name	LOC665183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665183
definition	number : 2 pseudo : _no_value

name	LOC665183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665183
definition	number : 1 pseudo : _no_value

name	LOC546683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546683
definition	number : 1 pseudo : _no_value

name	LOC627060 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627060
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps114 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041645
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps114 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041645
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 7 pseudo : _no_value

name	Vmn2r-ps115 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665292
definition	number : 8 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665303
definition	number : 7 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 1 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 2 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 3 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 4 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 5 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 6 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 7 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 8 pseudo : _no_value

name	LOC627466 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627466
definition	number : 1 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 1 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 2 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 3 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 4 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 5 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 6 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 7 pseudo : _no_value

name	EG665371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665371
definition	number : 1 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 1 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 2 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 3 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 4 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 5 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 6 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 7 pseudo : _no_value

name	EG665187 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268568 GeneID:665187 MGI:3644434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 148 ESTs, 6 Proteins product : predicted gene, EG665187 pseudo : _no_value transcript_id : XR_001702.2

name	Fpr-rs4 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268573 GeneID:14291 MGI:1278317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 Proteins product : formyl peptide receptor, related sequence 4 transcript_id : XR_035345.1

clone name	MSMg01-115N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356J01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145F02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-271I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-385P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049G13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-327B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080G16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-311J01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-187B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-217N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093A08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491O19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-309A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-120L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-438I08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-178B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-443H23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-308B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-540D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-134M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-350H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-173G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342M09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-111P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177L11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-436B23.T7 (MSMg01no436_b23.b1)	MSMg01-436B23.TJ (MSMg01no436_b23.g1)
ACC	AG527265	AG527266
length	768	760
length of high quality (start - end)	518 (47 - 564)	425 (75 - 499)
definition	CHROMAT_FILE: MSMg01no436_b23.b1 PHD_FILE: MSMg01no436_b23.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:01:07 2005	CHROMAT_FILE: MSMg01no436_b23.g1 PHD_FILE: MSMg01no436_b23.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:01:07 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	NTCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCG GAATTCCATTGTGTAAATGTGTCACATTTTCTGTACCCATTCCTCTGTTG AGGGACATCTGGGTTCTTTCCAGCTCTGGCTATTATAAATTAGGCTGCTA TGAATATAGTGTATCATGTGTCCTTATTACCAGTTGGAGCATCTTTGGGG TATATGCCCATGAGAGGTATTGCTGGTTTTTCCTGTAGTACTATGTCCAA ATTTTTGAGGAACTGCCAGACTGATTTCCAGAGTTGTTTTACAAGCTTGC AATTCCACCACCAAGGGAGGAGTGTGCCACTTTCTCCCATCCTCACCAGC ATCTGCTGTGACCTGAATTTTTTATTTTAGCCATTCAAAATGGTATGAGG TGGAATCTCAGGGTTGTTTTGATTTGCATTTACCTGATGATTATGAATGT TGAATTTTTTTTCAGGTGCTTCTCATCCATTTGGTATTCCTCAGTTGATA ATTCTTTATCTCTGTACCCCATTTTTAATAGGGTCATTTGATTTTCTGGA GTCCCTCTTCTTGAATATACCTATATGGATATATATATATATATATATAT ATATATATATATATATATATATATATATATNNATATATANNNNNNNNNNN NNNNNNNNNNNNNANNNNNANNNANNNANNNNNNNANNANAATTTATAAT TTATNAAANNNAAANATATATANNTTTTTTAAANNANAAAAAAAAAAATA TATATTTTAATTTTTTTA	CGATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXTGTATATGCAGGGAATTAAATAACAA TCTCTAATAATTGAGCAGATTAACTCAATATCTACAGTCACAGAACAGTG ATCAGTGTCAACTTCAATAAAACAGACTTGAGCACTCCCTTTTTCATACC TAATTAACAAAGCACATGCTTTATAATAAATATATTTTGAAAATGAATAC TATTTATATCATTTATATACTTGAGATTATAAAATGATTGCATAATTTCC CTCTTTCATTCTCTCCAGGTAAATGCTTATGCACTACCTTTATCGTTTTA ATTTCATGGAGTCTTCTTTCATTAATTGCCCAGGAAGACTTGAACTTGCT AGTCATGCATACACACACATGAAAACATCCACTCACAGGTACAACCACGA AAACTCACAAACACACACACATACATACCTGTATCCTCACACACAAATAA AAAAAATAGAAGCATGCCTTTGAGTGCACACATACACACATACACACACA CACACACACACACACACACACANAATTGTAGGTAACTAATGGATGATGTG AAATAGNTCACGAATGTTTAATAATCTTCCACCGGGAAGATTATATTTTT CCCCTGAAGGATTTATTTAAAAACCTCCACATCCGGGTATTATTTTTAGA AGGGGAAAAAAAAAAAAGTTTATTTGGTGGCCCAACCCCTTCTTAAAAAA AATGTAAAAA
quality values	Open. Hide. 0 3 8 8 8 8 8 8 11 28 37 30 30 25 22 22 30 23 23 22 24 28 28 43 48 31 29 28 28 28 33 47 37 30 22 20 17 16 19 24 28 22 27 18 20 20 30 31 59 59 36 36 36 36 37 37 33 33 33 42 57 57 44 43 36 33 33 36 36 37 42 43 43 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 51 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 48 48 46 46 48 48 50 51 68 51 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 57 57 57 54 48 59 59 59 59 59 59 59 59 57 68 68 68 68 57 59 59 59 59 57 57 57 57 57 57 57 54 47 47 47 47 47 48 57 57 57 43 43 35 35 35 59 59 57 57 57 59 59 59 59 57 43 43 39 39 43 59 39 47 47 59 47 47 41 41 39 41 39 39 39 39 34 37 32 39 31 47 47 59 40 34 28 21 14 24 21 25 19 28 28 30 29 31 35 31 31 39 37 39 41 46 34 34 25 25 25 30 32 43 35 31 26 34 39 36 31 31 20 24 14 12 12 19 25 17 26 22 31 39 39 30 25 25 37 37 36 35 27 24 23 20 20 16 23 15 25 28 24 24 30 24 18 16 16 13 16 13 18 13 11 11 18 23 24 19 12 12 11 11 14 24 59 59 47 50 50 50 50 53 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 50 50 47 47 33 19 17 3 0 0 3 23 23 37 21 21 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 3 0 0 0 3 0 0 0 3 0 0 0 0 0 0 0 3 0 0 3 0 3 8 8 8 12 10 10 11 10 8 8 6 6 3 0 3 8 3 0 0 0 3 6 3 0 3 6 8 13 8 8 3 0 0 3 6 8 6 6 6 6 6 3 0 0 3 0 3 7 7 7 7 7 6 8 8 8 8 8 8 8 8 6 8 8 8 9 10 8 8 8 10 10 10 10 10 11 11	Open. Hide. 8 8 8 10 12 11 9 9 19 12 16 9 9 9 15 27 32 37 39 39 37 37 44 39 39 44 44 39 39 39 39 39 31 39 39 37 30 33 33 33 33 32 39 47 50 53 44 39 47 42 42 47 47 59 59 59 57 57 43 28 24 21 21 29 40 41 57 57 42 41 41 41 41 42 51 68 68 68 68 68 68 68 68 68 57 57 47 47 50 50 68 68 68 68 68 68 68 68 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 50 48 48 48 48 48 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 68 68 68 68 68 68 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 50 53 57 57 50 50 53 50 50 50 53 50 50 50 47 47 47 37 37 32 29 29 34 40 44 47 59 59 50 50 59 59 59 46 46 46 57 57 57 57 57 48 48 48 48 48 48 39 43 32 34 30 34 28 37 29 32 39 35 35 35 39 32 32 34 28 28 26 32 25 30 25 20 20 34 16 11 11 12 12 12 28 31 17 21 13 14 14 31 34 32 23 23 11 11 12 20 21 34 30 19 13 12 12 11 11 15 19 20 32 18 22 13 28 28 44 23 25 12 12 11 22 24 47 59 59 59 57 53 53 50 50 50 50 50 53 53 53 50 50 50 50 50 50 47 47 59 29 29 3 0 3 17 12 10 9 9 9 10 10 8 8 8 8 8 8 6 8 9 10 11 10 10 9 11 9 9 9 10 9 7 7 7 3 0 3 11 11 11 15 12 12 10 10 11 11 11 10 9 8 8 8 8 8 8 8 8 6 6 6 8 8 9 8 8 8 11 8 8 8 6 6 6 8 9 11 14 15 10 10 12 8 8 8 11 8 8 8 8 8 8 6 6 6 6 6 6 12 9 9 7 11 6 7 6 8 8 7 7 7 9 8 8 8 8 8 8 9 10 10 8 9 8 8 8 8 8 8 8 8 14 8 9 9 11 16 21 29 24 19 9 9 8 6 6 8 7 7 7 6 8 8 8 8 8 8 8 8 8 12 12 8 8 8 8 8 8 8 8 6 6 6 6 6 8 9 10 8 6 9 9 9 9 9 10 21 17 13

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no436_b23.g1 MSMg01no436_b23.g1 CHROMAT_FILE:
MSMg01no436_b23.g1 PHD_FILE: MSMg01no436_b23.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:01:07 2005
         (425 letters)



>mm_chr17_18950679_18951503
          Length = 825

 Score =  491 bits (254), Expect = e-143
 Identities = 323/346 (93%), Gaps = 1/346 (0%)
 Strand = Plus / Minus

                                                                       
Query: 2   gtatatgcagggaattaaataacaatctctaataattgagcagattaactcaatatctac 61
           ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||
Sbjct: 345 gtatatgcagggaattaaataacaatcactaataactgagcagattaactcaatatctac 286

                                                                       
Query: 62  agtcacagaacagtgatcagtgtcaacttcaataaaacagacttgagcactccctttttc 121
           |||||||||| ||||||||| ||| |||||  |||||||||||||| |||||||||||||
Sbjct: 285 agtcacagaagagtgatcagagtccacttccctaaaacagacttgatcactccctttttc 226

                                                                       
Query: 122 atacctaattaacaaagcacatgctttataataaatatattttgaaaatgaatactattt 181
           |||||||||| ||||||||||||||| |||| |||||||||||||||||||| |||||||
Sbjct: 225 atacctaattcacaaagcacatgcttcataa-aaatatattttgaaaatgaaaactattt 167

                                                                       
Query: 182 atatcatttatatacttgagattataaaatgattgcataatttccctctttcattctctc 241
            ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||
Sbjct: 166 ttatcatttatatacttgagattataaaatgattgcataatttccccctttcattctttc 107

                                                                       
Query: 242 caggtaaatgcttatgcactacctttatcgttttaatttcatggagtcttctttcattaa 301
           ||||||||| |||||| ||| |||| ||| ||||||||||||||||||||||| ||||||
Sbjct: 106 caggtaaattcttatgtacttccttaatcattttaatttcatggagtcttcttccattaa 47

                                                         
Query: 302 ttgcccaggaagacttgaacttgctagtcatgcatacacacacatg 347
           |||||||||| |||| ||||||||||||||||||||||||||||||
Sbjct: 46  ttgcccaggaggactcgaacttgctagtcatgcatacacacacatg 1


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 425
Length of database: 825
Length adjustment: 9
Effective length of query: 416
Effective length of database: 816
Effective search space:   339456
Effective search space used:   339456
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information