MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-174A04
Chromosome	18 (Build37)	11 (Build37)
Map Location	61,472,292 - 61,472,755	13,510,319 - 13,511,167
singlet/doublet	singlet	singlet
Overlap gene	Ppargc1b
Upstream gene	LOC667578, EG667584, LOC435565, Iigp1, EG629292, LOC667597, 2010002N04Rik, Dctn4, Rbm22, Myoz3, Synpo, LOC100042675, Ndst1, Rps14, LOC667619, Cd74, Tcof1, LOC100042699, Arsi, Camk2a, Slc6a7, Cdx1, Pdgfrb, Csf1r, A630042L21Rik, Slc26a2, Pde6a, EG667279
Downstream gene	LOC667675, 4933429F08Rik, Csnk1a1, Il17b, Pcyox1l, LOC100042730, Grpel2, Afap1l1, LOC100042738, Ablim3, Sh3tc2, Adrb2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC667578 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG667584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667584 MGI:3644347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	LOC435565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iigp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60440 MGI:1926259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629292 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629292 MGI:3643572
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 2 Proteins

name	LOC667597 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010002N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106878 MGI:1917088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dctn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67665 MGI:1914915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66810 MGI:1914060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myoz3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170947 MGI:2179296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Synpo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104027 MGI:1099446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 55 ESTs, 3 Proteins

name	LOC100042675 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ndst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15531 MGI:104719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20044 MGI:98107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667619 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667619
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 5 Proteins pseudo : _no_value

name	Cd74 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16149 MGI:96534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tcof1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21453 MGI:892003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042699 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Arsi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545260 MGI:2670959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12322 MGI:88256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc6a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240332 MGI:2147363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12590 MGI:88360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdgfrb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18596 MGI:97531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf1r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12978 MGI:1339758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	A630042L21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106894 MGI:2441817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13521 MGI:892977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225600 MGI:97524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667279 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667279 MGI:3645604
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1492 ESTs, 4 Proteins

name	Ppargc1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170826 MGI:2444934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667675 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	4933429F08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328967 MGI:3045339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csnk1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93687 MGI:1934950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il17b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56069 MGI:1928397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcyox1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240334 MGI:3606062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Grpel2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17714 MGI:1334416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afap1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106877 MGI:2147199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042738 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042738
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ablim3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319713 MGI:2442582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3tc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225608 MGI:2444417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adrb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11555 MGI:87938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667584 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404496 GeneID:667584 MGI:3644347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins product : predicted gene, EG667584 transcript_id : XM_991343.1

name	LOC435565 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142378650 GeneID:435565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon-inducible GTPase-like transcript_id : NM_001013828.2

name	Iigp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274636 GeneID:60440 MGI:1926259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon inducible GTPase 1 transcript_id : NM_021792.3

name	EG629292 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404498 GeneID:629292 MGI:3643572
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 2 Proteins product : predicted gene, EG629292 transcript_id : XM_894152.2

name	LOC667597 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269599 GeneID:667597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC667597 transcript_id : XM_001471581.1

name	2010002N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125991226 GeneID:106878 MGI:1917088
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010002N04 gene transcript_id : NM_134133.2

name	Dctn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131213 GeneID:67665 MGI:1914915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynactin 4 transcript_id : NM_026302.3

name	Rbm22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802908 GeneID:66810 MGI:1914060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 22 transcript_id : NM_025776.2

name	Myoz3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371096 GeneID:170947 MGI:2179296
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myozenin 3 transcript_id : NM_133363.2

name	Synpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269853 GeneID:104027 MGI:1099446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 55 ESTs, 3 Proteins product : synaptopodin, transcript variant 1 transcript_id : XM_001479956.1

name	Synpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269855 GeneID:104027 MGI:1099446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 54 ESTs, 3 Proteins product : synaptopodin, transcript variant 2 transcript_id : XM_001479958.1

name	LOC100042675 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269785 GeneID:100042675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042675 transcript_id : XM_001478620.1

name	Ndst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227210 GeneID:15531 MGI:104719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 transcript_id : NM_008306.3

name	Rps14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362340 GeneID:20044 MGI:98107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S14 transcript_id : NM_020600.3

name	Cd74 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110624769 GeneID:16149 MGI:96534
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) transcript_id : NM_001042605.1

name	Cd74 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110624778 GeneID:16149 MGI:96534
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) transcript_id : NM_010545.3

name	Tcof1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130121 GeneID:21453 MGI:892003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Treacher Collins Franceschetti syndrome 1, homolog transcript_id : NM_011552.2

name	Arsi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370327 GeneID:545260 MGI:2670959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arylsulfatase i transcript_id : NM_001038499.1

name	Camk2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388229 GeneID:12322 MGI:88256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase II alpha transcript_id : NM_177407.3

name	Camk2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130259 GeneID:12322 MGI:88256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase II alpha transcript_id : NM_009792.2

name	Slc6a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235729 GeneID:240332 MGI:2147363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 transcript_id : NM_201353.1

name	Cdx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559385 GeneID:12590 MGI:88360
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caudal type homeo box 1 transcript_id : NM_009880.2

name	Pdgfrb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679258 GeneID:18596 MGI:97531
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet derived growth factor receptor, beta polypeptide transcript_id : NM_008809.1

name	Csf1r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723422 GeneID:12978 MGI:1339758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 1 receptor transcript_id : NM_001037859.2

name	A630042L21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527365 GeneID:106894 MGI:2441817
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630042L21 gene transcript_id : NM_134134.1

name	Slc26a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672924 GeneID:13521 MGI:892977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26 (sulfate transporter), member 2 transcript_id : NM_007885.2

name	Pde6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560752 GeneID:225600 MGI:97524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 6A, cGMP-specific, rod, alpha transcript_id : NM_146086.2

name	EG667279 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269857 GeneID:667279 MGI:3645604
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 987 ESTs, 3 Proteins product : predicted gene, EG667279, transcript variant 1 transcript_id : XM_001002026.2

name	Ppargc1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131021 GeneID:170826 MGI:2444934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferative activated receptor, gamma, coactivator 1 beta transcript_id : NM_133249.2

name	4933429F08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387990 GeneID:328967 MGI:3045339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933429F08 gene transcript_id : NM_177828.3

name	Csnk1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130247 GeneID:93687 MGI:1934950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 1, alpha 1 transcript_id : NM_146087.2

name	Il17b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9507246 GeneID:56069 MGI:1928397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 17B transcript_id : NM_019508.1

name	Pcyox1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343997 GeneID:240334 MGI:3606062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prenylcysteine oxidase 1 like transcript_id : NM_172832.2

name	LOC100042730 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269790 GeneID:100042730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042730 transcript_id : XM_001478705.1

name	Grpel2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87196330 GeneID:17714 MGI:1334416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GrpE-like 2, mitochondrial transcript_id : NM_021296.2

name	Afap1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130646 GeneID:106877 MGI:2147199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin filament associated protein 1-like 1 transcript_id : NM_178928.4

name	Ablim3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62990179 GeneID:319713 MGI:2442582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin binding LIM protein family, member 3 transcript_id : NM_198649.2

name	Sh3tc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817512 GeneID:225608 MGI:2444417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 domain and tetratricopeptide repeats 2 transcript_id : NM_172628.2

name	Adrb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328091 GeneID:11555 MGI:87938
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, beta 2 transcript_id : NM_007420.2

name	EG667584 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94404497 GeneID:667584 MGI:3644347
definition	codon_start : 1 product : similar to CDNA sequence BC023105 protein_id : XP_996437.1

name	LOC435565 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:62000686 GeneID:435565
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC435565 protein_id : NP_001013850.1

name	Iigp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49274637 CCDS:CCDS29270.1 GeneID:60440 MGI:1926259
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019003 - GDP binding [Evidence IDA]; GO:0005525 - GTP binding [Evidence IDA]; GO:0003924 - GTPase activity [Evidence IDA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence TAS] codon_start : 1 exception : mismatches in translation product : interferon-inducible GTPase protein_id : NP_068564.3

name	EG629292 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82996437 GeneID:629292 MGI:3643572
definition	codon_start : 1 product : similar to RIKEN cDNA 2610318N02 gene protein_id : XP_899245.1

name	LOC667597 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269600 GeneID:667597
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471631.1

name	2010002N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527364 GeneID:106878 MGI:1917088
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : putative small membrane protein NID67 protein_id : NP_598894.1

name	Dctn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385798 GeneID:67665 MGI:1914915
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] codon_start : 1 product : dynactin 4 protein_id : NP_080578.1

name	Rbm22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625591 CCDS:CCDS29272.1 GeneID:66810 MGI:1914060
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 22 protein_id : NP_080052.1

name	Myoz3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111172 CCDS:CCDS29273.1 GeneID:170947 MGI:2179296
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : calsarcin-3 product : myozenin 3 protein_id : NP_579941.1

name	Synpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269854 GeneID:104027 MGI:1099446
definition	codon_start : 1 product : synaptopodin isoform 1 protein_id : XP_001480006.1

name	Synpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269856 GeneID:104027 MGI:1099446
definition	codon_start : 1 product : synaptopodin isoform 2 protein_id : XP_001480008.1

name	LOC100042675 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269786 GeneID:100042675
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478670.1

name	Ndst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734444 GeneID:15531 MGI:104719
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0015016 - [heparan sulfate]-glucosamine N-sulfotransferase activity [Evidence TAS] GO_process : GO:0009790 - embryonic development [Evidence IGI]; GO:0048702 - embryonic neurocranium morphogenesis [Evidence IMP]; GO:0048703 - embryonic viscerocranium morphogenesis [Evidence IMP]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IMP]; GO:0030900 - forebrain development [Evidence IGI] [Evidence IMP]; GO:0030203 - glycosaminoglycan metabolism [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0000165 - MAPKKK cascade [Evidence IMP]; GO:0030901 - midbrain development [Evidence IGI]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0000271 - polysaccharide biosynthesis [Evidence IMP]; GO:0006476 - protein amino acid deacetylation [Evidence TAS]; GO:0006477 - protein amino acid sulfation [Evidence TAS] [Evidence IMP]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0007224 - smoothened signaling pathway [Evidence IGI] codon_start : 1 note : heparan sulfate-N-deacetylase/N-sulfotransferase; N-deacetylase/N-sulfotransferase-1; glucosaminyl N-deacetylase/N-sulfotransferase 1 product : N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 protein_id : NP_032332.2

name	Rps14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981100 CCDS:CCDS29274.1 GeneID:20044 MGI:98107
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005843 - cytosolic small ribosomal subunit (sensu Eukaryota) [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0030490 - processing of 20S pre-rRNA [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence ISS]; GO:0000028 - ribosomal small subunit assembly and maintenance [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein S14 protein_id : NP_065625.2

name	Cd74 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110624770 GeneID:16149 MGI:96534
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005771 - multivesicular body [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IMP] [Evidence IDA] GO_function : GO:0019955 - cytokine binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019882 - antigen processing and presentation [Evidence IMP] [Evidence IDA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IDA] [Evidence IMP]; GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0006886 - intracellular protein transport [Evidence IDA] [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0045581 - negative regulation of T cell differentiation [Evidence IMP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0045582 - positive regulation of T cell differentiation [Evidence IMP]; GO:0045059 - positive thymic T cell selection [Evidence IMP]; GO:0001516 - prostaglandin biosynthesis [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0043030 - regulation of macrophage activation [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Ia-associated invariant chain; dinucleotide microsatellite; MHC class II-associated invariant chain; class II-associated invariant chain peptide; HLA-DR-GAMMA; histocompatibility: class II antigens, gamma chain of; invariant polypeptide of major histocompatibility complex, class II antigen-associated product : CD74 antigen isoform 1 protein_id : NP_001036070.1

name	Cd74 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789020 GeneID:16149 MGI:96534
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005771 - multivesicular body [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IMP] [Evidence IDA] GO_function : GO:0019955 - cytokine binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019882 - antigen processing and presentation [Evidence IMP] [Evidence IDA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IDA] [Evidence IMP]; GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0006886 - intracellular protein transport [Evidence IDA] [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0045581 - negative regulation of T cell differentiation [Evidence IMP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0045582 - positive regulation of T cell differentiation [Evidence IMP]; GO:0045059 - positive thymic T cell selection [Evidence IMP]; GO:0001516 - prostaglandin biosynthesis [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0043030 - regulation of macrophage activation [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Ia-associated invariant chain; dinucleotide microsatellite; MHC class II-associated invariant chain; class II-associated invariant chain peptide; HLA-DR-GAMMA; histocompatibility: class II antigens, gamma chain of; invariant polypeptide of major histocompatibility complex, class II antigen-associated product : CD74 antigen isoform 2 protein_id : NP_034675.1

name	Tcof1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755742 GeneID:21453 MGI:892003
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0042790 - transcription of nuclear rRNA large RNA polymerase I transcript [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : treacle protein_id : NP_035682.1

name	Arsi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370328 CCDS:CCDS29275.1 GeneID:545260 MGI:2670959
definition	GO_function : GO:0008484 - sulfuric ester hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : arylsulfatase I protein_id : NP_001033588.1

name	Camk2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916677 CCDS:CCDS29276.1 GeneID:12322 MGI:88256
definition	GO_component : GO:0005954 - calcium- and calmodulin-dependent protein kinase complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0046928 - regulation of neurotransmitter secretion [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; CaMK II; alpha-CaMKII product : calcium/calmodulin-dependent protein kinase II alpha isoform 2 protein_id : NP_803126.1

name	Camk2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753250 CCDS:CCDS29277.1 GeneID:12322 MGI:88256
definition	GO_component : GO:0005954 - calcium- and calmodulin-dependent protein kinase complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0046928 - regulation of neurotransmitter secretion [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; CaMK II; alpha-CaMKII product : calcium/calmodulin-dependent protein kinase II alpha isoform 1 protein_id : NP_033922.1

name	Slc6a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235730 CCDS:CCDS29278.1 GeneID:240332 MGI:2147363
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 protein_id : NP_958741.1

name	Cdx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559386 CCDS:CCDS29279.1 GeneID:12590 MGI:88360
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007389 - pattern specification [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : caudal type homeobox transcription factor 1 protein_id : NP_034010.2

name	Pdgfrb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679259 GeneID:18596 MGI:97531
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IMP]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0050730 - regulation of peptidyl-tyrosine phosphorylation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IDA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PDGF beta chain; platelet-derived growth factor receptor beta variant 1 product : platelet derived growth factor receptor, beta polypeptide protein_id : NP_032835.1

name	Csf1r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723423 CCDS:CCDS29280.1 GeneID:12978 MGI:1339758
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 product : colony stimulating factor 1 receptor protein_id : NP_001032948.2

name	A630042L21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527366 GeneID:106894 MGI:2441817
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC106894 protein_id : NP_598895.1

name	Slc26a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681233 CCDS:CCDS29282.1 GeneID:13521 MGI:892977
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008271 - sulfate porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008272 - sulfate transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : diastrophic dysplasia product : solute carrier family 26 (sulfate transporter), member 2 protein_id : NP_031911.1

name	Pde6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122583 CCDS:CCDS29283.1 GeneID:225600 MGI:97524
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047555 - 3',5'-cyclic-GMP phosphodiesterase activity [Evidence IEA]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : cGMP phosphodiesterase alpha product : phosphodiesterase 6A, cGMP-specific, rod, alpha protein_id : NP_666198.1

name	EG667279 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94404463 GeneID:667279 MGI:3645604
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001002026.1

name	Ppargc1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875426 CCDS:CCDS29284.1 GeneID:170826 MGI:2444934
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0050682 - AF-2 domain binding [Evidence ISS]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : PPAR gamma coactivator-1beta protein; PGC-1beta/ERRL1 product : peroxisome proliferator-activated receptor gamma coactivator 1 beta protein_id : NP_573512.1

name	4933429F08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244390 GeneID:328967 MGI:3045339
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC328967 protein_id : NP_808496.1

name	Csnk1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165382 GeneID:93687 MGI:1934950
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : casein kinase I-alpha product : casein kinase 1, alpha 1 protein_id : NP_666199.1

name	Il17b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507247 CCDS:CCDS29286.1 GeneID:56069 MGI:1928397
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0006954 - inflammatory response [Evidence IEA]; GO:0030593 - neutrophil chemotaxis [Evidence ISS] codon_start : 1 note : gene for cytokine-like protein product : interleukin 17b protein_id : NP_062381.1

name	Pcyox1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370248 CCDS:CCDS29287.1 GeneID:240334 MGI:3606062
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : prenylcysteine oxidase 1 like protein_id : NP_766420.1

name	LOC100042730 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269791 GeneID:100042730
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478755.1

name	Grpel2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789124 CCDS:CCDS29288.1 GeneID:17714 MGI:1334416
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0000774 - adenyl-nucleotide exchange factor activity [Evidence IEA]; GO:0051087 - chaperone binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : GrpE-like 2, mitochondrial protein_id : NP_067271.1

name	Afap1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982370 GeneID:106877 MGI:2147199
definition	codon_start : 1 product : actin filament associated protein 1-like 1 protein_id : NP_849259.2

name	Ablim3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62990180 GeneID:319713 MGI:2442582
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : actin binding LIM protein family, member 3 protein_id : NP_941051.2

name	Sh3tc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817513 GeneID:225608 MGI:2444417
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : SH3 domain and tetratricopeptide repeats 2 protein_id : NP_766216.2

name	Adrb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328092 CCDS:CCDS29289.1 GeneID:11555 MGI:87938
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0043235 - receptor complex [Evidence ISS] GO_function : GO:0004941 - beta2-adrenergic receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0051380 - norepinephrine binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence ISS]; GO:0002032 - arrestin mediated desensitization of G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0045453 - bone resorption [Evidence IMP]; GO:0050873 - brown fat cell differentiation [Evidence IGI]; GO:0002024 - diet induced thermogenesis [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP] [Evidence IDA]; GO:0031649 - heat generation [Evidence IGI]; GO:0040015 - negative regulation of body size [Evidence IGI]; GO:0045986 - negative regulation of smooth muscle contraction [Evidence IGI]; GO:0001993 - norepinephrine-epinephrine regulation of blood pressure [Evidence IMP]; GO:0002025 - norepinephrine-epinephrine vasodilation during regulation of blood pressure [Evidence IMP] [Evidence IGI]; GO:0030501 - positive regulation of bone mineralization [Evidence IMP]; GO:0043410 - positive regulation of MAPKKK cascade [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0002028 - regulation of sodium ion transport [Evidence IMP]; GO:0009409 - response to cold [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : beta 2-AR; beta 2-adrenoceptor; beta-2 adrenergic receptor product : adrenergic receptor, beta 2 protein_id : NP_031446.2

name	LOC667578 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667578
definition	number : 1 pseudo : _no_value

name	LOC667578 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667578
definition	number : 2 pseudo : _no_value

name	LOC100042699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042699
definition	number : 1 pseudo : _no_value

name	LOC100042699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042699
definition	number : 2 pseudo : _no_value

name	LOC100042699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042699
definition	number : 3 pseudo : _no_value

name	LOC100042699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042699
definition	number : 4 pseudo : _no_value

name	LOC100042699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042699
definition	number : 5 pseudo : _no_value

name	LOC667675 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667675
definition	number : 1 pseudo : _no_value

name	LOC100042738 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042738
definition	number : 2 pseudo : _no_value

name	LOC100042738 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042738
definition	number : 1 pseudo : _no_value

name	LOC667619 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149269787 GeneID:667619
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 5 Proteins product : similar to Rps16 protein pseudo : _no_value transcript_id : XR_033806.1

clone name	MSMg01-419B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-278D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354O13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-125M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475P03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062B18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-504K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121L20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-174A04.b	B6Ng01-174A04.g
ACC	GA002204	GA002205
length	220	849
definition	B6Ng01-174A04.b	B6Ng01-174A04.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(61,472,292 - 61,472,755)	(13,510,319 - 13,511,167)
sequence	catagggaaaaacacactaactacttgcctattatcaaataggcagcctg aaaaacataataaaagtaaaattgaacagactaagcaggttttgtttaag aatatatatacatatacatatatatatatatatatatatatatatatgtg tgtgtgtgtgtgtgtgtgacacaacccgcgctgtgtgtgctctttttctt tatttttgtgtttgggggtg	gaattcaatagatgttgacatataaagtgccacgagaagaggaatggtag aaattgttattgcataaaagaaacaagagaactaagtggtggtttgaata tgcttcacctattggaagtggcacaattagggagtgtggccttgttggaa taggtgtggtcttgttggaggaagtgtgtcactgtgtaagtgagggctcc tggtgctcaaactctgcacagcatagaagatgatctcctttggctgcctt cagatcacaatacagaactcttagcatcttctccagcatgatgtctgcct gcagcctgccatgtttctactatgatggtaatgaactgaacttctaaaag ttaagagagcctcacttaaatgtggaggttctagatcctttataaaaact gccttgatcgtggtgtctctttatatttataaaaccctaggacagtgatc tacagaagcttgctggacagataaaggatttaaaataaaagagaatcatt tttacaaataatatatcaaaattctacaacttatcctctttttctagaga aggatgtagttgctagagtcatcaaaacatgcacaggaagaaagctatca ttgcagctcagaatcctatttgcttttgaaatataaaaccatgtaaggct tgcacttgctgtccattgatttgacaggtcatagcatcgtgtaaatgtat atggcttgtttctgctttaggcaagagctactaaggttttgagagaatac acccagttgttattttctgaatcactgaaatggttctcatcctccttgtt ctccggtgtctttctggagggcagtcctagctttcttccttctgctgtg
quality values	Open. Hide. 43 12 62 59 62 62 62 62 62 62 62 59 59 49 62 49 62 62 62 62 62 62 59 62 62 62 62 34 30 18 25 23 21 23 26 23 31 32 28 28 31 34 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 51 46 46 31 27 35 48 48 50 32 28 32 40 36 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 54 62 62 54 62 59 62 56 62 56 59 50 56 40 31 13 27 16 10 5 10 10 10 13 10 23 16 15 46 8 29 12 7 34 19 34 18 48 24 35 18 13 10 23 12 18 12 13 16 23 13 18 10 18 23 23 18 13 23 23 14 30 18 13 11 8 25 13 18 18 23	Open. Hide. 62 47 56 45 62 44 24 47 62 54 62 59 59 43 34 34 22 24 39 30 43 34 28 28 34 31 46 50 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 51 36 40 46 34 35 45 23 50 43 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 51 59 56 56 34 45 45 46 38 56 56 62 62 62 62 62 62 56 62 49 56 62 62 56 62 47 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 43 56 56 42 54 56 51 62 62 62 62 49 47 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 47 62 62 62 62 62 62 62 62 62 62 28 62 48 52 52 52 52 52 62 62 62 54 54 52 62 52 62 62 62 52 54 54 42 52 52 62 45 52 54 43 41 54 52 58 58 58 58 52 54 54 49 43 52 52 54 54 24 58 45 42 47 46 34 35 46 58 45 53 52 42 39 54 54 52 52 53 41 45 37 46 52 52 45 42 52 58 54 42 49 42 48 54 58 54 42 54 58 58 42 35 42 39 58 53 36 58 54 50 49 35 50 58 58 50 37 39 58 49 46 53 54 52 41 34 58 58 51 46 58 53 51 51 46 50 26 40 35 46 41 41 46 35 39 37 41 33 51 58 47 29 31 31 58 18 47 30 58 45 52 49 43 50 51 50 51 51 38 41 28 13 50 45 53 35 28 52 39 42 50 42 34 52 26 18 39 31 50 28 30 50 39 50 53 50 50 49 35 32 53 50 46 39 30 42 52 39 42 54 38 18 31 37 51 53 32 33 32 33 49 18 13 36 19 32 18 31 18 33 41 28 49 22 34 33 34 53 37 30 40 14 32 17 51 54 13 26 45 34 52 31 29 44 32 45 43 32 34 48 37 37 37 32 29 20 18 8 32 20 54 54 32 47 32 32 31 11 11 32 31 26 14 32 35 53 52 21 41 33 23 42 36 41 24 21 52 26 25 26 28 14 19 29 46 38 12 18 33 34 10 13 33 13 30 6 22 28 28 31 31 14 17 35 31 28 37 12 9 23 11 22 27 21 21 37 10 32 30 22 24 30 12 19 26 29 23 46 30 25 31 8 7 16 12 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr18_61472292_61472755
seq2: B6Ng01-174A04.b_196_270

seq1  ATGTGTGTGTGTGTGTGTGTGTGTGTGGTGTGTGTGTGTGTGTGTGAAAT  50
                                                        
seq2  --------------------------------------------------  0

seq1  TCTAAAAGGTAGACAATTAAAAGCAAGTCTCCTGGCCAGGCGTTGGTGGT  100
                                                        
seq2  --------------------------------------------------  0

seq1  GCACGCCTTTAATCCCAGCACTCAAGAGGCAAAGGTAGGTGGATCTCTGT  150
                                                        
seq2  --------------------------------------------------  0

seq1  GAGTTCAAGGCCAGTCTGGTCTTCAGGGCAGGACAGCCAGGGCTATGACA  200
                                                        
seq2  --------------------------------------------------  0

seq1  CAGGGAAATCCTGTCTAGAAAAAAACCAAATGCAAAAGCAAAAGCAAGTC  250
                                                        
seq2  --------------------------------------------------  0

seq1  CCCTTCCTCCTCAAGGTCCTTTCTCCTTCCCAGATGCAACTGCCACTATT  300
                                                        
seq2  --------------------------------------------------  0

seq1  TTCCTATAAACCTTCAGGAGGTGGACTTTAATCATAATATATAATCATAC  350
                                                        
seq2  --------------------------------------------------  0

seq1  AAGAATATATCCAAG---GTATATGCTACCTTCAACCCACTCAGCTGTTT  397
          || | |    |   || | ||  ||   |||||| |   ||||| |
seq2  ----ATGTGTGTGTGTGTGTGTGTGTGAC--ACAACCCGC---GCTGTGT  41

seq1  GCATACAAGTAAAAGAATGCTAACCTTTAGTTTGTTTTTTCTTCAACTAT  447
      |                ||||              ||||||||    |||
seq2  G----------------TGCT-------------CTTTTTCTT----TAT  58

seq1  TTTTGTGTTTGGGGGTG  464
      |||||||||||||||||
seq2  TTTTGTGTTTGGGGGTG  75

seq1: chr11_13510319_13511167
seq2: B6Ng01-174A04.g_67_915 (reverse)

seq1  CACAGCAGAAGGAAGAAAGCTAGGAACTGCCCTCCAGAAAGACACCGGAG  50
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  CACAGCAGAAGGAAGAAAGCTAGG-ACTGCCCTCCAGAAAGACACCGGAG  49

seq1  AACAAGGAGGATGAGAACCATTTCAGTGATTCAGAAAATAACAACTGGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAGGAGGATGAGAACCATTTCAGTGATTCAGAAAATAACAACTGGGT  99

seq1  GTATTCTCTCAAAACCTTAGTAGCTCTTGCCT-AAGCAGAAACAAGCCAT  149
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  GTATTCTCTCAAAACCTTAGTAGCTCTTGCCTAAAGCAGAAACAAGCCAT  149

seq1  ATACATTTACACGATGCTATGACCTGTCAAATCAATGGACAGCAAGTGCA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACATTTACACGATGCTATGACCTGTCAAATCAATGGACAGCAAGTGCA  199

seq1  AGCCTTACATGGTTTTATATTTCAAAAGCAAATAGGATTCTGAGCTGCAA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTTACATGGTTTTATATTTCAAAAGCAAATAGGATTCTGAGCTGCAA  249

seq1  TGATAGCTTTCTTCCTGTGCATGTTTTGATGACTCTAGCAACTACATCCT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATAGCTTTCTTCCTGTGCATGTTTTGATGACTCTAGCAACTACATCCT  299

seq1  TCTCTAGAAAAAGAGGATAAGTTGTAGAATTTTGATATATTATTTGTAAA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTAGAAAAAGAGGATAAGTTGTAGAATTTTGATATATTATTTGTAAA  349

seq1  AATGATTCTCTTTTATTTTAAATCCTTTATCTGTCCAGCAAGCTTCTGTA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGATTCTCTTTTATTTTAAATCCTTTATCTGTCCAGCAAGCTTCTGTA  399

seq1  GATCACTGTCCTAGGGTTTTATAAATATAAAGAGACACCACGATCAAGGC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCACTGTCCTAGGGTTTTATAAATATAAAGAGACACCACGATCAAGGC  449

seq1  AGTTTTTATAAAGGATCTAGAACCTCCACATTTAAGTGAGGCTCTCTTAA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTTTATAAAGGATCTAGAACCTCCACATTTAAGTGAGGCTCTCTTAA  499

seq1  CTTTTAGAAGTTCAGTTCATTACCATCATAGTAGAAACATGGCAGGCTGC  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTAGAAGTTCAGTTCATTACCATCATAGTAGAAACATGGCAGGCTGC  549

seq1  AGGCAGACATCATGCTGGAGAAGATGCTAAGAGTTCTGTATTGTGATCTG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGACATCATGCTGGAGAAGATGCTAAGAGTTCTGTATTGTGATCTG  599

seq1  AAGGCAGCCAAAGGAGATCATCTTCTATGCTGTGCAGAGTTTGAGCACCA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCAGCCAAAGGAGATCATCTTCTATGCTGTGCAGAGTTTGAGCACCA  649

seq1  GGAGCCCTCACTTACACAGTGACACACTTCCTCCAACAAGACCACACCTA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCCCTCACTTACACAGTGACACACTTCCTCCAACAAGACCACACCTA  699

seq1  TTCCAACAAGGCCACACTCCCTAATTGTGCCACTTCCAATAGGTGAAGCA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAACAAGGCCACACTCCCTAATTGTGCCACTTCCAATAGGTGAAGCA  749

seq1  TATTCAAACCACCACTTAGTTCTCTTGTTTCTTTTATGCAATAACAATTT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCAAACCACCACTTAGTTCTCTTGTTTCTTTTATGCAATAACAATTT  799

seq1  CTACCATTCCTCTTCTCGTGGCACTTTATATGTCAACATCTATTGAATTC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCATTCCTCTTCTCGTGGCACTTTATATGTCAACATCTATTGAATTC  849

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information