MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-178L02
Chromosome	18 (Build37)
Map Location	38,219,754 - 38,349,938
singlet/doublet	doublet
Overlap gene	none
Upstream gene	Pcdha1, Pcdha@, Pcdha2, Pcdha3, Pcdha4, Pcdha5, Pcdha6, Pcdha7, Pcdha8, Pcdha9, Pcdha10, Pcdha11, Pcdha12, Pcdhac1, Pcdhac2, Pcdhb1, Pcdhb2, Pcdhb3, Pcdhb4, Pcdhb5, Pcdhb6, Pcdhb7, Pcdhb8, Pcdhb9, Pcdhb10, Pcdhb11, Pcdhb12, Pcdhb13, Pcdhb14, Pcdhb15, Pcdhb16, Pcdhb17, Pcdhb18, Pcdhb19, Pcdhb20, Pcdhb21, Pcdhb22, Slc25a2, Taf7, EG666693, Pcdhg@, Pcdhga1, Pcdhga2, Pcdhga3, Pcdhgb1, Pcdhga4, Pcdhgb2, Pcdhga5, Pcdhga6, Pcdhga7, Pcdhgb4, Pcdhga8, Pcdhgb5, Pcdhga9, Pcdhgb6, Pcdhga10, Pcdhgb7, Pcdhga11, Pcdhgb8, Pcdhga12, Pcdhgc3, Pcdhgc4, Pcdhgc5, Diap1, Hdac3, 4631403P03Rik, Fchsd1, Centd3
Downstream gene	Pcdh1, LOC100042583, 1700086O06Rik, 0610009O20Rik, Pcdh12, Rnf14, Gnpda1, LOC240219, LOC100041839, Ndfip1, Spry4, 9630014M24Rik, LOC100041865, LOC100041875, LOC100042671, LOC666809, LOC100041894, Fgf1, EG545253, Arhgap26
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pcdha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116731 MGI:2150982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha@ (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 14 mRNAs

name	Pcdha2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353234 MGI:2681880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192163 MGI:2447313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12936 MGI:1298406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12941 MGI:1298371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12937 MGI:1298367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12939 MGI:1298369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353235 MGI:2681879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192161 MGI:2447322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12943 MGI:1298408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12942 MGI:1298372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192164 MGI:1298370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353236 MGI:1891442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353237 MGI:1891443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93872 MGI:2136730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93873 MGI:2136735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93874 MGI:2136737
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93875 MGI:2136738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93876 MGI:2136739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93877 MGI:2136740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93878 MGI:2136741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93879 MGI:2136742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93880 MGI:2136744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93881 MGI:2136745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93882 MGI:2136746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93883 MGI:2136747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93884 MGI:2136748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93885 MGI:2136749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93886 MGI:2136750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93887 MGI:2136752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93888 MGI:2136754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93889 MGI:2136756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93890 MGI:2136757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93891 MGI:2136758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93892 MGI:2136759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93893 MGI:2136760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83885 MGI:2137907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 9 Proteins

name	Taf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24074 MGI:1346348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG666693 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666693 MGI:3647216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	Pcdhg@ (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 22 mRNAs

name	Pcdhga1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93709 MGI:1935212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93710 MGI:1935214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93711 MGI:1935215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93699 MGI:1935169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93712 MGI:1935216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93700 MGI:1935170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93713 MGI:1935217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93714 MGI:1935218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93715 MGI:1935219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93701 MGI:1935173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93716 MGI:1935221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93702 MGI:1935196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93717 MGI:1935226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93703 MGI:1935197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93722 MGI:1935227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93704 MGI:1935199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93723 MGI:1935228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93705 MGI:1935200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93724 MGI:1935229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93706 MGI:1935201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93707 MGI:1935203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93708 MGI:1935205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Diap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13367 MGI:1194490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15183 MGI:1343091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4631403P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225392 MGI:1918044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fchsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319262 MGI:2441771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106952 MGI:2147274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75599 MGI:104692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042583 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 914 ESTs, 9 Proteins

name	1700086O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73516 MGI:1920766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	0610009O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66839 MGI:1914089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdh12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53601 MGI:1855700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56736 MGI:1929668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnpda1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26384 MGI:1347054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC240219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:240219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins

name	LOC100041839 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ndfip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65113 MGI:1929601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spry4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24066 MGI:1345144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630014M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381155 MGI:3588234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100041865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041875 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 84 ESTs

name	LOC100042671 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC666809 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100041894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Fgf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14164 MGI:95515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545253 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545253 MGI:3646292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71302 MGI:1918552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:16905102 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_054072.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092276 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_198117.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426880 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138662.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:133892408 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_007766.2

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:20137001 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009959.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142352474 GeneID:192162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_007767.2

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:23956045 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009957.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092278 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_201243.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426884 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138661.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426848 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009961.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:23956047 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009960.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31077090 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138663.2

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092280 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_001003671.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092282 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_001003672.1

name	Pcdhb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716424 GeneID:93872 MGI:2136730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 1 transcript_id : NM_053126.1

name	Pcdhb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866012 GeneID:93873 MGI:2136735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 2 transcript_id : NM_053127.2

name	Pcdhb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866016 GeneID:93874 MGI:2136737
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 3 transcript_id : NM_053128.2

name	Pcdhb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866008 GeneID:93875 MGI:2136738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 4 transcript_id : NM_053129.3

name	Pcdhb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866013 GeneID:93876 MGI:2136739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 5 transcript_id : NM_053130.3

name	Pcdhb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18087780 GeneID:93877 MGI:2136740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 6 transcript_id : NM_053131.1

name	Pcdhb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189406 GeneID:93878 MGI:2136741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 7 transcript_id : NM_053132.2

name	Pcdhb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716432 GeneID:93879 MGI:2136742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 8 transcript_id : NM_053133.1

name	Pcdhb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866010 GeneID:93880 MGI:2136744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 9 transcript_id : NM_053134.3

name	Pcdhb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866005 GeneID:93881 MGI:2136745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 10 transcript_id : NM_053135.2

name	Pcdhb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189402 GeneID:93882 MGI:2136746
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 11 transcript_id : NM_053136.2

name	Pcdhb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18087786 GeneID:93883 MGI:2136747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 12 transcript_id : NM_053137.1

name	Pcdhb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18087788 GeneID:93884 MGI:2136748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 13 transcript_id : NM_053138.1

name	Pcdhb14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189404 GeneID:93885 MGI:2136749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 14 transcript_id : NM_053139.2

name	Pcdhb15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189399 GeneID:93886 MGI:2136750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 15 transcript_id : NM_053140.2

name	Pcdhb16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189410 GeneID:93887 MGI:2136752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 16 transcript_id : NM_053141.2

name	Pcdhb17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32308224 GeneID:93888 MGI:2136754
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 17 transcript_id : NM_053142.2

name	Pcdhb18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872171 GeneID:93889 MGI:2136756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 18 transcript_id : NM_053143.2

name	Pcdhb19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89363033 GeneID:93890 MGI:2136757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 19 transcript_id : NM_053144.2

name	Pcdhb20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89994746 GeneID:93891 MGI:2136758
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 20 transcript_id : NM_053145.2

name	Pcdhb21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872174 GeneID:93892 MGI:2136759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 21 transcript_id : NM_053146.2

name	Pcdhb22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189395 GeneID:93893 MGI:2136760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 22 transcript_id : NM_053147.2

name	Slc25a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269721 GeneID:83885 MGI:2137907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 9 Proteins product : solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 2 transcript_id : XM_111757.7

name	Taf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348602 GeneID:24074 MGI:1346348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_175770.3

name	Taf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755711 GeneID:24074 MGI:1346348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_011901.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087752 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033584.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087754 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033585.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40254132 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033586.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:34328336 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033574.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31982597 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033587.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142380298 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033575.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142378127 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033588.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087762 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033589.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130765 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033590.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087736 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033576.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130786 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033591.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087738 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033577.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130792 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033592.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130767 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033578.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31982599 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033593.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087742 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033579.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40538828 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033594.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087744 GeneID:192682
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033580.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130793 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033595.4

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130764 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033581.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40789290 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033582.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130787 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033583.3

name	Diap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131108 GeneID:13367 MGI:1194490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diaphanous homolog 1 (Drosophila) transcript_id : NM_007858.2

name	Hdac3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89257351 GeneID:15183 MGI:1343091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 3 transcript_id : NM_010411.2

name	4631403P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418898 GeneID:225392 MGI:1918044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4631403P03 gene transcript_id : NM_153793.1

name	Fchsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130311 GeneID:319262 MGI:2441771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FCH and double SH3 domains 1 transcript_id : NM_175684.4

name	Centd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27885014 GeneID:106952 MGI:2147274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 3 transcript_id : NM_139206.1

name	Pcdh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130604 GeneID:75599 MGI:104692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin 1 transcript_id : NM_029357.3

name	LOC100042583 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269776 GeneID:100042583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 914 ESTs, 9 Proteins product : similar to Rpl17 protein transcript_id : XM_001478844.1

name	1700086O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269778 GeneID:73516 MGI:1920766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 1700086O06 gene transcript_id : XM_001478852.1

name	0610009O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383028 GeneID:66839 MGI:1914089
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610009O20 gene transcript_id : NM_024179.4

name	Pcdh12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444907 GeneID:53601 MGI:1855700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin 12 transcript_id : NM_017378.2

name	Rnf14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910591 GeneID:56736 MGI:1929668
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 14 transcript_id : NM_020012.1

name	Gnpda1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754029 GeneID:26384 MGI:1347054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosamine-6-phosphate deaminase 1 transcript_id : NM_011937.1

name	LOC240219 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269781 GeneID:240219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins product : similar to glutamine synthetase transcript_id : XM_001478918.1

name	Ndfip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89001090 GeneID:65113 MGI:1929601
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Nedd4 family interacting protein 1 transcript_id : NM_022996.1

name	Spry4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543766 GeneID:24066 MGI:1345144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sprouty homolog 4 (Drosophila) transcript_id : NM_011898.2

name	LOC100041875 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269725 GeneID:100041875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 84 ESTs product : hypothetical protein LOC100041875 transcript_id : XM_001477150.1

name	LOC100041894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269731 GeneID:100041894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical protein LOC100041894 transcript_id : XM_001477178.1

name	Fgf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937366 GeneID:14164 MGI:95515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 1 transcript_id : NM_010197.3

name	EG545253 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702102 GeneID:545253 MGI:3646292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545253 transcript_id : NM_001033789.1

name	Arhgap26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87159825 GeneID:71302 MGI:1918552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 26 transcript_id : NM_175164.4

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:16905103 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 1 protein_id : NP_473413.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092277 GeneID:192162
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin alpha 2 protein_id : NP_932785.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426881 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 3 protein_id : NP_619603.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:6681021 GeneID:192162
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 1 product : protocadherin alpha 4 protein_id : NP_031792.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:20137002 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 6 product : protocadherin alpha 5 protein_id : NP_034089.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:6681023 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cadherin-related neuronal receptor 2 product : protocadherin alpha 6 protein_id : NP_031793.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:23956046 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 4 product : protocadherin alpha 7 protein_id : NP_034087.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092279 GeneID:192162
definition	GO_component : GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin alpha 8 protein_id : NP_957695.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426885 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 9 protein_id : NP_619602.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426849 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 3; protocadherin alpha 14 product : protocadherin alpha 10 protein_id : NP_034091.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:23956048 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 7 product : protocadherin alpha 11 protein_id : NP_034090.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426883 CCDS:CCDS29166.1 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 5; protocadherin alpha 13 product : protocadherin alpha 12 protein_id : NP_619604.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092281 CCDS:CCDS29167.1 GeneID:192162
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : protocadherin alpha C1 product : protocadherin alpha subfamily C, 1 protein_id : NP_001003671.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092283 CCDS:CCDS29168.1 GeneID:192162
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : protocadherin alpha C2 product : protocadherin alpha subfamily C, 2 protein_id : NP_001003672.1

name	Pcdhb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716425 CCDS:CCDS29169.1 GeneID:93872 MGI:2136730
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 1 protein_id : NP_444356.1

name	Pcdhb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716427 CCDS:CCDS29170.1 GeneID:93873 MGI:2136735
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 2 protein_id : NP_444357.1

name	Pcdhb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866017 CCDS:CCDS29171.1 GeneID:93874 MGI:2136737
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 3 protein_id : NP_444358.2

name	Pcdhb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866009 CCDS:CCDS29172.1 GeneID:93875 MGI:2136738
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 4 protein_id : NP_444359.3

name	Pcdhb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716429 CCDS:CCDS29173.1 GeneID:93876 MGI:2136739
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : Protocadherin-betaE; cell-cell adhesion molecule product : protocadherin beta 5 protein_id : NP_444360.1

name	Pcdhb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087781 CCDS:CCDS29174.1 GeneID:93877 MGI:2136740
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin beta 6 protein_id : NP_444361.1

name	Pcdhb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189407 GeneID:93878 MGI:2136741
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin beta 7 protein_id : NP_444362.2

name	Pcdhb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716433 CCDS:CCDS29175.1 GeneID:93879 MGI:2136742
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 8 protein_id : NP_444363.1

name	Pcdhb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866011 GeneID:93880 MGI:2136744
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 9 protein_id : NP_444364.3

name	Pcdhb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087783 CCDS:CCDS29177.1 GeneID:93881 MGI:2136745
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 10 protein_id : NP_444365.1

name	Pcdhb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189403 CCDS:CCDS29178.1 GeneID:93882 MGI:2136746
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin beta 11 protein_id : NP_444366.2

name	Pcdhb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087787 GeneID:93883 MGI:2136747
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 12 protein_id : NP_444367.1

name	Pcdhb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087789 CCDS:CCDS29179.1 GeneID:93884 MGI:2136748
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 13 protein_id : NP_444368.1

name	Pcdhb14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189405 CCDS:CCDS29180.1 GeneID:93885 MGI:2136749
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Protocadherin-betaN; cell-cell adhesion molecule product : protocadherin beta 14 protein_id : NP_444369.2

name	Pcdhb15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087793 CCDS:CCDS29181.1 GeneID:93886 MGI:2136750
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 15 protein_id : NP_444370.1

name	Pcdhb16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189411 CCDS:CCDS29182.1 GeneID:93887 MGI:2136752
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Protocadherin-betaP; cell-cell adhesion molecule product : protocadherin beta 16 protein_id : NP_444371.2

name	Pcdhb17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32308225 CCDS:CCDS29183.1 GeneID:93888 MGI:2136754
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 17 protein_id : NP_444372.2

name	Pcdhb18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087797 CCDS:CCDS29184.1 GeneID:93889 MGI:2136756
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 18 protein_id : NP_444373.1

name	Pcdhb19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89363034 CCDS:CCDS29185.1 GeneID:93890 MGI:2136757
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 19 protein_id : NP_444374.2

name	Pcdhb20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89994747 GeneID:93891 MGI:2136758
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 20 protein_id : NP_444375.2

name	Pcdhb21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087803 CCDS:CCDS29186.1 GeneID:93892 MGI:2136759
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 21 protein_id : NP_444376.1

name	Pcdhb22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189396 CCDS:CCDS29187.1 GeneID:93893 MGI:2136760
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin beta 22 protein_id : NP_444377.2

name	Slc25a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269722 GeneID:83885 MGI:2137907
definition	codon_start : 1 product : mutant ornithine transporter 2 protein_id : XP_111757.4

name	Taf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755712 CCDS:CCDS29189.1 GeneID:24074 MGI:1346348
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : TATA box binding protein (TBP) associated factor, RNA polymerase II, F, 55 kDa; TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55 kDa product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_036031.1

name	Taf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28461141 CCDS:CCDS29189.1 GeneID:24074 MGI:1346348
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : TATA box binding protein (TBP) associated factor, RNA polymerase II, F, 55 kDa; TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55 kDa product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_786964.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087753 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 1 protein_id : NP_291062.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087755 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 2 protein_id : NP_291063.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087757 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 3 protein_id : NP_291064.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:34328337 GeneID:192682
definition	GO_component : GO:0030426 - growth cone [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin gamma subfamily B, 1 protein_id : NP_291052.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:31982598 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin gamma subfamily A, 4 protein_id : NP_291065.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087735 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : 3' RACE product; protocadherin gamma B2 product : protocadherin gamma subfamily B, 2 protein_id : NP_291053.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087761 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 5 protein_id : NP_291066.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087763 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 6 protein_id : NP_291067.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:50878294 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 7 protein_id : NP_291068.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087737 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : protocadherin gamma C-VI product : protocadherin gamma subfamily B, 4 protein_id : NP_291054.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087767 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 8 protein_id : NP_291069.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087739 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 5 protein_id : NP_291055.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087769 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 9 protein_id : NP_291070.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087741 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 6 protein_id : NP_291056.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087771 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 10 protein_id : NP_291071.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087743 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 7 protein_id : NP_291057.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087773 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 11 protein_id : NP_291072.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087745 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : protocadherin gamma subfamily B, 8 protein_id : NP_291058.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087775 CCDS:CCDS29191.1 GeneID:192682
definition	GO_component : GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence ISS]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : protocadherin 13; protocadherin gamma A12; protocadherin gamma B6 product : protocadherin gamma subfamily A, 12 protein_id : NP_291073.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087747 CCDS:CCDS29192.1 GeneID:192682
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005911 - intercellular junction [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence TAS] codon_start : 1 note : protocadherin 2 product : protocadherin gamma subfamily C, 3 protein_id : NP_291059.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087749 CCDS:CCDS29193.1 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily C, 4 protein_id : NP_291060.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087751 CCDS:CCDS29194.1 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily C, 5 protein_id : NP_291061.1

name	Diap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681183 GeneID:13367 MGI:1194490
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030041 - actin filament polymerization [Evidence IDA]; GO:0016043 - cell organization and biogenesis [Evidence IEA] codon_start : 1 product : diaphanous homolog 1 protein_id : NP_031884.1

name	Hdac3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89257352 GeneID:15183 MGI:1343091
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence TAS] [Evidence IEA]; GO:0016575 - histone deacetylation [Evidence IEA]; GO:0007346 - regulation of progression through mitotic cell cycle [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 3 protein_id : NP_034541.2

name	4631403P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418899 CCDS:CCDS29195.1 GeneID:225392 MGI:1918044
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC225392 protein_id : NP_722488.1

name	Fchsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254312 GeneID:319262 MGI:2441771
definition	GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : FCH and double SH3 domains 1 protein_id : NP_783615.2

name	Centd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27885015 CCDS:CCDS29196.1 GeneID:106952 MGI:2147274
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0008060 - ARF GTPase activator activity [Evidence IDA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0030675 - Rac GTPase activator activity [Evidence IDA]; GO:0005100 - Rho GTPase activator activity [Evidence IDA] GO_process : GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0035021 - negative regulation of Rac protein signal transduction [Evidence IDA]; GO:0035024 - negative regulation of Rho protein signal transduction [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dual-specificity Rho- and Arf-GTPase activating protein 1; ARF-GAP, RHO-GAP, ankyrin repeat and plekstrin homology domains-containing protein 3 product : ARF-GAP, RHO-GAP, ankyrin repeat and pleckstrin homology domains-containing protein 3 protein_id : NP_631945.1

name	Pcdh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328319 CCDS:CCDS29197.1 GeneID:75599 MGI:104692
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005911 - intercellular junction [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence TAS] codon_start : 1 product : protocadherin 1 protein_id : NP_083633.2

name	1700086O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269779 GeneID:73516 MGI:1920766
definition	codon_start : 1 product : hypothetical protein LOC73516 protein_id : XP_001478902.1

name	LOC100042583 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269777 GeneID:100042583
definition	codon_start : 1 product : similar to Rpl17 protein protein_id : XP_001478894.1

name	0610009O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560224 GeneID:66839 MGI:1914089
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66839 protein_id : NP_077141.2

name	Pcdh12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444908 CCDS:CCDS29199.1 GeneID:53601 MGI:1855700
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IDA] codon_start : 1 note : protocadherin 14; VE-cadherin-2; vascular endothelial cadherin-2 product : protocadherin 12 protein_id : NP_059074.2

name	Rnf14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910592 CCDS:CCDS29200.1 GeneID:56736 MGI:1929668
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0019787 - small conjugating protein ligase activity [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence ISS]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRIAD2 type I product : ring finger protein 14 protein_id : NP_064396.1

name	Gnpda1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754030 CCDS:CCDS29201.1 GeneID:26384 MGI:1347054
definition	GO_function : GO:0004342 - glucosamine-6-phosphate deaminase activity [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence TAS]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006002 - fructose 6-phosphate metabolism [Evidence ISS]; GO:0046370 - fructose biosynthesis [Evidence ISS]; GO:0006041 - glucosamine metabolism [Evidence ISS]; GO:0006044 - N-acetylglucosamine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glucose-6-phosphate isomerase product : glucosamine-6-phosphate deaminase 1 protein_id : NP_036067.1

name	LOC240219 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269782 GeneID:240219
definition	codon_start : 1 product : similar to glutamine synthetase protein_id : XP_001478968.1

name	Ndfip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89001091 GeneID:65113 MGI:1929601
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Nedd4 WW-binding protein 5; Nedd4 WW binding protein 5 product : Nedd4 family interacting protein 1 protein_id : NP_075372.1

name	Spry4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543767 CCDS:CCDS29202.1 GeneID:24066 MGI:1345144
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0043407 - negative regulation of MAPK activity [Evidence IDA]; GO:0009966 - regulation of signal transduction [Evidence IEA] codon_start : 1 product : sprouty homolog 4 protein_id : NP_036028.2

name	LOC100041875 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269726 GeneID:100041875
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477200.1

name	LOC100041894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269732 GeneID:100041894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477228.1

name	Fgf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753850 CCDS:CCDS29204.1 GeneID:14164 MGI:95515
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0001759 - induction of an organ [Evidence IDA]; GO:0030324 - lung development [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : fibroblast growth factor 1 (acidic) product : fibroblast growth factor 1 protein_id : NP_034327.1

name	EG545253 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702103 GeneID:545253 MGI:3646292
definition	codon_start : 1 product : hypothetical protein LOC545253 protein_id : NP_001028961.1

name	Arhgap26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87159826 CCDS:CCDS29205.1 GeneID:71302 MGI:1918552
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Rho GTPase activating protein 26 protein_id : NP_780373.3

name	LOC100041839 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041839
definition	number : 1 pseudo : _no_value

name	LOC100041865 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041865
definition	number : 1 pseudo : _no_value

name	LOC100042671 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042671
definition	number : 2 pseudo : _no_value

name	LOC100042671 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042671
definition	number : 1 pseudo : _no_value

name	LOC666809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666809
definition	number : 3 pseudo : _no_value

name	LOC666809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666809
definition	number : 2 pseudo : _no_value

name	LOC666809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666809
definition	number : 1 pseudo : _no_value

name	EG666693 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94404394 GeneID:666693 MGI:3647216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : predicted gene, EG666693 pseudo : _no_value transcript_id : XR_001910.1

name	9630014M24Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149269783 GeneID:381155 MGI:3588234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 9630014M24 gene transcript_id : XR_035375.1

clone name	MSMg01-062G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-446E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-186O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054H02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-178L02.b	B6Ng01-178L02.g
ACC	GA005607	GA005608
length	505	1,048
definition	B6Ng01-178L02.b	B6Ng01-178L02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(38,349,428 - 38,349,938)	(38,219,754 - 38,220,802)
sequence	catgattgaacctgtctggagacaggtgagggtttgtaggtgagctgttt gcgcacctgtctgaaggcagattcggtgtgtgagagagaagagtgctggg gagtgaagctgaaagaactgcacctactttagggagttggggggggactg tcctagagggcagcagaatagtgacagcgggccacaggtgggtaaggaag gctgtgcttgcctgaggggcgtgtgcttctgagctcgcacctcaggtcag aagcagaatgtgtatgctaaggagaggccatagagcagagatttttgagg gtgccatccctaatggctgttcctgctcttctgcagacctccgccctttg cccgacgtcgccatgacgggcacatgtacccgggagtgcagcgagtttgg tcactctgacacatgctggatgcctggccagtcgtctcccagccgccgga ccaagagcagcgccctcaaactctccaccttcgtgccttaccaggaccga ggagg	gaattctttgacatgttgtatatccagggacaacttgctgatctctctga gctttggtctccatatccttcaaatgggggaagatattgccatgggatta tgtggggatcccatatagttatcagggcttgtgagggacagtgtggacca gtggtagccactgctctggaatgccagccatcatttacagcttctcttcc tgctgtgccatgagctgtgtctgctccacactggccacatgttcagtttg ataggctggtagttggactgtttctgatagtatcagtaagccacaacagc caagctctaattctggagccagagacaggagttcaaatcccagtgtggca tcggacactgaacttttcaaagttttgatttcttcacttctaaaaaggaa gcgggttttatggagattaaataggacggtgctcagcattttccaggccc ttcctggacattgctataaaaggttttatgctgtaatggggaaagcctct gatttgagatcaagagatctaggttaaatccacctccatctcttatttac tgtactatctttaggcaattgttgcacctctagttcccaatatatagaaa aaaacatgtcaagtgcggctctaaggctcgcacttgctatcccagcactt agcaggtcaaggcagagagggtgcaatgagttttaggtctgtctgggcta cagagtgaggtacagtctcaaaaccaaccaaccaacaaccaacaacactc cagaaagaaagcacatgacagtgtaaaatcatccggtcttaagtcgccat gaagaaaactgagaacccagcatgatgcttactgcctatagaatgaataa cagcagtgacgagatctcagatctggattgagaagaacctagctttgtat ttgctttgtgtgtgacttgggacaatgacttcacctctatgaacctttga attctcttgctataaaagtaggatatatgtatccccagcatcatcatgga attaaatagacaggtaatattaaaacacctcataaaccataggacgtc
quality values	Open. Hide. 31 10 62 62 44 47 62 62 62 49 49 62 59 62 62 62 62 62 62 62 62 49 59 49 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 51 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 56 62 56 62 47 47 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 35 47 62 62 62 62 56 62 56 47 62 62 62 62 62 47 51 56 50 43 56 47 47 47 47 62 56 62 54 62 62 62 62 62 50 47 56 56 43 43 62 62 39 35 52 33 35 21 15 21 25 39 48 52 46 46 41 35 52 62 62 62 47 62 62 62 43 47 39 52 44 58 54 58 54 41 52 42 52 43 41 54 54 54 38 58 58 58 52 43 47 52 52 54 47 41 52 52 41 31 54 54 54 20 19 19 12 16 13 7 7 16 20 40 37 37 41 52 36 29 18	Open. Hide. 62 49 56 47 62 62 62 62 62 62 59 59 43 46 49 34 34 48 50 50 56 62 62 62 59 49 62 62 59 54 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 49 42 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 59 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 49 58 58 58 58 58 54 54 58 52 58 54 58 52 54 53 58 58 58 54 58 58 58 58 58 58 54 58 58 52 58 58 58 58 54 39 58 58 58 58 58 54 58 52 58 54 58 58 58 58 52 49 58 53 58 58 58 58 58 58 53 41 58 41 48 58 49 58 58 38 58 58 50 53 45 58 58 58 51 51 51 58 54 50 58 46 50 58 47 51 54 58 49 51 53 54 58 58 58 58 58 58 51 52 58 58 52 41 51 58 58 50 58 49 47 58 37 58 52 53 46 49 28 49 39 58 51 51 50 50 48 58 41 46 51 49 50 52 50 58 58 50 52 51 52 41 58 33 30 50 53 52 32 58 39 50 39 49 49 58 52 52 41 46 35 51 30 58 51 50 58 45 31 38 50 51 53 39 49 58 58 42 52 15 58 38 53 52 54 52 51 41 38 54 41 49 53 33 37 25 37 54 24 52 53 41 29 54 32 32 31 38 37 49 54 53 52 28 54 54 51 26 30 27 50 39 35 13 49 24 49 28 51 42 31 49 38 27 30 33 30 31 47 44 25 52 54 32 51 31 34 49 26 21 40 54 54 44 26 39 32 33 33 33 39 32 33 37 37 28 53 32 34 53 53 25 34 39 15 40 32 39 26 41 26 32 31 40 30 33 31 31 27 31 34 42 23 32 34 34 33 29 53 53 51 37 26 40 32 37 23 34 32 16 41 40 28 25 29 31 31 33 21 20 26 25 38 35 33 31 38 41 10 31 32 23 31 36 26 42 28 29 41 32 31 35 21 25 19 30 36 32 25 32 31 37 16 19 16 24 13 31 31 34 32 18 12 17 31 24 31 31 41 32 26 16 31 32 26 12 31 8 9 27 24 29 42 34 36 33 34 38 46 33 26 11 9 24 46 31 31 25 22 46 28 10 14 31 27 31 29 19 27 16 32 10 25 46 36 29 30 37 21 17 30 27 24 21 32 9 5 28 29 21 26 27 25 16 13 22 21 17 32 16 44 21 33 32 37 27 24 12 7 14 31 27 42 21 33 31 36 24 44 44 36 19 31 23 17 11 10 6 13 10 16 15 19 21 32 34 27 48 39 34 22 28 34 12 20 21 7 16 29 23 17 18 28 7 6 17 17 16 31 15 17 7 6 32 28 8 5 4 14 10 17 6 7 30 7 18 43 39 18 11 16 24 10 28 14 13 18 15 24 10 14 21 11 21 8 18 11 29 24 27 28 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr18_38349428_38349938
seq2: B6Ng01-178L02.b_42_552 (reverse)

seq1  CCTCCTCGGTCCTGGTAAGGCACGAAGGTGGAGAGTTTGAGGGCGCTGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTCGGTCCTGGTAAGGCACGAAGGTGGAGAGTTTGAGGGCGCTGCT  50

seq1  CTTGGTCCGGCGGCTGGGAGACGACTGGCCAGGCATCCAGCATGTGTCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGTCCGGCGGCTGGGAGACGACTGGCCAGGCATCCAGCATGTGTCAG  100

seq1  AGTGACCAAACTCGCTGCACTCCCGGGTACATGTGCCCGTCATGGCGACG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGACCAAACTCGCTGCACTCCCGGGTACATGTGCCCGTCATGGCGACG  150

seq1  TCGGGCAAAGGGCGGAGGTCTGCAGAAGAGCAGGAACAGCCATTAGGGAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGGCAAAGGGCGGAGGTCTGCAGAAGAGCAGGAACAGCCATTAGGGAT  200

seq1  GGCACCCTCAAAAATCTCTGCTCTATGGCCTCTCCTTAGCATACACATTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCACCCTCAAAAATCTCTGCTCTATGGCCTCTCCTTAGCATACACATTC  250

seq1  TGCTTCTGACCTGAGGTGCGAGCTCAGAAGCACACGCCCCTCAGGCAAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTCTGACCTGAGGTGCGAGCTCAGAAGCACACGCCCCTCAGGCAAGC  300

seq1  ACAGCCTTCCTTACCCACCTGTGGCCCGCTGTCACTATTCTGCTGCCCTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCCTTCCTTACCCACCTGTGGCCCGCTGTCACTATTCTGCTGCCCTC  350

seq1  TAGGACAGTCCCCCCCCAACTCCCTAAAGTAGGTGCAGTTCTTTCAGCTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGACAGTCCCCCCCCAACTCCCTAAAGTAGGTGCAGTTCTTTCAGCTT  400

seq1  CACTCCCCAGCACTCTTCTCTCTCACACACCGAATCTGCCTTCAGACAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCCCCAGCACTCTTCTCTCTCACACACCGAATCTGCCTTCAGACAGG  450

seq1  TGCGCAAACAGCTCACCTACAAACCCTCACCTGTCTCCAGACAGGTTCAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCGCAAACAGCTCACCTACAAACCCTCACCTGTCTCCAGACAGGTTCAA  500

seq1  TCATGGAATTC  511
      |||||||||||
seq2  TCATGGAATTC  511

seq1: chr18_38219754_38220802
seq2: B6Ng01-178L02.g_62_1109

seq1  GAATTCTTTGACATGTTGTATATCCAGGGACAACTTGCTGATCTCTCTGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTGACATGTTGTATATCCAGGGACAACTTGCTGATCTCTCTGA  50

seq1  GCTTTGGTCTCCATATCCTTCAAATGGGGGAAGATATTGCCATGGGATTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTGGTCTCCATATCCTTCAAATGGGGGAAGATATTGCCATGGGATTA  100

seq1  TGTGGGGATCCCATATAGTTATCAGGGCTTGTGAGGGACAGTGTGGACCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGGGATCCCATATAGTTATCAGGGCTTGTGAGGGACAGTGTGGACCA  150

seq1  GTGGTAGCCACTGCTCTGGAATGCCAGCCATCATTTACAGCTTCTCTTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTAGCCACTGCTCTGGAATGCCAGCCATCATTTACAGCTTCTCTTCC  200

seq1  TGCTGTGCCATGAGCTGTGTCTGCTCCACACTGGCCACATGTTCAGTTTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTGCCATGAGCTGTGTCTGCTCCACACTGGCCACATGTTCAGTTTG  250

seq1  ATAGGCTGGTAGTTGGACTGTTTCTGATAGTATCAGTAAGCCACAACAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGGCTGGTAGTTGGACTGTTTCTGATAGTATCAGTAAGCCACAACAGC  300

seq1  CAAGCTCTAATTCTGGAGCCAGAGACAGGAGTTCAAATCCCAGTGTGGCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCTCTAATTCTGGAGCCAGAGACAGGAGTTCAAATCCCAGTGTGGCA  350

seq1  TCGGACACTGAACTTTTCAAAGTTTTGATTTCTTCACTTCTAAAAAGGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGACACTGAACTTTTCAAAGTTTTGATTTCTTCACTTCTAAAAAGGAA  400

seq1  GCGGGTTTTATGGAGATTAAATAGGACGGTGCTCAGCATTTTCCAGGCCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGGTTTTATGGAGATTAAATAGGACGGTGCTCAGCATTTTCCAGGCCC  450

seq1  TTCCTGGACATTGCTATAAAAGGTTTTATGCTGTAATGGGGAAAGCCTCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTGGACATTGCTATAAAAGGTTTTATGCTGTAATGGGGAAAGCCTCT  500

seq1  GATTTGAGATCAAGAGATCTAGGTTAAATCCACCTCCATCTCTTATTTAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTGAGATCAAGAGATCTAGGTTAAATCCACCTCCATCTCTTATTTAC  550

seq1  TGTACTATCTTTAGGCAATTGTTGCACCTCTAGTTCCCAATATATAGAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTACTATCTTTAGGCAATTGTTGCACCTCTAGTTCCCAATATATAGAAA  600

seq1  AAAACATGTCAAGTGCGGCTCTAAGGCTCGCACTTGCTATCCCAGCACTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACATGTCAAGTGCGGCTCTAAGGCTCGCACTTGCTATCCCAGCACTT  650

seq1  AGCAGGTCAAGGCAGAGAGGGTGCAATGAGTTTTAGGTCTGTCTGGGCTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGTCAAGGCAGAGAGGGTGCAATGAGTTTTAGGTCTGTCTGGGCTA  700

seq1  CAGAGTGAGGTACAGTCTCAAAACCAACCAACCAACAACCAACAACACTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGTGAGGTACAGTCTCAAAACCAACCAACCAACAACCAACAACACTC  750

seq1  CAGAAAGAAAGCACATGACAGTGTAAAATCATCCGGTCTTAAGTCGCCAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAAGAAAGCACATGACAGTGTAAAATCATCCGGTCTTAAGTCGCCAT  800

seq1  GAAGAAAACTGAGAACCCAGCATGATGCTTACTGCCTATAGAATGAATAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAAAACTGAGAACCCAGCATGATGCTTACTGCCTATAGAATGAATAA  850

seq1  CAGCAGTGACGAGATCTCAGATCTGGATTGAG-AGAACCTAGCTTTGTAT  899
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  CAGCAGTGACGAGATCTCAGATCTGGATTGAGAAGAACCTAGCTTTGTAT  900

seq1  TTGCTTTGTGTGTGACTTGGGACAAATGACTTCACCTCTATGAACC-TTG  948
      ||||||||||||||||||||||| |||||||||||||||||||||| |||
seq2  TTGCTTTGTGTGTGACTTGGGAC-AATGACTTCACCTCTATGAACCTTTG  949

seq1  AATTCTCTTGCTATAAAAGTAGGATAATATGTATCCCCAGCATCATCATG  998
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  AATTCTCTTGCTATAAAAGTAGGAT-ATATGTATCCCCAGCATCATCATG  998

seq1  GAATTAAATTAGACAGTTAATATTAAAACACCTCATAAACCATAGGACGT  1048
      |||||||| ||||||| |||||||||||||||||||||||||||||||||
seq2  GAATTAAA-TAGACAGGTAATATTAAAACACCTCATAAACCATAGGACGT  1047

seq1  C  1049
      |
seq2  C  1048

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information