MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-340D12
Chromosome	18 (Build37)
Map Location	36,065,604 - 36,193,433
singlet/doublet	doublet
Overlap gene	Psd2, LOC100042150
Upstream gene	Etf1, Hspa9, LOC100041377, EG626954, LOC100041951, Ctnna1, Lrrtm2, Sil1, LOC100041423, LOC666460, LOC666462, EG383341, EG436583, Matr3, Paip2, Slc23a1, 2010001M09Rik, Gm1614, 5133400G04Rik, Dnajc18, 1110006O17Rik, 1700066B19Rik, 2610307O08Rik, LOC666505, Ube2d2, Cxxc5, LOC100042131
Downstream gene	LOC100041531, Pura, 0610010O12Rik, Pfdn1, Hbegf, Slc4a9, LOC624979, Eif4ebp3, Sra1, Apbb3, Slc35a4, E230025N22Rik, Cd14, Tmco6, Ndufa2, Ik, Wdr55, Dnd1, Hars, Hars2, Zmat2, EG627427, Pcdha1, Pcdha@, Pcdha2, Pcdha3, Pcdha4, Pcdha5, Pcdha6, Pcdha7, Pcdha8, Pcdha9, Pcdha10, Pcdha11, Pcdha12
Link	Open Mouse BAC browser

Click to get alignment info.

name	Etf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225363 MGI:2385071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspa9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15526 MGI:96245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041377 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG626954 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626954 MGI:3648052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 780 ESTs, 8 Proteins

name	LOC100041951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ctnna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12385 MGI:88274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrtm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107065 MGI:2389174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81500 MGI:1932040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC666460 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins pseudo : _no_value

name	LOC666462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	EG383341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383341 MGI:3648788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 16 Proteins

name	EG436583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436583 MGI:3646921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17184 MGI:1298379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67869 MGI:1915119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc23a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20522 MGI:1341903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010001M09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69816 MGI:1917066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1614 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381148 MGI:2686460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs, 2 Proteins

name	5133400G04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71242 MGI:1918492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dnajc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76594 MGI:1923844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110006O17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68545 MGI:1915795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700066B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73449 MGI:1920699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610307O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 207 ESTs, 5 Proteins

name	LOC666505 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ube2d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56550 MGI:1930715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxxc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67393 MGI:1914643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042131 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Psd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74002 MGI:1921252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 9 Proteins

name	LOC100041531 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Pura (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19290 MGI:103079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610010O12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66060 MGI:1913310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfdn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67199 MGI:1914449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hbegf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15200 MGI:96070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240215 MGI:2443384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624979 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 299 ESTs, 9 Proteins pseudo : _no_value

name	Eif4ebp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108112 MGI:1270847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24068 MGI:1344414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apbb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225372 MGI:108404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67843 MGI:1915093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	E230025N22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240216 MGI:3687212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12475 MGI:88318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmco6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71983 MGI:1919233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17991 MGI:1343103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24010 MGI:1345142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67936 MGI:1915186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213236 MGI:2447763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15115 MGI:108087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70791 MGI:1918041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66492 MGI:1913742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627427 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627427 MGI:3647509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 175 ESTs, 5 Proteins

name	Pcdha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116731 MGI:2150982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha@ (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 14 mRNAs

name	Pcdha2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353234 MGI:2681880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192163 MGI:2447313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12936 MGI:1298406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12941 MGI:1298371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12937 MGI:1298367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12939 MGI:1298369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353235 MGI:2681879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192161 MGI:2447322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12943 MGI:1298408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12942 MGI:1298372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192164 MGI:1298370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286825 GeneID:225363 MGI:2385071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation termination factor 1 transcript_id : NM_144866.3

name	Hspa9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754255 GeneID:15526 MGI:96245
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 9 transcript_id : NM_010481.1

name	LOC100041377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269711 GeneID:100041377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100041377 transcript_id : XM_001476281.1

name	EG626954 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269735 GeneID:626954 MGI:3648052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 780 ESTs, 8 Proteins product : predicted gene, EG626954 transcript_id : XM_891577.3

name	LOC100041951 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269737 GeneID:100041951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041951 transcript_id : XM_001477645.1

name	Ctnna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753293 GeneID:12385 MGI:88274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin (cadherin associated protein), alpha 1 transcript_id : NM_009818.1

name	Lrrtm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802003 GeneID:107065 MGI:2389174
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat transmembrane neuronal 2 transcript_id : NM_178005.2

name	Sil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13540506 GeneID:81500 MGI:1932040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae) transcript_id : NM_030749.1

name	LOC100041423 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269714 GeneID:100041423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041423 transcript_id : XM_001476356.1

name	LOC666462 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94404369 GeneID:666462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical LOC666462 transcript_id : XM_984027.1

name	EG383341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269743 GeneID:383341 MGI:3648788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 16 Proteins product : predicted gene, EG383341 transcript_id : XM_356994.4

name	Matr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349909 GeneID:17184 MGI:1298379
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrin 3 transcript_id : NM_010771.4

name	Paip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372306 GeneID:67869 MGI:1915119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyadenylate-binding protein-interacting protein 2 transcript_id : NM_026420.2

name	Slc23a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42741685 GeneID:20522 MGI:1341903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 23 (nucleobase transporters), member 1 transcript_id : NM_011397.3

name	2010001M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803335 GeneID:69816 MGI:1917066
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010001M09 gene transcript_id : NM_027222.2

name	Gm1614 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269717 GeneID:381148 MGI:2686460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs, 2 Proteins product : gene model 1614, (NCBI) transcript_id : XM_891736.3

name	5133400G04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56961613 GeneID:71242 MGI:1918492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5133400G04 gene transcript_id : NM_029485.1

name	5133400G04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803045 GeneID:71242 MGI:1918492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5133400G04 gene transcript_id : NM_027733.4

name	Dnajc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377320 GeneID:76594 MGI:1923844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 18 transcript_id : NM_029669.3

name	1110006O17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677529 GeneID:68545 MGI:1915795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110006O17 gene transcript_id : NM_001033141.1

name	1700066B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388187 GeneID:73449 MGI:1920699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700066B19 gene transcript_id : NM_001033168.2

name	2610307O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404341 GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 185 ESTs, 2 Proteins product : RIKEN cDNA 2610307O08 gene, transcript variant 6 transcript_id : XM_989707.1

name	2610307O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404340 GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 199 ESTs, 3 Proteins product : RIKEN cDNA 2610307O08 gene, transcript variant 5 transcript_id : XM_900126.2

name	2610307O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404338 GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 128 ESTs, 4 Proteins product : RIKEN cDNA 2610307O08 gene, transcript variant 2 transcript_id : XM_892499.2

name	2610307O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404337 GeneID:72512 MGI:1919762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 124 ESTs, 3 Proteins product : RIKEN cDNA 2610307O08 gene, transcript variant 1 transcript_id : XM_128954.7

name	LOC666505 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269718 GeneID:666505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to hCG1640785 transcript_id : XM_984294.2

name	Ube2d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910599 GeneID:56550 MGI:1930715
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2D 2 transcript_id : NM_019912.1

name	Cxxc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709446 GeneID:67393 MGI:1914643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CXXC finger 5 transcript_id : NM_133687.2

name	LOC100042131 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269746 GeneID:100042131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100042131 transcript_id : XM_001477987.1

name	Psd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676386 GeneID:74002 MGI:1921252
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin and Sec7 domain containing 2 transcript_id : NM_028707.3

name	LOC100042150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269755 GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 2 Proteins product : similar to NTAK alpha2, transcript variant 4 transcript_id : XM_001478044.1

name	LOC100042150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269749 GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 4 Proteins product : similar to NTAK alpha2, transcript variant 1 transcript_id : XM_001478011.1

name	LOC100042150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269753 GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 3 Proteins product : similar to NTAK alpha2, transcript variant 3 transcript_id : XM_001478031.1

name	LOC100042150 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269751 GeneID:100042150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 3 Proteins product : similar to NTAK alpha2, transcript variant 2 transcript_id : XM_001478024.1

name	Pura (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358028 GeneID:19290 MGI:103079
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purine rich element binding protein A transcript_id : NM_008989.2

name	0610010O12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486944 GeneID:66060 MGI:1913310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610010O12 gene transcript_id : NM_001081365.1

name	Pfdn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802614 GeneID:67199 MGI:1914449
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prefoldin 1 transcript_id : NM_026027.2

name	Hbegf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754177 GeneID:15200 MGI:96070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparin-binding EGF-like growth factor transcript_id : NM_010415.1

name	Slc4a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129949 GeneID:240215 MGI:2443384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4, sodium bicarbonate cotransporter, member 9 transcript_id : NM_172830.2

name	Eif4ebp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892449 GeneID:108112 MGI:1270847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E binding protein 3 transcript_id : NM_201256.3

name	Sra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801852 GeneID:24068 MGI:1344414
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : steroid receptor RNA activator 1 transcript_id : NM_025291.2

name	Apbb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122588 GeneID:225372 MGI:108404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family B, member 3 transcript_id : NM_146085.1

name	Slc35a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031965 GeneID:67843 MGI:1915093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member A4 transcript_id : NM_026404.2

name	Slc35a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031967 GeneID:67843 MGI:1915093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member A4 transcript_id : NM_001083317.1

name	E230025N22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89257349 GeneID:240216 MGI:3687212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Riken cDNA E230025N22 gene transcript_id : NM_172831.2

name	Cd14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129882 GeneID:12475 MGI:88318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD14 antigen transcript_id : NM_009841.3

name	Tmco6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181163 GeneID:71983 MGI:1919233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and coiled-coil domains 6 transcript_id : NM_028036.3

name	Ndufa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372167 GeneID:17991 MGI:1343103
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 transcript_id : NM_010885.3

name	Ik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468954 GeneID:24010 MGI:1345142
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IK cytokine transcript_id : NM_011879.1

name	Wdr55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980932 GeneID:67936 MGI:1915186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 55 transcript_id : NM_026464.2

name	Dnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27734199 GeneID:213236 MGI:2447763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dead end homolog 1 (zebrafish) transcript_id : NM_173383.1

name	Hars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388902 GeneID:15115 MGI:108087
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidyl-tRNA synthetase transcript_id : NM_008214.3

name	Hars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18079342 GeneID:70791 MGI:1918041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidyl-tRNA synthetase 2, mitochondrial (putative) transcript_id : NM_080636.1

name	Zmat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130302 GeneID:66492 MGI:1913742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, matrin type 2 transcript_id : NM_025594.3

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:16905102 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_054072.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092276 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_198117.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426880 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138662.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:133892408 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_007766.2

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:20137001 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009959.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142352474 GeneID:192162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_007767.2

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:23956045 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009957.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092278 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_201243.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426884 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138661.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426848 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009961.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:23956047 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009960.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31077090 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138663.2

name	Etf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286826 CCDS:CCDS29137.1 GeneID:225363 MGI:2385071
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003747 - translation release factor activity [Evidence ISS]; GO:0016149 - translation release factor activity, codon specific [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006415 - translational termination [Evidence ISS] [Evidence IEA] codon_start : 1 product : eukaryotic translation termination factor 1 protein_id : NP_659115.3

name	Hspa9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754256 CCDS:CCDS29138.1 GeneID:15526 MGI:96245
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006611 - protein export from nucleus [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : mismatches in translation note : heat shock protein cognate 74; heat shock protein, 74 kDa, A; heat shock protein, A; C3H-specific antigen product : heat shock protein 9A protein_id : NP_034611.1

name	LOC100041377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269712 GeneID:100041377
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476331.1

name	EG626954 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269736 GeneID:626954 MGI:3648052
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896670.2

name	LOC100041951 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269738 GeneID:100041951
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477695.1

name	Ctnna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753294 CCDS:CCDS29139.1 GeneID:12385 MGI:88274
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IEA]; GO:0005912 - adherens junction [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005915 - zonula adherens [Evidence IDA] GO_function : GO:0051015 - actin filament binding [Evidence IDA]; GO:0045296 - cadherin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : alpha E catenin; alpha(E)-catenin; cadherin associated protein product : catenin alpha 1 protein_id : NP_033948.1

name	Lrrtm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29725617 GeneID:107065 MGI:2389174
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : leucine-rich repeat transmembrane neuronal 2 protein protein_id : NP_821072.1

name	Sil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13540507 CCDS:CCDS29140.1 GeneID:81500 MGI:1932040
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : ER chaperone and modulator of BiP product : endoplasmic reticulum chaperone SIL1 homolog protein_id : NP_109674.1

name	LOC100041423 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269715 GeneID:100041423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476406.1

name	LOC666462 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94404370 GeneID:666462
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989121.1

name	EG383341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82996161 GeneID:383341 MGI:3648788
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 protein_id : XP_356994.2

name	Matr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25141233 CCDS:CCDS29142.1 GeneID:17184 MGI:1298379
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : matrin 3 protein_id : NP_034901.2

name	Paip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385918 CCDS:CCDS29143.1 GeneID:67869 MGI:1915119
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 note : Pabp-interacting protein 2 product : polyadenylate-binding protein-interacting protein 2 protein_id : NP_080696.1

name	Slc23a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42741686 CCDS:CCDS29144.1 GeneID:20522 MGI:1341903
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 23 (nucleobase transporters), member 2 product : solute carrier family 23 (nucleobase transporters), member 1 protein_id : NP_035527.3

name	2010001M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312436 CCDS:CCDS29145.1 GeneID:69816 MGI:1917066
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69816 protein_id : NP_081498.1

name	Gm1614 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82996166 GeneID:381148 MGI:2686460
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896829.1

name	5133400G04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56961614 CCDS:CCDS29146.1 GeneID:71242 MGI:1918492
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; TATA-binding protein-like factor-interacting protein product : TATA-binding protein-like factor-interacting protein isoform 2 protein_id : NP_083761.1

name	5133400G04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56961629 CCDS:CCDS29147.1 GeneID:71242 MGI:1918492
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; TATA-binding protein-like factor-interacting protein product : TATA-binding protein-like factor-interacting protein isoform 1 protein_id : NP_082009.3

name	Dnajc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313260 CCDS:CCDS29148.1 GeneID:76594 MGI:1923844
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : DnaJ (Hsp40) homolog, subfamily C, member 18 protein_id : NP_083945.1

name	1110006O17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677530 GeneID:68545 MGI:1915795
definition	codon_start : 1 product : hypothetical protein LOC68545 protein_id : NP_001028313.1

name	1700066B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701682 GeneID:73449 MGI:1920699
definition	codon_start : 1 product : hypothetical protein LOC73449 protein_id : NP_001028340.1

name	2610307O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82995953 GeneID:72512 MGI:1919762
definition	codon_start : 1 product : hypothetical protein LOC72512 isoform 2 protein_id : XP_897592.1

name	2610307O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38083636 GeneID:72512 MGI:1919762
definition	codon_start : 1 product : hypothetical protein LOC72512 isoform 1 protein_id : XP_128954.2

name	2610307O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94404342 GeneID:72512 MGI:1919762
definition	codon_start : 1 product : hypothetical protein LOC72512 isoform 6 protein_id : XP_994801.1

name	2610307O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82995950 GeneID:72512 MGI:1919762
definition	codon_start : 1 product : hypothetical protein LOC72512 isoform 5 protein_id : XP_905219.1

name	LOC666505 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269719 GeneID:666505
definition	codon_start : 1 product : similar to hCG1640785 protein_id : XP_989388.2

name	Ube2d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910600 GeneID:56550 MGI:1930715
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : ubiquitin conjugating enzyme 2e product : ubiquitin-conjugating enzyme E2D 2 protein_id : NP_064296.1

name	Cxxc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526854 CCDS:CCDS29150.1 GeneID:67393 MGI:1914643
definition	codon_start : 1 product : CXXC finger 5 protein_id : NP_598448.1

name	LOC100042131 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269747 GeneID:100042131
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478037.1

name	Psd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676387 GeneID:74002 MGI:1921252
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 product : pleckstrin and Sec7 domain containing 2 protein_id : NP_082983.3

name	LOC100042150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269756 GeneID:100042150
definition	codon_start : 1 product : similar to NTAK alpha2 isoform 4 protein_id : XP_001478094.1

name	LOC100042150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269750 GeneID:100042150
definition	codon_start : 1 product : similar to NTAK alpha2 isoform 1 protein_id : XP_001478061.1

name	LOC100042150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269754 GeneID:100042150
definition	codon_start : 1 product : similar to NTAK alpha2 isoform 3 protein_id : XP_001478081.1

name	LOC100042150 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269752 GeneID:100042150
definition	codon_start : 1 product : similar to NTAK alpha2 isoform 2 protein_id : XP_001478074.1

name	Pura (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679573 CCDS:CCDS29151.1 GeneID:19290 MGI:103079
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005662 - DNA replication factor A complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003697 - single-stranded DNA binding [Evidence IDA]; GO:0046332 - SMAD binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence NAS]; GO:0030154 - cell differentiation [Evidence NAS]; GO:0008283 - cell proliferation [Evidence NAS]; GO:0031575 - G1/S transition checkpoint [Evidence NAS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007399 - nervous system development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] citation : [PUBMED 93078769] citation : [PUBMED 95047494] codon_start : 1 function : sequence-specific single-stranded DNA-binding protein note : Pur alpha product : purine rich element binding protein A protein_id : NP_033015.1

name	0610010O12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486945 GeneID:66060 MGI:1913310
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66060 protein_id : NP_001074834.1

name	Pfdn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385532 CCDS:CCDS29152.1 GeneID:67199 MGI:1914449
definition	GO_function : GO:0051082 - unfolded protein binding [Evidence IEA] codon_start : 1 product : prefoldin 1 protein_id : NP_080303.1

name	Hbegf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754178 CCDS:CCDS29153.1 GeneID:15200 MGI:96070
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005154 - epidermal growth factor receptor binding [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA] [Evidence IDA]; GO:0008201 - heparin binding [Evidence IDA] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence NAS]; GO:0001832 - blastocyst growth [Evidence TAS]; GO:0007173 - epidermal growth factor receptor signaling pathway [Evidence IDA]; GO:0051549 - positive regulation of keratinocyte migration [Evidence IMP]; GO:0048661 - positive regulation of smooth muscle cell proliferation [Evidence IDA]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0035313 - wound healing, spreading of epidermal cells [Evidence IMP] codon_start : 1 note : heparin binding epidermal growth factor-like growth factor; diphtheria toxin receptor product : heparin-binding EGF-like growth factor protein_id : NP_034545.1

name	Slc4a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370244 CCDS:CCDS29154.1 GeneID:240215 MGI:2443384
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : solute carrier family 4, sodium bicarbonate cotransporter, member 9 protein_id : NP_766418.1

name	Eif4ebp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054842 CCDS:CCDS29155.1 GeneID:108112 MGI:1270847
definition	GO_function : GO:0008190 - eukaryotic initiation factor 4E binding [Evidence IEA] GO_process : GO:0017148 - negative regulation of protein biosynthesis [Evidence IEA]; GO:0045947 - negative regulation of translational initiation [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 4E binding protein 3 protein_id : NP_957708.1

name	Sra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384640 CCDS:CCDS29156.1 GeneID:24068 MGI:1344414
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] [Evidence ISS]; GO:0005831 - steroid hormone aporeceptor complex [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003712 - transcription cofactor activity [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA] [Evidence ISS]; GO:0030154 - cell differentiation [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : steroid receptor RNA activator 1 protein_id : NP_079567.1

name	Apbb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122589 CCDS:CCDS29157.1 GeneID:225372 MGI:108404
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0043066 - negative regulation of apoptosis [Evidence TAS] codon_start : 1 product : amyloid beta (A4) precursor protein-binding, family B, member 3 protein_id : NP_666197.1

name	Slc35a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031968 GeneID:67843 MGI:1915093
definition	codon_start : 1 product : solute carrier family 35, member A4 protein_id : NP_001076786.1

name	Slc35a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031966 CCDS:CCDS29158.1 GeneID:67843 MGI:1915093
definition	codon_start : 1 product : solute carrier family 35, member A4 protein_id : NP_080680.2

name	E230025N22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89257350 GeneID:240216 MGI:3687212
definition	codon_start : 1 product : hypothetical protein LOC240216 protein_id : NP_766419.2

name	Cd14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753332 CCDS:CCDS29159.1 GeneID:12475 MGI:88318
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : CD14 antigen protein_id : NP_033971.1

name	Tmco6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181164 GeneID:71983 MGI:1919233
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : transmembrane and coiled-coil domains 6 protein_id : NP_082312.3

name	Ndufa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981600 CCDS:CCDS29161.1 GeneID:17991 MGI:1343103
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005747 - respiratory chain complex I (sensu Eukaryota) [Evidence TAS] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence TAS]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : NADH-ubiquinone oxidoreductase B8 subunit; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 2 (8 kDa) product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 protein_id : NP_035015.2

name	Ik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468955 GeneID:24010 MGI:1345142
definition	codon_start : 1 note : arginine/glutamic acid/aspartic acid repeat containing protein product : IK cytokine protein_id : NP_036009.1

name	Wdr55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229061 CCDS:CCDS29162.1 GeneID:67936 MGI:1915186
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WD repeat domain 55 protein_id : NP_080740.2

name	Dnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734200 CCDS:CCDS29163.1 GeneID:213236 MGI:2447763
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007281 - germ cell development [Evidence IMP] codon_start : 1 note : teratoma product : dead end protein_id : NP_775559.1

name	Hars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982302 CCDS:CCDS29164.1 GeneID:15115 MGI:108087
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004821 - histidine-tRNA ligase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006427 - histidyl-tRNA aminoacylation [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : histidyl tRNA synthetase product : histidyl-tRNA synthetase protein_id : NP_032240.2

name	Hars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079343 CCDS:CCDS29165.1 GeneID:70791 MGI:1918041
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : histidyl-tRNA synthetase-like protein_id : NP_542367.1

name	Zmat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385046 GeneID:66492 MGI:1913742
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, matrin type 2 protein_id : NP_079870.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:16905103 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 1 protein_id : NP_473413.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092277 GeneID:192162
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin alpha 2 protein_id : NP_932785.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426881 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 3 protein_id : NP_619603.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:6681021 GeneID:192162
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 1 product : protocadherin alpha 4 protein_id : NP_031792.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:20137002 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 6 product : protocadherin alpha 5 protein_id : NP_034089.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:6681023 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cadherin-related neuronal receptor 2 product : protocadherin alpha 6 protein_id : NP_031793.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:23956046 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 4 product : protocadherin alpha 7 protein_id : NP_034087.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092279 GeneID:192162
definition	GO_component : GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin alpha 8 protein_id : NP_957695.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426885 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 9 protein_id : NP_619602.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426849 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 3; protocadherin alpha 14 product : protocadherin alpha 10 protein_id : NP_034091.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:23956048 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 7 product : protocadherin alpha 11 protein_id : NP_034090.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426883 CCDS:CCDS29166.1 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 5; protocadherin alpha 13 product : protocadherin alpha 12 protein_id : NP_619604.1

name	LOC100041531 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041531
definition	number : 2 pseudo : _no_value

name	LOC100041531 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041531
definition	number : 1 pseudo : _no_value

name	LOC666460 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149269716 GeneID:666460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins product : similar to Ac2-008 pseudo : _no_value transcript_id : XR_032703.1

name	EG436583 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:142382261 GeneID:436583 MGI:3646921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436583 transcript_id : NR_002905.2

name	LOC624979 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149269757 GeneID:624979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 299 ESTs, 9 Proteins product : similar to Proteasome subunit alpha type 4 (Proteasome component C9) (Macropain subunit C9) (Multicatalytic endopeptidase complex subunit C9) (Proteasome subunit L) pseudo : _no_value transcript_id : XR_033566.1

name	EG627427 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149269720 GeneID:627427 MGI:3647509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 175 ESTs, 5 Proteins product : predicted gene, EG627427 transcript_id : XR_032902.1

clone name	MSMg01-339G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121F22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-302M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542K17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-375F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158N01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-328P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192B09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281F07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-340D12.b	B6Ng01-340D12.g
ACC	GA123990	GA123991
length	1,066	863
definition	B6Ng01-340D12.b	B6Ng01-340D12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(36,192,384 - 36,193,433)	(36,065,604 - 36,066,462)
sequence	gaattccaggttggctaatgttgcacagtgacctgggaccgaggggcttc cctagctcctaaggaacggcaggccagggcagcagaccctgaagacatcc atgtctaagggttagctcagccctgtctgtgagcttctctcaggtgactc gccttcctggggttcagaagaaagcacaggactgggcatgtctcctagaa atctacgaaactgggacttgcttaaggggagaggtggcagccagagacca gaaggaagtgtaccttgagggtatgacagggtcagggagaagggggtggg tggtgcctgggaccagcaagggagtcaagatttgaggagatccaggtcgg agccaggacaaagcccggccacagtggaagaacaggtcccagggcaggca ggccaaggctggcttccagccggctcctgtacacaacagggtcccggtta ggctgctctaagtttccccgaaccaggtgtcaggaaggcagctgtgggac gctagcaactccacctctcctccagctctccagtcccccacttagttttc ctcacacctactgccttagggcaggcagccttctccaaagtataccctct aaaaagtgccttctgttcccagacagccagagctatagcacgagaccctg tctcaaaatacacaaacaagacttcctaggccaaataagtttgtctagtt cagttattatctcctctgctaatggagactgccactctacaggaaccctg ggggatggatttcccaaacacactggaccacagatctctctctctgagag agcagatcaaatacctcccaggtccctttggttcttgagcacacagtgtg agaacagcctagcagatttctactttgagtgttctgggagctgtttcaat agagaaggaaacttgcccagagtcccttgagaagaatcctttccatgggg gcctggaggagtgaccaccaggaacttgtatcctcattattaagtctgcc tgcctggcacctggaaagctacagttctggctttcccgaggggcaccagg ctaggtaagaaggaaa	gaattctctttgtagctaatccctgagaaactgcctctgactcccagatc ataagatggtagtagaaaatatttaatatcccagcccaggatttctaccc cgtctttggttattgagttcccagataaaaaacacactcacagcctttat atttacaattcgccttaagcagcacaatagctgggcagctgaccaccctc catgccgtcagaatctactttcctattgataaccccgagttattacttcc tattttatatgttccatctgggctgctcttaactcctattgggcagctct caggaccacgtttttatggctcagctaacctttggtgatttctcttttct cctctgctgtaaggatcatcgcctatgccaccacaccttaggcagttggc ttgcttatttgttttggttttggagatggggcctcacatagcccaggata ccttgaaactctctaggtggccaaaaatgaccttgaactcctggtcctcc tacctctctctacctctcaagtgctgagattacagccatgcgccatggtg cccggatctttaaggtgctgaagacagaatccaacatgctagactccagc atctgagctacacacacccaactagctctatttaaattgtttgctatttc ttaaagagttatttctgccttgatatgtatgtatgagtgtttgtctgtgt gtatgtatgtgcactgcatgtatgtgtgagtaccacgtgtgtgcaatgca ctgcatgcccaggaggccagaagaggtttgttggatcttttggaactgga gttatgagatggttgtgagctgttggggaattgaacattgggccctctag aagagcagccagt
quality values	Open. Hide. 58 39 26 33 62 62 33 22 62 62 62 62 62 47 62 62 62 62 47 47 62 62 47 62 56 56 44 34 34 51 27 44 43 33 38 28 38 20 28 43 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 56 54 54 59 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 59 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 49 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 62 45 56 62 54 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 54 43 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 54 62 62 47 62 62 62 62 62 62 54 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 62 62 52 62 45 58 52 52 52 52 54 54 54 52 48 42 36 35 42 13 13 9 13 15 16 54 54 54 58 58 42 39 58 58 58 58 54 52 58 34 58 54 58 58 58 58 41 46 52 58 58 39 41 49 42 52 54 52 52 52 46 54 19 41 54 52 54 52 48 58 54 54 54 58 52 45 33 43 43 54 54 54 52 54 34 27 54 58 54 52 52 52 37 40 38 32 45 49 36 51 50 41 36 51 54 51 51 40 53 38 58 40 50 30 58 50 49 39 58 52 53 58 51 45 46 53 52 45 49 36 58 37 39 50 42 42 41 54 50 32 51 54 53 52 58 54 58 37 58 27 50 41 33 39 38 28 51 42 39 46 50 49 19 31 32 39 46 39 39 32 37 25 19 58 49 39 46 54 49 52 41 54 58 58 33 40 20 50 58 35 22 49 50 29 58 44 25 25 37 25 29 39 32 31 41 39 40 44 24 37 32 38 39 35 33 39 30 53 42 51 32 53 52 52 31 42 40 39 23 44 29 41 21 25 36 16 47 21 22 28 54 32 38 29 34 27 39 28 54 53 21 7 46 33 41 52 45 31 54 32 41 46 9 10 54 21 15 33 52 16 40 23 17 16 24 26 39 20 41 33 34 42 28 41 31 32 28 32 27 41 28 35 11 45 39 28 53 15 34 29 33 32 35 34 23 52 26 28 39 29 22 32 19 22 31 31 32 47 13 29 24 28 31 31 10 51 9 33 8 18 32 31 12 30 34 35 45 10 51 45 51 21 12 28 23 36 31 30 29 23 6 32 21 18 9 28 13 15 8 16 6 10 23 24 18 19 29 31 31 26 22 46 14 13 28 20 22 24 30 19 25 10 9 22 26 32 18 33 22 17 27 7 12 32 10 6 12 16 7 24 13 32 27 13 15 27 32 21 26 14 17 32 33 11 6 13 9 7 20 30 12 27 27 15 31 25 17 13 24 17 17 14 10 19 16 24 25 25 9 17 16 30 24 34 23 11 22 8 6 32 13 21 21 10 23 14 20 30 8 31 34 13 32 36 20 19 33 11 6 17 6 39 37 31 13 19 26 34 15 11 8 5 6 6 28 19 14 32 7 12 19 27 9 11 23 28 24	Open. Hide. 62 47 51 59 62 62 59 59 51 32 32 32 36 24 25 28 44 49 59 62 62 62 62 62 62 59 62 59 62 62 59 62 62 54 62 62 62 62 62 59 59 62 62 62 59 59 62 59 62 59 62 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 56 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 44 62 56 56 62 62 62 62 62 62 56 43 54 62 62 62 62 62 62 62 47 56 56 56 56 56 56 56 56 56 56 56 62 62 62 62 62 56 56 56 62 54 62 56 62 62 62 56 47 37 54 56 56 47 47 41 36 56 47 62 47 42 56 56 56 56 62 62 62 54 62 56 56 56 56 38 47 56 62 62 54 33 48 43 54 42 62 52 62 39 62 62 52 62 52 42 62 62 52 52 62 41 38 62 62 51 54 62 41 42 52 47 62 43 62 62 46 62 54 62 42 54 47 58 58 54 46 54 49 52 54 47 54 41 45 41 52 52 42 39 58 54 58 58 58 54 58 49 41 52 31 58 39 46 54 45 30 39 54 54 54 52 54 49 45 37 9 54 24 36 39 34 33 49 52 52 58 30 35 54 54 42 58 58 52 42 36 28 45 35 47 54 54 20 41 42 54 30 42 25 26 42 45 52 54 58 28 48 52 31 41 50 45 27 58 40 50 28 51 47 46 33 29 46 53 32 52 39 50 37 30 30 32 53 50 53 41 24 46 51 31 32 53 53 30 50 46 42 47 15 50 19 37 34 17 22 15 6 26 26 53 39 46 32 34 35 10 25 31 12 28 52 53 37 36 33 50 29 35 29 16 19 12 42 16 26 7 38 46 23 32 26 9 12 6 19 11 53 11 25 39 33 30 10 40 22 33 22 47 38 13 33 26 39 26 28 24 16 18 32 25 47 12 15 38 35 40 22 47 32 37 22 15 16 26 21 19 24 9 16 27 27 17 22 21 32 16 11 16 17 9 10 11 15 18 18 18 32 6 32 21 13 8 30 6 19 39 28 33 25 50 24 12 31 16 11 6 9 21 19 7 23 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr18_36192384_36193433
seq2: B6Ng01-340D12.b_46_1107 (reverse)

seq1  CTTCTTACCT-GCCTGGTGCCCCTCGGG-AAGCCAGAACTGTAGC-TTCC  47
      |||||||||| ||||||||||||||||| |||||||||||||||| ||||
seq2  CTTCTTACCTAGCCTGGTGCCCCTCGGGAAAGCCAGAACTGTAGCTTTCC  50

seq1  AGGTGCCAGGCAGGCAGACTT-ATTATG-GGATACAAGTTCCTGGT-GTC  94
      ||||||||||||||||||||| || ||| ||||||||||||||||| |||
seq2  AGGTGCCAGGCAGGCAGACTTAATAATGAGGATACAAGTTCCTGGTGGTC  100

seq1  ACTCCTCCAGG-CCCCATGG-AAGGATTC-TCTCCA-GGACTCTGGGCAA  140
      ||||||||||| |||||||| |||||||| |||| | |||||||||||||
seq2  ACTCCTCCAGGCCCCCATGGAAAGGATTCTTCTCAAGGGACTCTGGGCAA  150

seq1  GTTTCCTTCTCTA-TGGAACAGCTCCCAGAACACTCAAAGTAGAATTCTG  189
      ||||||||||||| || |||||||||||||||||||||||||||| ||||
seq2  GTTTCCTTCTCTATTGAAACAGCTCCCAGAACACTCAAAGTAGAAATCTG  200

seq1  CTAGGCTGTTCTCACACTGTGTGCTC-AGGACCAAAGGGACCTGGGAGGT  238
      |||||||||||||||||||||||||| || ||||||||||||||||||||
seq2  CTAGGCTGTTCTCACACTGTGTGCTCAAGAACCAAAGGGACCTGGGAGGT  250

seq1  ATTTGATCTGCTCTCTCAGAGAGAGAGATCTGTGGTCCAGTGTGTTTGGG  288
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTGATCTGCTCTCTCAGAGAGAGAGATCTGTGGTCCAGTGTGTTTGGG  300

seq1  AAATCCATCCCCCAGGGTTCCTGTAGAGTGGCAGTCTCCATTAGCAGAGG  338
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCCATCCCCCAGGGTTCCTGTAGAGTGGCAGTCTCCATTAGCAGAGG  350

seq1  AGATAATAACTGAACTAGACAAACTTATTTGGCCTAGGAAGTCTTGTTTG  388
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAATAACTGAACTAGACAAACTTATTTGGCCTAGGAAGTCTTGTTTG  400

seq1  TGTATTTTGAGACAGGGTCTCGTGCTATAGCTCTGGCTGTCTGGGAACAG  438
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTTTGAGACAGGGTCTCGTGCTATAGCTCTGGCTGTCTGGGAACAG  450

seq1  AAGGCACTTTTTAGAGGGTATACTTTGGAGAAGGCTGCCTGCCCTAAGGC  488
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCACTTTTTAGAGGGTATACTTTGGAGAAGGCTGCCTGCCCTAAGGC  500

seq1  AGTAGGTGTGAGGAAAACTAAGTGGGGGACTGGAGAGCTGGAGGAGAGGT  538
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGGTGTGAGGAAAACTAAGTGGGGGACTGGAGAGCTGGAGGAGAGGT  550

seq1  GGAGTTGCTAGCGTCCCACAGCTGCCTTCCTGACACCTGGTTCGGGGAAA  588
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTTGCTAGCGTCCCACAGCTGCCTTCCTGACACCTGGTTCGGGGAAA  600

seq1  CTTAGAGCAGCCTAACCGGGACCCTGTTGTGTACAGGAGCCGGCTGGAAG  638
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGAGCAGCCTAACCGGGACCCTGTTGTGTACAGGAGCCGGCTGGAAG  650

seq1  CCAGCCTTGGCCTGCCTGCCCTGGGACCTGTTCTTCCACTGTGGCCGGGC  688
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCTTGGCCTGCCTGCCCTGGGACCTGTTCTTCCACTGTGGCCGGGC  700

seq1  TTTGTCCTGGCTCCGACCTGGATCTCCTCAAATCTTGACTCCCTTGCTGG  738
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTCCTGGCTCCGACCTGGATCTCCTCAAATCTTGACTCCCTTGCTGG  750

seq1  TCCCAGGCACCACCCACCCCCTTCTCCCTGACCCTGTCATACCCTCAAGG  788
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGGCACCACCCACCCCCTTCTCCCTGACCCTGTCATACCCTCAAGG  800

seq1  TACACTTCCTTCTGGTCTCTGGCTGCCACCTCTCCCCTTAAGCAAGTCCC  838
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACTTCCTTCTGGTCTCTGGCTGCCACCTCTCCCCTTAAGCAAGTCCC  850

seq1  AGTTTCGTAGATTTCTAGGAGACATGCCCAGTCCTGTGCTTTCTTCTGAA  888
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTCGTAGATTTCTAGGAGACATGCCCAGTCCTGTGCTTTCTTCTGAA  900

seq1  CCCCAGGAAGGCGAGTCACCTGAGAGAAGCTCACAGACAGGGCTGAGCTA  938
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAGGAAGGCGAGTCACCTGAGAGAAGCTCACAGACAGGGCTGAGCTA  950

seq1  ACCCTTAGACATGGATGTCTTCAGGGTCTGCTGCCCTGGCCTGCCGTTCC  988
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTTAGACATGGATGTCTTCAGGGTCTGCTGCCCTGGCCTGCCGTTCC  1000

seq1  TTAGGAGCTAGGGAAGCCCCTCGGTCCCAGGTCACTGTGCAACATTAGCC  1038
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGAGCTAGGGAAGCCCCTCGGTCCCAGGTCACTGTGCAACATTAGCC  1050

seq1  AACCTGGAATTC  1050
      ||||||||||||
seq2  AACCTGGAATTC  1062

seq1: chr18_36065604_36066462
seq2: B6Ng01-340D12.g_68_930

seq1  GAATTCTCTTTGTAGCTAATCCCTGAGAAACTGCCTCTGACTCCCAGATC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTTTGTAGCTAATCCCTGAGAAACTGCCTCTGACTCCCAGATC  50

seq1  ATAAGATGGTAGTAGAAAATATTTAATATCCCAGCCCAGGATTTCTACCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGATGGTAGTAGAAAATATTTAATATCCCAGCCCAGGATTTCTACCC  100

seq1  CGTCTTTGGTTATTGAGTTCCCAGATAAAAAACACACTCACAGCCTTTAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTCTTTGGTTATTGAGTTCCCAGATAAAAAACACACTCACAGCCTTTAT  150

seq1  ATTTACAATTCGCCTTAAGCAGCACAATAGCTGGGCAGCTGACCACCCTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTACAATTCGCCTTAAGCAGCACAATAGCTGGGCAGCTGACCACCCTC  200

seq1  CATGCCGTCAGAATCTACTTTCCTATTGATAACCCCGAGTTATTACTTCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCCGTCAGAATCTACTTTCCTATTGATAACCCCGAGTTATTACTTCC  250

seq1  TATTTTATATGTTCCATCTGGGCTGCTCTTAACTCCTATTGGGCAGCTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTATATGTTCCATCTGGGCTGCTCTTAACTCCTATTGGGCAGCTCT  300

seq1  CAGGACCACGTTTTTATGGCTCAGCTAACCTTTGGTGATTTCTCTTTTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACCACGTTTTTATGGCTCAGCTAACCTTTGGTGATTTCTCTTTTCT  350

seq1  CCTCTGCTGTAAGGATCATCGCCTATGCCACCACACCTTAGGCAGTTGGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGCTGTAAGGATCATCGCCTATGCCACCACACCTTAGGCAGTTGGC  400

seq1  TTGCTTATTTGTTTTGGTTTTGGAGATGGGGCCTCACATAGCCCAGGATA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTATTTGTTTTGGTTTTGGAGATGGGGCCTCACATAGCCCAGGATA  450

seq1  CCTTGAAACTCTCTAGGTGGCCAAAAATGACCTTGAACTCCTGGTCCTCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGAAACTCTCTAGGTGGCCAAAAATGACCTTGAACTCCTGGTCCTCC  500

seq1  TACCTCTCTCTACCTCTCAAGTGCTGAGATTACAGCCATGCGCCATGGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTCTCTCTACCTCTCAAGTGCTGAGATTACAGCCATGCGCCATGGTG  550

seq1  CCCGGATCTTTAAGGTGCTGAAGACAGAATCCAACATGCTAGACTCCAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGGATCTTTAAGGTGCTGAAGACAGAATCCAACATGCTAGACTCCAGC  600

seq1  ATCTGAGCTACACACACCCAACTAGCTCTATTTAAATTGTTTGCTA-TTC  649
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  ATCTGAGCTACACACACCCAACTAGCTCTATTTAAATTGTTTGCTATTTC  650

seq1  TTAAAGAGTTATTTCTGCCTTGATATGTATGTATGAGTGTTTGTCTGTGT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGAGTTATTTCTGCCTTGATATGTATGTATGAGTGTTTGTCTGTGT  700

seq1  GTATGTATGTGCACTGCATGTATGTGTGAGTACCACGTGTGTGCAATGCA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGTATGTGCACTGCATGTATGTGTGAGTACCACGTGTGTGCAATGCA  750

seq1  CTGCATGCCCAGGAGGCCAGAAGAGG-TTGTTGGATCTTTTGGAACTGGA  798
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CTGCATGCCCAGGAGGCCAGAAGAGGTTTGTTGGATCTTTTGGAACTGGA  800

seq1  GTTATGAGATGGTTGTGAGCTGTT-GGGAATTGAACA-TGGGTCCTCTAG  846
      |||||||||||||||||||||||| |||||||||||| |||| |||||||
seq2  GTTATGAGATGGTTGTGAGCTGTTGGGGAATTGAACATTGGGCCCTCTAG  850

seq1  AAGAGCAGCCAGT  859
      |||||||||||||
seq2  AAGAGCAGCCAGT  863

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information