MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-010B05
Chromosome	19 (Build37)
Map Location	6,948,703 - 7,109,251
singlet/doublet	doublet
Overlap gene	Prdx5, 0610038D11Rik, Esrra, 1700019N12Rik, Kcnk4, Gpr137, Bad, Plcb3, Ppp1r14b, Fkbp2, Vegfb, Dnajc4, Nudt22, Trpt1, BC032204, Stip1
Upstream gene	Pola2, Slc22a20, Capn1, EG666300, Syvn1, Mrpl49, Fau, Znhit2, Tm7sf2, 1110014N23Rik, LOC100039773, Zfpl1, Cdca5, Gm550, Naaladl1, Sac3d1, Snx15, Arl2, EG433216, Batf2, LOC622554, Gpha2, Ppp2r5b, 1810013C15Rik, Ehd1, Cdc42bpg, Men1, Map4k2, Sf1, Pygm, Rasgrp2, Nrxn2, Slc22a12, LOC629372, Rps6ka4, Ccdc88
Downstream gene	D930010J01Rik, Flrt1, Otub1, Cox8a, Nat11, Rcor2, Mark2, AI846148, EG665419, 2700081O15Rik, Rtn3, LOC100039547, 5730596K20Rik, Hrasls3, Lgals12, Hrasls5, LOC433217, Slc22a19, LOC666543, BC014805, LOC632903, AB056442, LOC620946, LOC623030, 9530053H05Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pola2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18969 MGI:99690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381203 MGI:2685809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12333 MGI:88263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666300 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666300 MGI:3644144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Syvn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74126 MGI:1921376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18120 MGI:108180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fau (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14109 MGI:102547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znhit2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29805 MGI:1352481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm7sf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73166 MGI:1920416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110014N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68505 MGI:1915755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039773 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Zfpl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81909 MGI:1891017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdca5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67849 MGI:1915099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225852 MGI:2685396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Naaladl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381204 MGI:2685810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sac3d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66406 MGI:1913656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69024 MGI:1916274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56327 MGI:1928393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433216 MGI:3648472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 179 ESTs, 5 Proteins

name	Batf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74481 MGI:1921731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622554 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Gpha2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170458 MGI:2156541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225849 MGI:2388480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810013C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329015 MGI:1916291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ehd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13660 MGI:1341878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42bpg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240505 MGI:2652845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 20 Proteins

name	Men1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17283 MGI:1316736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map4k2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26412 MGI:1346883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22668 MGI:1095403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pygm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19309 MGI:97830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasgrp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19395 MGI:1333849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrxn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18190 MGI:1096362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20521 MGI:1195269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629372
definition	note : high mobility group protein 1-like pseudo : _no_value

name	Rps6ka4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56613 MGI:1930076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78317 MGI:1925567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prdx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54683 MGI:1859821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610038D11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67674 MGI:1914924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Esrra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26379 MGI:1346831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700019N12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67077 MGI:1914327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16528 MGI:1298234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr137 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107173 MGI:2147529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12015 MGI:1096330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plcb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18797 MGI:104778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r14b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18938 MGI:107682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14227 MGI:95542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vegfb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22340 MGI:106199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57431 MGI:1927346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68323 MGI:1915573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107328 MGI:1333115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC032204 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108101 MGI:2147790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20867 MGI:109130
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D930010J01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107227 MGI:2147583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flrt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:396184 MGI:3026647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107260 MGI:2147616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12868 MGI:105959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nat11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70999 MGI:1918249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 349 ESTs, 3 Proteins

name	Rcor2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104383 MGI:1859854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mark2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13728 MGI:99638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	AI846148 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68229 MGI:2147611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665419 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665419 MGI:3643959
definition	note : predicted gene, EG665419 pseudo : _no_value

name	2700081O15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108899 MGI:1919667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20168 MGI:1339970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC100039547 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	5730596K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109168 MGI:1924270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hrasls3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225845 MGI:2179715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56072 MGI:1929094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hrasls5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66727 MGI:1913977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 101 ESTs, 8 Proteins

name	Slc22a19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207151 MGI:2442751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 10 Proteins pseudo : _no_value

name	BC014805 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236149 MGI:2385316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	AB056442 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171405 MGI:3042283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 14 Proteins

name	LOC620946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 382 ESTs, 22 Proteins pseudo : _no_value

name	LOC623030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	9530053H05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78425 MGI:1925675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Pola2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982106 GeneID:18969 MGI:99690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), alpha 2 transcript_id : NM_008893.2

name	Slc22a20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130881 GeneID:381203 MGI:2685809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion transporter), member 20 transcript_id : NM_198650.2

name	Capn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982478 GeneID:12333 MGI:88263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 1 transcript_id : NM_007600.2

name	EG666300 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405708 GeneID:666300 MGI:3644144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG666300 transcript_id : XM_982884.1

name	Syvn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254387 GeneID:74126 MGI:1921376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial apoptosis inhibitor 1, synoviolin transcript_id : NM_028769.4

name	Mrpl49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354540 GeneID:18120 MGI:108180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L49 transcript_id : NM_026246.2

name	Fau (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679752 GeneID:14109 MGI:102547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived) transcript_id : NM_007990.1

name	Znhit2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676553 GeneID:29805 MGI:1352481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, HIT domain containing 2 transcript_id : NM_013859.2

name	Tm7sf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117414163 GeneID:73166 MGI:1920416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 7 superfamily member 2 transcript_id : NM_028454.2

name	1110014N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486661 GeneID:68505 MGI:1915755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110014N23 gene transcript_id : NM_001081041.1

name	LOC100039773 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270261 GeneID:100039773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039773 transcript_id : XM_001473483.1

name	Zfpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130277 GeneID:81909 MGI:1891017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger like protein 1 transcript_id : NM_024231.2

name	Cdca5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803003 GeneID:67849 MGI:1915099
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle associated 5 transcript_id : NM_026410.2

name	Gm550 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405710 GeneID:225852 MGI:2685396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : gene model 550, (NCBI) transcript_id : XM_148894.7

name	Naaladl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222281 GeneID:381204 MGI:2685810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylated alpha-linked acidic dipeptidase-like 1 transcript_id : NM_001009546.1

name	Sac3d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508434 GeneID:66406 MGI:1913656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAC3 domain containing 1 transcript_id : NM_133678.3

name	Snx15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794429 GeneID:69024 MGI:1916274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 15 transcript_id : NM_026912.1

name	Arl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129285 GeneID:56327 MGI:1928393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 2 transcript_id : NM_019722.3

name	EG433216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405711 GeneID:433216 MGI:3648472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 179 ESTs, 5 Proteins product : predicted gene, EG433216 transcript_id : XM_484764.3

name	Batf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077032 GeneID:74481 MGI:1921731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic leucine zipper transcription factor, ATF-like 2 transcript_id : NM_028967.1

name	LOC622554 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94405713 GeneID:622554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical LOC622554 transcript_id : XM_886988.2

name	Gpha2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475777 GeneID:170458 MGI:2156541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein hormone alpha 2 transcript_id : NM_130453.2

name	Ppp2r5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364854 GeneID:225849 MGI:2388480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), beta isoform transcript_id : NM_198168.3

name	1810013C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112382277 GeneID:329015 MGI:1916291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810013C15 gene transcript_id : NM_194348.3

name	Ehd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359457 GeneID:13660 MGI:1341878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EH-domain containing 1 transcript_id : NM_010119.4

name	Cdc42bpg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270271 GeneID:240505 MGI:2652845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 20 Proteins product : CDC42 binding protein kinase gamma (DMPK-like) transcript_id : XM_140553.7

name	Men1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678857 GeneID:17283 MGI:1316736
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : multiple endocrine neoplasia 1 transcript_id : NM_008583.1

name	Map4k2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130565 GeneID:26412 MGI:1346883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase kinase 2 transcript_id : NM_009006.2

name	Sf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106450 GeneID:22668 MGI:1095403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 1 transcript_id : NM_011750.1

name	Pygm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755255 GeneID:19309 MGI:97830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : muscle glycogen phosphorylase transcript_id : NM_011224.1

name	Rasgrp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131888393 GeneID:19395 MGI:1333849
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS, guanyl releasing protein 2 transcript_id : NM_011242.2

name	Nrxn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62243517 GeneID:18190 MGI:1096362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexin II transcript_id : NM_020253.2

name	Slc22a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982004 GeneID:20521 MGI:1195269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion/cation transporter), member 12 transcript_id : NM_009203.2

name	Rps6ka4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910453 GeneID:56613 MGI:1930076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase, polypeptide 4 transcript_id : NM_019924.1

name	Ccdc88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486838 GeneID:78317 MGI:1925567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 88 transcript_id : NM_001081291.1

name	Prdx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129958 GeneID:54683 MGI:1859821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxiredoxin 5 transcript_id : NM_012021.2

name	0610038D11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098119 GeneID:67674 MGI:1914924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610038D11 gene transcript_id : NM_026306.2

name	Esrra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293261 GeneID:26379 MGI:1346831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : estrogen related receptor, alpha transcript_id : NM_007953.2

name	1700019N12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373966 GeneID:67077 MGI:1914327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700019N12 gene transcript_id : NM_001039494.2

name	Kcnk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803210 GeneID:16528 MGI:1298234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily K, member 4 transcript_id : NM_008431.2

name	Gpr137 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402190 GeneID:107173 MGI:2147529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 137 transcript_id : NM_207220.1

name	Bad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892666 GeneID:12015 MGI:1096330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl-associated death promoter transcript_id : NM_007522.2

name	Plcb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130639 GeneID:18797 MGI:104778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, beta 3 transcript_id : NM_008874.3

name	Ppp1r14b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62122945 GeneID:18938 MGI:107682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 14B transcript_id : NM_008889.2

name	Fkbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254639 GeneID:14227 MGI:95542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 2 transcript_id : NM_008020.2

name	Vegfb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372406 GeneID:22340 MGI:106199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vascular endothelial growth factor B transcript_id : NM_011697.2

name	Dnajc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181195 GeneID:57431 MGI:1927346
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 4 transcript_id : NM_020566.1

name	Nudt22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367573 GeneID:68323 MGI:1915573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 22 transcript_id : NM_026675.2

name	Trpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956403 GeneID:107328 MGI:1333115
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA phosphotransferase 1 transcript_id : NM_153597.1

name	BC032204 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418902 GeneID:108101 MGI:2147790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC032204 transcript_id : NM_153795.1

name	Stip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14389430 GeneID:20867 MGI:109130
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stress-induced phosphoprotein 1 transcript_id : NM_016737.1

name	D930010J01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803412 GeneID:107227 MGI:2147583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D930010J01 gene transcript_id : NM_134147.3

name	Flrt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41351536 GeneID:396184 MGI:3026647
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin leucine rich transmembrane protein 3 transcript_id : NM_201411.1

name	Otub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129951 GeneID:107260 MGI:2147616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OTU domain, ubiquitin aldehyde binding 1 transcript_id : NM_134150.2

name	Cox8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84000428 GeneID:12868 MGI:105959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VIIIa transcript_id : NM_007750.2

name	Nat11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270330 GeneID:70999 MGI:1918249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 348 ESTs, 2 Proteins product : N-acetyltransferase 11 transcript_id : XM_001473047.1

name	Nat11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270332 GeneID:70999 MGI:1918249
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 279 ESTs, 1 Protein product : N-acetyltransferase 11 transcript_id : XM_001473067.1

name	Rcor2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357032 GeneID:104383 MGI:1859854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REST corepressor 2 transcript_id : NM_054048.2

name	Mark2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937354 GeneID:13728 MGI:99638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP/microtubule affinity-regulating kinase 2 transcript_id : NM_001080388.1

name	Mark2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937362 GeneID:13728 MGI:99638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP/microtubule affinity-regulating kinase 2 transcript_id : NM_001080389.1

name	Mark2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937358 GeneID:13728 MGI:99638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP/microtubule affinity-regulating kinase 2 transcript_id : NM_007928.2

name	Mark2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937356 GeneID:13728 MGI:99638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP/microtubule affinity-regulating kinase 2 transcript_id : NM_001080390.1

name	AI846148 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803489 GeneID:68229 MGI:2147611
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI846148 transcript_id : NM_001033139.2

name	2700081O15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129868 GeneID:108899 MGI:1919667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700081O15 gene transcript_id : NM_175381.5

name	Rtn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51511740 GeneID:20168 MGI:1339970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 3 transcript_id : NM_001003933.1

name	Rtn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607015 GeneID:20168 MGI:1339970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 3 transcript_id : NM_001003934.1

name	Rtn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51511742 GeneID:20168 MGI:1339970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 3 transcript_id : NM_053076.2

name	Rtn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51511738 GeneID:20168 MGI:1339970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 3 transcript_id : NM_001003930.1

name	LOC100039547 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270334 GeneID:100039547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to chromosome 4 open reading frame 16 transcript_id : XM_001473327.1

name	5730596K20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380963 GeneID:109168 MGI:1924270
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730596K20 gene transcript_id : NM_146091.3

name	Hrasls3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781796 GeneID:225845 MGI:2179715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HRAS like suppressor 3 transcript_id : NM_139269.2

name	Lgals12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365081 GeneID:56072 MGI:1929094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose binding, soluble 12 transcript_id : NM_019516.3

name	Hrasls5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803065 GeneID:66727 MGI:1913977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HRAS-like suppressor family, member 5 transcript_id : NM_025731.2

name	LOC433217 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270345 GeneID:433217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 101 ESTs, 8 Proteins product : similar to nitrogen fixation cluster-like transcript_id : XM_001473815.1

name	Slc22a19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450130 GeneID:207151 MGI:2442751
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion transporter), member 19 transcript_id : NM_144785.1

name	BC014805 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122800 GeneID:236149 MGI:2385316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC014805 transcript_id : NM_146232.1

name	AB056442 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405827 GeneID:171405 MGI:3042283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 13 Proteins product : cDNA sequence AB056442 transcript_id : XM_984546.1

name	Pola2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982107 CCDS:CCDS29485.1 GeneID:18969 MGI:99690
definition	GO_component : GO:0005658 - alpha DNA polymerase:primase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI] GO_process : GO:0006260 - DNA replication [Evidence IDA]; GO:0000060 - protein import into nucleus, translocation [Evidence IDA] codon_start : 1 note : DNA polymerase alpha 2, 68 kDa product : polymerase (DNA directed), alpha 2 protein_id : NP_032919.2

name	Slc22a20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348536 CCDS:CCDS29486.1 GeneID:381203 MGI:2685809
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008514 - organic anion transporter activity [Evidence NAS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0015711 - organic anion transport [Evidence NAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : SLC22 organic anion transporter; OAT1-like organic anion transporter product : solute carrier family 22 (organic anion transporter), member 20 protein_id : NP_941052.1

name	Capn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671668 GeneID:12333 MGI:88263
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence TAS]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mu-calpain product : calpain 1 protein_id : NP_031626.1

name	EG666300 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405709 GeneID:666300 MGI:3644144
definition	codon_start : 1 product : similar to thymosin, beta 10 protein_id : XP_987978.1

name	Syvn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254388 CCDS:CCDS29487.1 GeneID:74126 MGI:1921376
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0006986 - response to unfolded protein [Evidence ISS] codon_start : 1 exception : mismatches in translation product : synoviolin 1 protein_id : NP_083045.3

name	Mrpl49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385752 CCDS:CCDS29488.1 GeneID:18120 MGI:108180
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : neighbor of fau 1 product : mitochondrial ribosomal protein L49 protein_id : NP_080522.1

name	Fau (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679753 CCDS:CCDS29489.1 GeneID:14109 MGI:102547
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : monoclonal nonspecific suppressor factor betamonoclonal nonspecific suppressor factor beta product : Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived) protein_id : NP_032016.1

name	Znhit2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676554 GeneID:29805 MGI:1352481
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, HIT domain containing 2 protein_id : NP_038887.2

name	Tm7sf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117414164 CCDS:CCDS29490.1 GeneID:73166 MGI:1920416
definition	codon_start : 1 product : transmembrane 7 superfamily member 2 protein_id : NP_082730.2

name	1110014N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486662 GeneID:68505 MGI:1915755
definition	codon_start : 1 product : hypothetical protein LOC68505 protein_id : NP_001074510.1

name	LOC100039773 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270262 GeneID:100039773
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473533.1

name	Zfpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195658 CCDS:CCDS29492.1 GeneID:81909 MGI:1891017
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger like protein 1 protein_id : NP_077193.1

name	Cdca5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385902 CCDS:CCDS29493.1 GeneID:67849 MGI:1915099
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence ISS]; GO:0007067 - mitosis [Evidence IDA] [Evidence IEA]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0007080 - mitotic metaphase plate congression [Evidence ISS] codon_start : 1 note : sororin p35 product : cell division cycle associated 5 protein_id : NP_080686.1

name	Gm550 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28525884 GeneID:225852 MGI:2685396
definition	codon_start : 1 product : similar to Cell division cycle associated 5 protein_id : XP_148894.2

name	Naaladl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222282 CCDS:CCDS29494.1 GeneID:381204 MGI:2685810
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0043275 - glutamate carboxypeptidase II activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 function : protease product : N-acetylated-alpha-linked acidic dipeptidase like protein protein_id : NP_001009546.1

name	Sac3d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508435 GeneID:66406 MGI:1913656
definition	GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0051298 - centrosome duplication [Evidence IMP]; GO:0051227 - mitotic spindle assembly [Evidence IMP] codon_start : 1 note : Sac3 homology domain 1 product : SAC3 domain containing 1 protein_id : NP_598439.3

name	Snx15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794430 CCDS:CCDS29495.1 GeneID:69024 MGI:1916274
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : sorting nexin 15 protein_id : NP_081188.1

name	Arl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980988 CCDS:CCDS29496.1 GeneID:56327 MGI:1928393
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : arf-like protein 2; ADP-ribosylation-like 2 product : ADP-ribosylation factor-like 2 protein_id : NP_062696.2

name	EG433216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270270 GeneID:433216 MGI:3648472
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484764.4

name	Batf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077033 CCDS:CCDS29497.1 GeneID:74481 MGI:1921731
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : basic leucine zipper transcription factor, ATF-like 2 protein_id : NP_083243.1

name	LOC622554 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94405714 GeneID:622554
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892081.2

name	Gpha2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18485506 CCDS:CCDS29498.1 GeneID:170458 MGI:2156541
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : glycoprotein hormone alpha 2 protein_id : NP_569720.1

name	Ppp2r5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718993 CCDS:CCDS29499.1 GeneID:225849 MGI:2388480
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein phosphatase 2, regulatory subunit B (B56), beta isoform protein_id : NP_937811.1

name	1810013C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62243857 CCDS:CCDS29500.1 GeneID:329015 MGI:1916291
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC329015 protein_id : NP_919329.2

name	Ehd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106303 CCDS:CCDS29501.1 GeneID:13660 MGI:1341878
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0005768 - endosome [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IDA]; GO:0016197 - endosome transport [Evidence IDA] codon_start : 1 function : suggested to be involved in regulated endocytosis product : EH-domain containing 1 protein_id : NP_034249.1

name	Cdc42bpg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270272 GeneID:240505 MGI:2652845
definition	codon_start : 1 product : CDC42 binding protein kinase gamma (DMPK-like) protein_id : XP_140553.6

name	Men1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678858 CCDS:CCDS29502.1 GeneID:17283 MGI:1316736
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0016571 - histone methylation [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS] codon_start : 1 product : menin protein_id : NP_032609.1

name	Map4k2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678800 CCDS:CCDS29503.1 GeneID:26412 MGI:1346883
definition	GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0006903 - vesicle targeting [Evidence IDA] codon_start : 1 note : RAB8 interacting protein product : mitogen activated protein kinase kinase kinase kinase 2 protein_id : NP_033032.1

name	Sf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106451 GeneID:22668 MGI:1095403
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 162 protein_id : NP_035880.1

name	Pygm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755256 CCDS:CCDS29504.1 GeneID:19309 MGI:97830
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008184 - glycogen phosphorylase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004645 - phosphorylase activity [Evidence IEA]; GO:0030170 - pyridoxal phosphate binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005980 - glycogen catabolism [Evidence IDA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 product : muscle glycogen phosphorylase protein_id : NP_035354.1

name	Rasgrp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131888394 GeneID:19395 MGI:1333849
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence ISS]; GO:0019992 - diacylglycerol binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005088 - Ras guanyl-nucleotide exchange factor activity [Evidence ISS] GO_process : GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : RAP 1A protein-specific guanine nucleotide exchange factor 1; CalDAG-GEFI; F25B3.3 kinase like protein product : RAS, guanyl releasing protein 2 protein_id : NP_035372.2

name	Nrxn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62243518 GeneID:18190 MGI:1096362
definition	GO_component : GO:0042734 - presynaptic membrane [Evidence ISS] GO_function : GO:0005246 - calcium channel regulator activity [Evidence IGI] GO_process : GO:0007269 - neurotransmitter secretion [Evidence IGI]; GO:0007268 - synaptic transmission [Evidence IGI]; GO:0007416 - synaptogenesis [Evidence IGI] codon_start : 1 note : neurexin II beta; neurexin II alpha product : neurexin II protein_id : NP_064649.2

name	Slc22a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982005 CCDS:CCDS29505.1 GeneID:20521 MGI:1195269
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence ISS]; GO:0031526 - brush border membrane [Evidence IDA] [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IDA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0030165 - PDZ domain binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0015143 - urate transporter activity [Evidence ISS] [Evidence IDA] GO_process : GO:0019725 - cell homeostasis [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0015747 - urate transport [Evidence ISS] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : solute carrier family 22 (organic cation transporter)-like 2 product : solute carrier family 22 (organic anion/cation transporter), member 12 protein_id : NP_033229.2

name	Rps6ka4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910454 GeneID:56613 MGI:1930076
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0048273 - mitogen-activated protein kinase p38 binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004711 - ribosomal protein S6 kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS] codon_start : 1 exception : mismatches in translation note : mitogen- and stress-activated protein kinase-2; ribosomal protein S6 kinase, 90kD, polypeptide 4 product : ribosomal protein S6 kinase, polypeptide 4 protein_id : NP_064308.1

name	Ccdc88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486839 GeneID:78317 MGI:1925567
definition	codon_start : 1 product : coiled-coil domain containing 88 protein_id : NP_001074760.1

name	Prdx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755114 CCDS:CCDS29507.1 GeneID:54683 MGI:1859821
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA]; GO:0051920 - peroxiredoxin activity [Evidence IEA] GO_process : GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 note : peroxiredoxin 6; peroxiredoxin V; peroxisomal membrane protein 20 product : peroxiredoxin 5 precursor protein_id : NP_036151.1

name	0610038D11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098120 CCDS:CCDS29508.1 GeneID:67674 MGI:1914924
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67674 protein_id : NP_080582.2

name	Esrra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293262 CCDS:CCDS29509.1 GeneID:26379 MGI:1346831
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : estrogen receptor related 1 product : estrogen related receptor, alpha protein_id : NP_031979.2

name	1700019N12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:95772156 CCDS:CCDS29510.1 GeneID:67077 MGI:1914327
definition	codon_start : 1 product : hypothetical protein LOC67077 protein_id : NP_001034583.1

name	Kcnk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680540 CCDS:CCDS29511.1 GeneID:16528 MGI:1298234
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : TRAAK protein_id : NP_032457.1

name	Gpr137 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402191 CCDS:CCDS29512.1 GeneID:107173 MGI:2147529
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : G protein-coupled receptor TM7SF1L1 product : expressed sequence AI428855 protein_id : NP_997103.1

name	Bad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671610 CCDS:CCDS29513.1 GeneID:12015 MGI:1096330
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006007 - glucose catabolism [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence IMP]; GO:0045579 - positive regulation of B cell differentiation [Evidence IMP]; GO:0045582 - positive regulation of T cell differentiation [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IMP] codon_start : 1 product : Bcl-associated death promoter protein_id : NP_031548.1

name	Plcb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982122 GeneID:18797 MGI:104778
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004435 - phosphoinositide phospholipase C activity [Evidence IEA]; GO:0004629 - phospholipase C activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : phospholipase C, beta 3 protein_id : NP_032900.2

name	Ppp1r14b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62122946 CCDS:CCDS29514.1 GeneID:18938 MGI:107682
definition	GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] codon_start : 1 note : phospholipase c neighboring product : protein phosphatase 1, regulatory (inhibitor) subunit 14B protein_id : NP_032915.2

name	Fkbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679805 CCDS:CCDS29515.1 GeneID:14227 MGI:95542
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : FK506 binding protein 2 (13 kDa) product : FK506 binding protein 2 protein_id : NP_032046.1

name	Vegfb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755969 CCDS:CCDS29516.1 GeneID:22340 MGI:106199
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : vascular endothelial growth factor B protein_id : NP_035827.1

name	Dnajc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181196 GeneID:57431 MGI:1927346
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : multiple endocrine neoplasia type 1 candidate protein 18 product : heat shock 40kD protein 2 protein_id : NP_065591.1

name	Nudt22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311969 CCDS:CCDS29517.1 GeneID:68323 MGI:1915573
definition	codon_start : 1 product : nudix (nucleoside diphosphate linked moiety X)-type motif 22 protein_id : NP_080951.1

name	Trpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956404 GeneID:107328 MGI:1333115
definition	codon_start : 1 note : EST-MNCb3719; tRNA splicing 2' phosphotransferase 1 homolog product : tRNA splicing 2' phosphotransferase 1 protein_id : NP_705825.1

name	BC032204 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418903 CCDS:CCDS29518.1 GeneID:108101 MGI:2147790
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008665 - 2'-phosphotransferase activity [Evidence IGI] [Evidence IDA]; GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006388 - tRNA splicing [Evidence IGI] codon_start : 1 product : UNC-112 related protein 2 protein_id : NP_722490.1

name	Stip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14389431 GeneID:20867 MGI:109130
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : stress-inducible protein; IEF SSP 3521; Hsp70/Hsp90 organizing protein product : stress-induced phosphoprotein 1 protein_id : NP_058017.1

name	D930010J01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527384 GeneID:107227 MGI:2147583
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : LRP16 protein protein_id : NP_598908.1

name	Flrt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41351537 CCDS:CCDS29519.1 GeneID:396184 MGI:3026647
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : fibronectin leucine rich transmembrane protein 1 product : fibronectin leucine rich transmembrane protein 3 protein_id : NP_958813.1

name	Otub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527388 CCDS:CCDS29520.1 GeneID:107260 MGI:2147616
definition	GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : otubain 1 protein_id : NP_598911.1

name	Cox8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680993 CCDS:CCDS29521.1 GeneID:12868 MGI:105959
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : COX VIII-L product : cytochrome c oxidase, subunit VIIIa protein_id : NP_031776.1

name	Nat11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270333 GeneID:70999 MGI:1918249
definition	codon_start : 1 product : N-acetyltransferase 11 protein_id : XP_001473117.1

name	Nat11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270331 GeneID:70999 MGI:1918249
definition	codon_start : 1 product : N-acetyltransferase 11 protein_id : XP_001473097.1

name	Rcor2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17298682 CCDS:CCDS29522.1 GeneID:104383 MGI:1859854
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : co-repressor of Rest; Rest co-repressor; RE1-silencing transcription factor (REST) co-repressor 1; REST co-repressor 2 product : REST corepressor 2 protein_id : NP_473389.1

name	Mark2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937355 GeneID:13728 MGI:99638
definition	GO_component : GO:0045180 - basal cortex [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045197 - establishment and/or maintenance of epithelial cell polarity [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ELKL motif kinase product : MAP/microtubule affinity-regulating kinase 2 isoform 2 protein_id : NP_001073857.1

name	Mark2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937363 GeneID:13728 MGI:99638
definition	GO_component : GO:0045180 - basal cortex [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045197 - establishment and/or maintenance of epithelial cell polarity [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; ELKL motif kinase product : MAP/microtubule affinity-regulating kinase 2 isoform 3 protein_id : NP_001073858.1

name	Mark2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937359 GeneID:13728 MGI:99638
definition	GO_component : GO:0045180 - basal cortex [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045197 - establishment and/or maintenance of epithelial cell polarity [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ELKL motif kinase product : MAP/microtubule affinity-regulating kinase 2 isoform 1 protein_id : NP_031954.2

name	Mark2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937357 GeneID:13728 MGI:99638
definition	GO_component : GO:0045180 - basal cortex [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045197 - establishment and/or maintenance of epithelial cell polarity [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; ELKL motif kinase product : MAP/microtubule affinity-regulating kinase 2 isoform 4 protein_id : NP_001073859.1

name	AI846148 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701646 CCDS:CCDS29523.1 GeneID:68229 MGI:2147611
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68229 protein_id : NP_001028311.1

name	2700081O15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254300 CCDS:CCDS29524.1 GeneID:108899 MGI:1919667
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC108899 protein_id : NP_780590.2

name	Rtn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716353 CCDS:CCDS29526.1 GeneID:20168 MGI:1339970
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; Nsp-like II product : reticulon 3 isoform 4 protein_id : NP_444306.1

name	Rtn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51511741 CCDS:CCDS29525.1 GeneID:20168 MGI:1339970
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Nsp-like II product : reticulon 3 isoform 2 protein_id : NP_001003933.1

name	Rtn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51511739 GeneID:20168 MGI:1339970
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; Nsp-like II product : reticulon 3 isoform 3 protein_id : NP_001003930.1

name	Rtn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607016 GeneID:20168 MGI:1339970
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Nsp-like II product : reticulon 3 isoform 1 protein_id : NP_001003934.1

name	LOC100039547 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270335 GeneID:100039547
definition	codon_start : 1 product : similar to chromosome 4 open reading frame 16 protein_id : XP_001473377.1

name	5730596K20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559920 CCDS:CCDS29527.1 GeneID:109168 MGI:1924270
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC109168 protein_id : NP_666203.2

name	Hrasls3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781797 CCDS:CCDS29528.1 GeneID:225845 MGI:2179715
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : HRAS like suppressor 3 protein_id : NP_644675.2

name	Lgals12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506757 CCDS:CCDS29529.1 GeneID:56072 MGI:1929094
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0030395 - lactose binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008629 - induction of apoptosis by intracellular signals [Evidence ISS] codon_start : 1 note : galectin-related inhibitor of proliferation; galectin-related inhibitor of proliferation 1; galectin-12 product : lectin, galactose binding, soluble 12 protein_id : NP_062389.1

name	Hrasls5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313354 CCDS:CCDS29530.1 GeneID:66727 MGI:1913977
definition	codon_start : 1 product : HRAS-like suppressor family, member 5 protein_id : NP_080007.1

name	LOC433217 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270346 GeneID:433217
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473865.1

name	Slc22a19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450131 CCDS:CCDS29532.1 GeneID:207151 MGI:2442751
definition	codon_start : 1 note : solute carrier family 22 (organic cation transporter), member 19 product : solute carrier family 22 (organic anion transporter), member 19 protein_id : NP_659034.1

name	BC014805 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122801 CCDS:CCDS29533.1 GeneID:236149 MGI:2385316
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC236149 protein_id : NP_666344.1

name	AB056442 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270337 GeneID:171405 MGI:3042283
definition	codon_start : 1 product : organic anion transporter 6 protein_id : XP_989640.2

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 10 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 9 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 8 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 7 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 6 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 5 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 4 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 3 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 2 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 1 pseudo : _no_value

name	LOC623030 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623030
definition	number : 1 pseudo : _no_value

name	LOC666543 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270336 GeneID:666543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_031235.1

name	LOC620946 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270338 GeneID:620946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 382 ESTs, 22 Proteins product : similar to hCG2043493 pseudo : _no_value transcript_id : XR_031281.1

name	9530053H05Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270339 GeneID:78425 MGI:1925675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 9530053H05 gene transcript_id : XR_035210.1

clone name	MSMg01-518C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535B20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-144P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-288O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523D22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-422K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-066B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-292M18
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-078H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064P03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-010B05.b	B6Ng01-010B05.g
ACC	DH845849	DH845850
length	839	894
definition	DH845849\|Mus musculus domesticus DNA, BAC clone: B6Ng01-010B05, 5' end.	DH845850\|Mus musculus domesticus DNA, BAC clone: B6Ng01-010B05, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(7,108,411 - 7,109,251)	(6,948,703 - 6,949,593)
sequence	gaattcctaaaccggtttgaggaagccaaacgaacctatgaagaaggttt aaaacatgaagccaataatctccagcttaaggagggcttgcagaacatgg aggccaggttggcaggtgggtattcattcagcattcccttttttatttag taggattaatttttttttttttttttttttttttgggttttttggttttt cgagacagggtttctctgtatagccctggctgtcctggagctcactttgt agaccaggctggcctcgaactcagaaattcgcctgcctctgcctcccgag tgctgggattaaaggcgtgcgccaccacgcccggctggattaatttttaa aacagtgctgtcctccccaaagtgaaggtatgtggtaggtgggctatgtt tgtcatgaagactcaagttaatatttcatactactgtactggctttcatt tggacagagaggaaattcatgaatccattcaacttgcctaatctatacca aaagttggaaaacgaccccaggacaaggtcgctgctcagtgaccccacct acagggagctcatagaacagctgcagaacaagccgtcagacctgggcacg tgagtacaggccgcaagacagaagctctctgatgtgggccactgaggagg ataggttttgtaattgcatttgtaaaaaagaaaagttggtcagcttgtaa tagcaagacattcaggagtgttacttccaatcttgcccatgctaggcaaa tgccatctctgagcttgtactcctgttataggtaaagatcatccaggtat atgaaatctgttactgatgccaggtaaggagcagttgta	gaattcccactggaagataaagacaatgagcctccagctaggtgtgctgg ggcaggcctgtgatcttagtaccaaggagatggagtcagaggataaggag ttcaaagtcatccactcctcggctacatagcaaatttgaggccagcctgg gctgcatgagattgtcaaaagaataagaggctggagagatgactcagagg ttaagagccctgcctactcttccaaagggcctgtatccaattcccagagc ccatgtgacagttgtatctccagtttcagaagatccaaagccctcttctg gcctccaaggacagtgcacacatatgctgcacaaatatgcaagcaggcaa aacacataaaataaaaataaaataaaaacacataaaataaaacatttttc aattttcttgatttaaaaaaaaaaaaaaaagagcacttgctgctcttgca gagagaggatccaggttcccttccaagcacccatgtggcagctcatagct gtctgtaattccagctccaagggatctgatgctctcttctcatttccaag agcaccaggcaggcacacagtacatacgtttatgccgggaaaactctcat acacgtaaacaaaaataaaaaggaaggaaggaagggagcaccacggtacc acatggtacacacttacagtcccaactgaggcagggggatcatgtgagct cagagttcaagatttgcttgggcaaaatagtgagaacctatgcaagccag gcggtggtggcgcatgcctttaatcccagcacttgggaggcagaggcagg cagatttctgagttcgaggccaacctggtctacaaagtgagttccagggc agccacggatacacagagacagaggtggggggttgggaaggagg
quality values	Open. Hide. 61 41 22 35 61 61 61 61 61 50 50 61 61 50 47 61 61 61 47 61 55 61 61 61 49 47 47 52 43 50 52 37 55 52 52 52 61 61 61 61 61 61 59 61 61 59 59 36 59 59 59 59 59 59 59 59 61 61 61 61 59 61 61 59 61 61 61 61 61 61 59 61 61 59 59 61 61 59 59 59 59 61 61 44 55 59 59 61 61 61 61 61 59 61 61 61 59 61 61 59 61 59 61 59 59 61 59 61 61 61 61 61 59 59 52 59 59 61 59 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 59 55 59 61 61 61 59 59 61 61 61 61 49 49 35 28 32 39 22 27 36 39 59 52 44 49 30 35 37 43 49 45 12 37 27 39 39 27 24 36 41 37 49 41 36 33 41 43 45 39 39 43 39 36 43 52 49 44 44 35 27 44 49 36 41 45 37 35 33 44 27 39 39 39 43 38 41 52 49 45 32 32 18 49 43 43 32 18 44 37 49 45 52 36 49 39 41 13 35 52 39 41 43 29 13 41 59 52 43 43 36 18 35 49 44 52 45 49 43 45 39 49 49 52 43 45 52 49 23 44 27 35 49 35 36 36 52 44 49 39 43 39 45 52 27 49 24 21 30 38 44 33 52 59 39 39 49 28 39 22 41 49 52 36 49 24 36 49 52 36 37 45 43 49 59 59 59 52 45 45 49 52 52 49 36 27 31 52 45 45 44 39 45 49 43 45 49 49 59 43 49 49 35 39 49 50 59 23 52 34 39 38 45 39 45 52 39 45 19 52 34 49 52 52 44 39 43 45 45 45 45 45 59 49 45 36 41 49 49 52 27 52 37 24 39 28 30 52 52 59 59 59 52 59 59 59 52 52 43 37 43 52 45 49 45 45 59 36 45 34 31 43 12 29 22 36 59 59 52 59 59 59 59 52 59 49 37 36 59 27 52 39 52 59 52 43 38 52 37 31 36 52 52 52 49 52 55 43 52 52 52 36 52 52 49 41 43 36 52 37 41 52 37 41 41 33 43 30 37 37 28 41 52 55 52 30 24 29 49 49 52 52 55 52 26 49 41 52 52 52 36 37 52 47 50 39 43 19 38 15 24 14 32 50 50 43 37 37 31 19 43 49 43 41 50 49 50 50 55 38 34 31 31 18 37 50 50 43 43 31 37 31 31 31 26 11 43 43 42 39 21 29 43 50 49 35 21 55 47 37 50 50 31 47 53 26 27 35 31 23 47 23 31 35 24 21 35 25 35 23 12 21 21 31 12 53 45 45 35 35 47 31 45 17 29 27 9 37 40 33 45 21 43 43 20 50 50 45 33 33 39 35 27 23 17 10 19 20 53 28 50 28 52 32 31 31 10 38 42 14 52 53 31 43 14 61 22 53 61 61 45 45 32 38 43 42 27 31 14 53 61 30 27 19 20 28 27 27 26 61 28 53 45 45 47 14 39 38 38 22 8 22 9 14 27 28 43 42 32 30 45 18 36 17 26 14 29 30 28 12 20 17 34 33 35 34 53 36 23 45 45 18 42 29 38 32 40 17 26 10 19 21 25 21 27 30 23 21 28 23 30 45 36 28 30 9 47 18 12 24 30 24 27 21 50 20 45 33 22 32 27 32 53 11 45 20 32 20 14 35 30 13 13 13 14 23 10 8 6 12 23 23 45 8 37 53 20 29 18 34 20 14 20 42 41 12 21 18 43 33 29 24 7 31 17 32 24 12 26 13 29 30 21 18 10 22 11 20 14 15 16 32 43 14 31 11 27 14 40 8 25 7 33 22 30 34 32 21 29 13	Open. Hide. 61 55 49 49 55 52 59 49 49 59 59 55 49 59 59 59 59 33 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 55 44 55 61 61 61 61 59 44 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 59 61 61 59 59 61 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 55 50 61 61 55 61 55 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 45 50 52 50 61 61 61 50 61 61 61 61 61 61 61 61 53 53 40 61 43 61 50 47 47 50 61 47 50 53 50 50 61 53 53 52 47 47 47 53 47 47 34 53 61 61 50 61 61 61 53 61 61 61 61 61 50 52 45 53 53 52 47 53 52 45 53 61 57 53 53 53 57 53 53 57 53 53 50 53 52 50 53 53 53 47 38 53 53 57 53 47 47 53 53 46 53 50 53 47 53 52 57 50 57 57 53 53 53 52 53 53 53 50 40 33 53 53 57 53 53 52 53 53 52 50 57 53 50 42 57 53 52 53 52 53 53 52 50 53 53 50 53 50 46 39 53 57 52 53 53 53 47 47 42 53 57 57 53 53 52 50 53 50 53 43 45 53 35 32 19 30 26 42 45 46 33 46 45 46 43 41 35 53 50 57 41 57 37 43 43 46 45 28 57 41 37 25 41 52 40 39 57 53 52 28 53 28 38 53 42 53 52 53 39 28 33 37 28 46 31 37 53 57 47 37 50 38 42 40 47 47 41 37 53 36 36 33 38 38 33 29 40 47 53 53 40 29 40 35 39 22 57 57 57 57 25 28 35 36 47 53 47 40 41 29 44 47 36 44 21 53 37 38 45 29 37 41 40 25 18 57 53 37 37 53 37 44 33 37 29 18 46 46 30 22 29 30 31 44 30 25 24 19 17 25 30 39 48 48 30 19 48 35 30 22 20 15 47 32 33 47 27 36 40 29 36 45 29 29 36 27 37 41 22 40 31 44 29 28 36 29 28 48 47 28 31 36 21 24 29 32 29 39 36 32 9 39 14 29 21 28 7 38 28 29 23 39 20 31 14 29 19 51 41 28 29 24 39 9 43 27 30 25 36 12 36 10 30 16 26 22 36 28 27 15 28 23 10 23 28 29 46 29 29 20 28 34 24 27 26 16 23 28 29 43 34 20 29 22 27 23 15 19 17 16 29 19 20 27 12 16 10 7 26 18 13 10 18 14 36 20 25 30 29 38 36 36 38 38 9 6 23 22 31 19 11 12 10 20 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_7108411_7109251
seq2: B6Ng01-010B05.b_42_880 (reverse)

seq1  TACAACTGCTCCTTACCTTGGCACTCATTAACAGA-TTCCTATACCTGGA  49
      ||||||||||||||||| ||||| ||| ||||||| ||| ||||||||||
seq2  TACAACTGCTCCTTACC-TGGCA-TCAGTAACAGATTTCATATACCTGGA  48

seq1  TGATCCTTACCTACTAACAGGAGTACAAGCTCAGAGATGGCATTTGCCTA  99
      ||||| ||||||| ||||||||||||||||||||||||||||||||||||
seq2  TGATCTTTACCTA-TAACAGGAGTACAAGCTCAGAGATGGCATTTGCCTA  97

seq1  GCATGGGCAAGATTGGAAGTAACACTCCTGAATGTCTTGCTATTACAAGC  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGGGCAAGATTGGAAGTAACACTCCTGAATGTCTTGCTATTACAAGC  147

seq1  TGACCAACTTTTCTTTTTTACAAATGCAATTACAAAACCTATCCTCCTCA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACCAACTTTTCTTTTTTACAAATGCAATTACAAAACCTATCCTCCTCA  197

seq1  GTGGCCCACATCAGAGAGCTTCTGTCCTGCGGCCTGTACTCACGTGCCCA  249
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  GTGGCCCACATCAGAGAGCTTCTGTCTTGCGGCCTGTACTCACGTGCCCA  247

seq1  GGTCTGACGGCTTGTTCTGCAGCTGTTCTATGAGCTCCCTGTAGGTGGGG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTGACGGCTTGTTCTGCAGCTGTTCTATGAGCTCCCTGTAGGTGGGG  297

seq1  TCACTGAGCAGCGACCTTGTCCTGGGGTCGTTTTCCAACTTTTGGTATAG  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTGAGCAGCGACCTTGTCCTGGGGTCGTTTTCCAACTTTTGGTATAG  347

seq1  ATTAGGCAAGTTGAATGGATTCATGAATTTCCTCTCTGTCCAAATGAAAG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGGCAAGTTGAATGGATTCATGAATTTCCTCTCTGTCCAAATGAAAG  397

seq1  ACAGTACAGTAGTATGAAATATTAACTTGAGTCTTCATGACAAACATAGC  449
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTACAGTAGTATGAAATATTAACTTGAGTCTTCATGACAAACATAGC  447

seq1  CCACCTACCACATACCTTCACTTTGGGGAGGACAGCACTGTTTTAAAAAT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCTACCACATACCTTCACTTTGGGGAGGACAGCACTGTTTTAAAAAT  497

seq1  TAATCCAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATCCAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAG  547

seq1  GCAGAGGCAGGCGAATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAGGCAGGCGAATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTG  597

seq1  AGCTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAACCA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAACCA  647

seq1  AAAAACCCAAAAAAAAAAAAAAAAAAAAAAAAATTAATCCTACTAAATAA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACCCAAAAAAAAAAAAAAAAAAAAAAAAATTAATCCTACTAAATAA  697

seq1  AAAAGGGAATGCTGAATGAATACCCACCTGCCAACCTGGCCTCCATGTTC  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGGAATGCTGAATGAATACCCACCTGCCAACCTGGCCTCCATGTTC  747

seq1  TGCAAGCCCTCCTTAAGCTGGAGATTATTGGCTTCATGTTTTAAACCTTC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAGCCCTCCTTAAGCTGGAGATTATTGGCTTCATGTTTTAAACCTTC  797

seq1  TTCATAGGTTCGTTTGGCTTCCTCAAACCGGTTTAGGAATTC  841
      ||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATAGGTTCGTTTGGCTTCCTCAAACCGGTTTAGGAATTC  839

seq1: chr19_6948703_6949593
seq2: B6Ng01-010B05.g_65_958

seq1  GAATTCCCACTGGAAGATAAAGACAATGAGCCTCCAGCTAGGTGTGCTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCACTGGAAGATAAAGACAATGAGCCTCCAGCTAGGTGTGCTGG  50

seq1  GGCAGGCCTGTGATCTTAGTACCAAGGAGATGGAGTCAGAGGATAAGGAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGGCCTGTGATCTTAGTACCAAGGAGATGGAGTCAGAGGATAAGGAG  100

seq1  TTCAAAGTCATCCACTCCTCGGCTACATAGCAAATTTGAGGCCAGCCTGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAAAGTCATCCACTCCTCGGCTACATAGCAAATTTGAGGCCAGCCTGG  150

seq1  GCTGCATGAGATTGTCAAAAGAATAAGAGGCTGGAGAGATGACTCAGAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCATGAGATTGTCAAAAGAATAAGAGGCTGGAGAGATGACTCAGAGG  200

seq1  TTAAGAGCCCTGCCTACTCTTCCAAAGGGCCTGTATCCAATTCCCAGAGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGAGCCCTGCCTACTCTTCCAAAGGGCCTGTATCCAATTCCCAGAGC  250

seq1  CCATGTGACAGTTGTATCTCCAGTTTCAGAAGATCCAAAGCCCTCTTCTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGTGACAGTTGTATCTCCAGTTTCAGAAGATCCAAAGCCCTCTTCTG  300

seq1  GCCTCCAAGGACAGTGCACACATATGCTGCACAAATATGCAAGCAGGCAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCCAAGGACAGTGCACACATATGCTGCACAAATATGCAAGCAGGCAA  350

seq1  AACACATAAAATAAAAATAAAATAAAAACACATAAAATAAAACATTTTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACATAAAATAAAAATAAAATAAAAACACATAAAATAAAACATTTTTC  400

seq1  AATTTTCTTGATTTAAAAAAAAAAAAAAAAGAGCACTTGCTGCTCTTGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTTCTTGATTTAAAAAAAAAAAAAAAAGAGCACTTGCTGCTCTTGCA  450

seq1  GAGAGAGGATCCAGGTTCCCTTCCAAGCACCCATGTGGCAGCTCATAGCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGGATCCAGGTTCCCTTCCAAGCACCCATGTGGCAGCTCATAGCT  500

seq1  GTCTGTAATTCCAGCTCCAAGGGATCTGATGCTCTCTTCTCATTTCCAAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGTAATTCCAGCTCCAAGGGATCTGATGCTCTCTTCTCATTTCCAAG  550

seq1  AGCACCAGGCAGGCACACAGTACATACGTTTATGCCGGGAAAACTCTCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACCAGGCAGGCACACAGTACATACGTTTATGCCGGGAAAACTCTCAT  600

seq1  ACACGTAAACAAAAATAAAAAGGAAGGAAGGAAGGGAGCACCACGGTACC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACGTAAACAAAAATAAAAAGGAAGGAAGGAAGGGAGCACCACGGTACC  650

seq1  ACATGGTACACACTTACAGTCCCAACTGAGGCAGGGGGATCATGTGAGCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGGTACACACTTACAGTCCCAACTGAGGCAGGGGGATCATGTGAGCT  700

seq1  CAGAGTTCAAGATTTGCTTGGGCAAAATAGTGAGAACCTATGCAAGCCAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGTTCAAGATTTGCTTGGGCAAAATAGTGAGAACCTATGCAAGCCAG  750

seq1  GCGGTGGTGGCGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGTGGTGGCGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGG  800

seq1  CAGATTTCTGAGTTCGAGGCCAACCTGGTCTACAAAGTGAGTTCCAGGGC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATTTCTGAGTTCGAGGCCAACCTGGTCTACAAAGTGAGTTCCAGGGC  850

seq1  AGCCACGGATACACAGAGACAGAGGTGGGGG--TGGG-AGGAGG  891
      |||||||||||||||||||||||||||||||  |||| ||||||
seq2  AGCCACGGATACACAGAGACAGAGGTGGGGGGTTGGGAAGGAGG  894

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information