MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-199O11
Chromosome	19 (Build37)	4 (Build37)
Map Location	10,876,479 - 10,876,888	131,691,954 - 131,692,416
singlet/doublet	singlet	singlet
Overlap gene	Cd6
Upstream gene	6720475J19Rik, LOC100040203, Incenp, LOC100040215, Fth1, Best1, Rab3il1, Fads3, Fads2, LOC100040227, Fads1, Fen1, 1810006K21Rik, Gm98, Dagla, Syt7, Gm705, 4930579J09Rik, 0610038F07Rik, 5730453I16Rik, 2810441K11Rik, Tmem138, Cybasc3, Dak, Ddb1, Vwce, Pga5, 2210404E10Rik, Vps37c, Cd5
Downstream gene	Slc15a3, Tmem132a, Tmem109, Prpf19, Zp1, Gpr44, Ccdc86, Ms4a10, E530011F12Rik, 5033428B15Rik, AW112010, Ms4a8a, Gm336, LOC624395, 1700025F22Rik, Ms4a13, Ms4a12, Ms4a1, Ms4a5, Gm1276, Ms4a7, Ms4a4a, LOC435588, Ms4a4c, LOC433221, Ms4a4b, Ms4a6c, EG666926, Ms4a6b, Ms4a4d, LOC100040454, Ms4a6d, Ms4a2, Ms4a3, Plac1l, Oosp1, Gm97, Gif, EG666958, Mrpl16, Stx3
Link	Open Mouse BAC browser

Click to get alignment info.

name	6720475J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68157 MGI:1915407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 42 ESTs

name	LOC100040203 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Incenp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16319 MGI:1313288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Fth1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14319 MGI:95588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Best1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24115 MGI:1346332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab3il1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74760 MGI:1922010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fads3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60527 MGI:1928740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fads2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56473 MGI:1930079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Fads1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76267 MGI:1923517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fen1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14156 MGI:102779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810006K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69038 MGI:1916288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 78 ESTs, 2 Proteins

name	Gm98 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225908 MGI:2684944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 1 Protein

name	Dagla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269060 MGI:2677061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54525 MGI:1859545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Gm705 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278795 MGI:2685551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins

name	4930579J09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67752 MGI:1915002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610038F07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66072 MGI:1913322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730453I16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269061 MGI:1917826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810441K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68642 MGI:1920020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72982 MGI:1920232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cybasc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225912 MGI:2686925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225913 MGI:2385084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13194 MGI:1202384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vwce (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71768 MGI:1919018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Pga5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58803 MGI:1915935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210404E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72305 MGI:1919555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Vps37c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107305 MGI:2147661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12507 MGI:88340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12511 MGI:103566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc15a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65221 MGI:1929691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem132a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98170 MGI:2147810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68539 MGI:1915789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28000 MGI:106247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22786 MGI:103073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14764 MGI:1330275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc86 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108673 MGI:1277220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69826 MGI:1917076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E530011F12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545279 MGI:3617853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5033428B15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76002 MGI:1923252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	AW112010 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107350 MGI:2147706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 109 ESTs

name	Ms4a8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64381 MGI:1927657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm336 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240539 MGI:2685182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	LOC624395 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624395
definition	note : NS1-associated protein 1 pseudogene pseudo : _no_value

name	1700025F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69416 MGI:1916666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73466 MGI:1920716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381213 MGI:2685812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ms4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12482 MGI:88321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269063 MGI:2670985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1276 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383435 MGI:2686122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	Ms4a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109225 MGI:1918846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ms4a4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666907 MGI:3643932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC435588 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ms4a4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64380 MGI:1927656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 24 Proteins pseudo : _no_value

name	Ms4a4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60361 MGI:1913083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a6c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73656 MGI:2385644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG666926 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666926 MGI:3645380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ms4a6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69774 MGI:1917024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66607 MGI:1913857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ms4a6d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68774 MGI:1916024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14126 MGI:95495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ms4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170813 MGI:2158468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plac1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225922 MGI:2684945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oosp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170834 MGI:2149290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225923 MGI:2684943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gif (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14603 MGI:1202394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666958 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666958 MGI:3647782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Mrpl16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94063 MGI:2137219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20908 MGI:103077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	6720475J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270376 GeneID:68157 MGI:1915407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 42 ESTs product : RIKEN cDNA 6720475J19 gene transcript_id : XM_001474896.1

name	LOC100040203 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270369 GeneID:100040203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to prostatein C3 subunit transcript_id : XM_001474259.1

name	Incenp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710039 GeneID:16319 MGI:1313288
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inner centromere protein transcript_id : NM_016692.1

name	LOC100040215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270371 GeneID:100040215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040215 transcript_id : XM_001474300.1

name	Fth1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753911 GeneID:14319 MGI:95588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ferritin heavy chain 1 transcript_id : NM_010239.1

name	Best1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233764 GeneID:24115 MGI:1346332
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bestrophin 1 transcript_id : NM_011913.1

name	Rab3il1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239979 GeneID:74760 MGI:1922010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB3A interacting protein (rabin3)-like 1 transcript_id : NM_144538.2

name	Fads3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887800 GeneID:60527 MGI:1928740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid desaturase 3 transcript_id : NM_021890.3

name	Fads2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790070 GeneID:56473 MGI:1930079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid desaturase 2 transcript_id : NM_019699.1

name	Fads1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164783 GeneID:76267 MGI:1923517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid desaturase 1 transcript_id : NM_146094.1

name	Fen1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47132513 GeneID:14156 MGI:102779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flap structure specific endonuclease 1 transcript_id : NM_007999.3

name	1810006K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270373 GeneID:69038 MGI:1916288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 78 ESTs, 2 Proteins product : RIKEN cDNA 1810006K21 gene transcript_id : XM_622862.4

name	Gm98 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270386 GeneID:225908 MGI:2684944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 1 Protein product : gene model 98, (NCBI), transcript variant 2 transcript_id : XM_888586.3

name	Dagla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674270 GeneID:269060 MGI:2677061
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol lipase, alpha transcript_id : NM_198114.1

name	Syt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129798 GeneID:54525 MGI:1859545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin VII transcript_id : NM_173067.2

name	Syt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281839 GeneID:54525 MGI:1859545
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin VII transcript_id : NM_173068.1

name	Syt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130738 GeneID:54525 MGI:1859545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin VII transcript_id : NM_018801.2

name	Gm705 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270374 GeneID:278795 MGI:2685551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : gene model 705, (NCBI) transcript_id : XM_204937.8

name	4930579J09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526857 GeneID:67752 MGI:1915002
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930579J09 gene transcript_id : NM_133689.1

name	0610038F07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828928 GeneID:66072 MGI:1913322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610038F07 gene transcript_id : NM_025333.3

name	5730453I16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982054 GeneID:269061 MGI:1917826
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730453I16 gene transcript_id : NM_172302.2

name	2810441K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312085 GeneID:68642 MGI:1920020
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810441K11 gene transcript_id : NM_026798.1

name	Tmem138 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374796 GeneID:72982 MGI:1920232
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 138 transcript_id : NM_028411.2

name	Cybasc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235723 GeneID:225912 MGI:2686925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b, ascorbate dependent 3 transcript_id : NM_201351.1

name	Dak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703975 GeneID:225913 MGI:2385084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydroxyacetone kinase 2 homolog (yeast) transcript_id : NM_145496.1

name	Ddb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657010 GeneID:13194 MGI:1202384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : damage specific DNA binding protein 1 transcript_id : NM_015735.1

name	Vwce (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405819 GeneID:71768 MGI:1919018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : von Willebrand factor C and EGF domains, transcript variant 2 transcript_id : XM_889279.2

name	Pga5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378195 GeneID:58803 MGI:1915935
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pepsinogen 5, group I transcript_id : NM_021453.3

name	2210404E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270388 GeneID:72305 MGI:1919555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 2210404E10 gene transcript_id : XM_001475568.1

name	Vps37c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340991 GeneID:107305 MGI:2147661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 37C (yeast) transcript_id : NM_181403.2

name	Cd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517488 GeneID:12507 MGI:88340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD5 antigen transcript_id : NM_007650.3

name	Cd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126513131 GeneID:12511 MGI:103566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD6 antigen transcript_id : NM_001037801.2

name	Cd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126513129 GeneID:12511 MGI:103566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD6 antigen transcript_id : NM_009852.3

name	Slc15a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12746419 GeneID:65221 MGI:1929691
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 15, member 3 transcript_id : NM_023044.1

name	Tmem132a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196787 GeneID:98170 MGI:2147810
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 132A transcript_id : NM_133804.2

name	Tmem109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527377 GeneID:68539 MGI:1915789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 109 transcript_id : NM_134142.1

name	Prpf19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892883 GeneID:28000 MGI:106247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) transcript_id : NM_134129.3

name	Zp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249091 GeneID:22786 MGI:103073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida glycoprotein 1 transcript_id : NM_009580.2

name	Gpr44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328164 GeneID:14764 MGI:1330275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 44 transcript_id : NM_009962.2

name	Ccdc86 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357952 GeneID:108673 MGI:1277220
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 86 transcript_id : NM_023731.2

name	Ms4a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647223 GeneID:69826 MGI:1917076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 10 transcript_id : NM_023529.2

name	E530011F12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803485 GeneID:545279 MGI:3617853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E530011F12 gene transcript_id : NM_001034898.2

name	5033428B15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405843 GeneID:76002 MGI:1923252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5033428B15 gene transcript_id : XM_129208.5

name	AW112010 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405846 GeneID:107350 MGI:2147706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 109 ESTs product : expressed sequence AW112010 transcript_id : XM_888885.2

name	Ms4a8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953176 GeneID:64381 MGI:1927657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 8A transcript_id : NM_022430.2

name	Gm336 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270378 GeneID:240539 MGI:2685182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : gene model 336, (NCBI) transcript_id : XM_140607.6

name	1700025F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802777 GeneID:69416 MGI:1916666
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700025F22 gene transcript_id : NM_027074.2

name	Ms4a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130838 GeneID:73466 MGI:1920716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 13 transcript_id : NM_198224.3

name	Ms4a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270379 GeneID:381213 MGI:2685812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : membrane-spanning 4-domains, subfamily A, member 12 transcript_id : XM_001474614.1

name	Ms4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361802 GeneID:12482 MGI:88321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 1 transcript_id : NM_007641.4

name	Ms4a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625823 GeneID:269063 MGI:2670985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 5 transcript_id : NM_183190.2

name	Gm1276 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405848 GeneID:383435 MGI:2686122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : gene model 1276, (NCBI) transcript_id : XM_357051.4

name	Ms4a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130396 GeneID:109225 MGI:1918846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 7 transcript_id : NM_027836.5

name	Ms4a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802929 GeneID:109225 MGI:1918846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 7 transcript_id : NM_001025610.2

name	Ms4a4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270381 GeneID:666907 MGI:3643932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : membrane-spanning 4-domains, subfamily A, member 4A transcript_id : XM_986941.2

name	Ms4a4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62461603 GeneID:64380 MGI:1927656
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 4C transcript_id : NM_029499.2

name	Ms4a4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796633 GeneID:60361 MGI:1913083
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 4B transcript_id : NM_021718.2

name	Ms4a6c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373919 GeneID:73656 MGI:2385644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : membrane-spanning 4-domains, subfamily A, member 6C transcript_id : NM_028595.3

name	EG666926 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270384 GeneID:666926 MGI:3645380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG666926 transcript_id : XM_987047.2

name	Ms4a6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130332 GeneID:69774 MGI:1917024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 6B transcript_id : NM_027209.3

name	Ms4a4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374560 GeneID:66607 MGI:1913857
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 4D transcript_id : NM_025658.4

name	Ms4a6d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637843 GeneID:68774 MGI:1916024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 6D transcript_id : NM_026835.2

name	Ms4a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305048 GeneID:14126 MGI:95495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 2 transcript_id : NM_013516.1

name	Ms4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354489 GeneID:170813 MGI:2158468
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-spanning 4-domains, subfamily A, member 3 transcript_id : NM_133246.3

name	Plac1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364906 GeneID:225922 MGI:2684945
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placenta-specific 1-like transcript_id : NM_001037634.2

name	Oosp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354986 GeneID:170834 MGI:2149290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte secreted protein 1 transcript_id : NM_133353.3

name	Gm97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185933 GeneID:225923 MGI:2684943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 97, (NCBI) transcript_id : NM_001033283.2

name	Gif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377019 GeneID:14603 MGI:1202394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastric intrinsic factor transcript_id : NM_008118.3

name	Mrpl16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130301 GeneID:94063 MGI:2137219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L16 transcript_id : NM_025606.3

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778801 GeneID:20908 MGI:103077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_001025307.1

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778979 GeneID:20908 MGI:103077
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_011502.2

name	Stx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778910 GeneID:20908 MGI:103077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 3 transcript_id : NM_152220.1

name	6720475J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270377 GeneID:68157 MGI:1915407
definition	codon_start : 1 product : hypothetical protein LOC68157 protein_id : XP_001474946.1

name	LOC100040203 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270370 GeneID:100040203
definition	codon_start : 1 product : similar to prostatein C3 subunit protein_id : XP_001474309.1

name	Incenp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710040 GeneID:16319 MGI:1313288
definition	GO_component : GO:0000801 - central element [Evidence IDA]; GO:0005721 - centric heterochromatin [Evidence ISS]; GO:0000775 - chromosome, pericentric region [Evidence IDA] [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0030496 - midbody [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence ISS]; GO:0005819 - spindle [Evidence ISS]; GO:0000795 - synaptonemal complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence ISS]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : inner centromere protein protein_id : NP_057901.1

name	LOC100040215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270372 GeneID:100040215
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474350.1

name	Fth1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753912 CCDS:CCDS29567.1 GeneID:14319 MGI:95588
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0004322 - ferroxidase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0019900 - kinase binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence ISS]; GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS] codon_start : 1 product : ferritin heavy chain 1 protein_id : NP_034369.1

name	Best1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50233765 CCDS:CCDS29568.1 GeneID:24115 MGI:1346332
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : best macular dystrophy; vitelliform macular dystrophy 2 homolog product : bestrophin protein_id : NP_036043.1

name	Rab3il1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362337 CCDS:CCDS29569.1 GeneID:74760 MGI:1922010
definition	GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0017112 - Rab guanyl-nucleotide exchange factor activity [Evidence ISS] codon_start : 1 product : RAB3A interacting protein (rabin3)-like 1 protein_id : NP_653121.1

name	Fads3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887801 CCDS:CCDS29570.1 GeneID:60527 MGI:1928740
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006636 - fatty acid desaturation [Evidence IEA] codon_start : 1 product : fatty acid desaturase 3 protein_id : NP_068690.3

name	Fads2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790071 CCDS:CCDS29571.1 GeneID:56473 MGI:1930079
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA]; GO:0004768 - stearoyl-CoA 9-desaturase activity [Evidence IDA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006636 - fatty acid desaturation [Evidence IEA] codon_start : 1 note : delta-6 fatty acid desaturase product : fatty acid desaturase 2 protein_id : NP_062673.1

name	Fads1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164784 CCDS:CCDS29572.1 GeneID:76267 MGI:1923517
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016213 - linoleoyl-CoA desaturase activity [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0006636 - fatty acid desaturation [Evidence ISS] [Evidence IEA]; GO:0042759 - long-chain fatty acid biosynthesis [Evidence ISS] codon_start : 1 product : delta-5 desaturase protein_id : NP_666206.1

name	Fen1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048490 CCDS:CCDS29573.1 GeneID:14156 MGI:102779
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IDA]; GO:0048256 - flap endonuclease activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IDA]; GO:0030145 - manganese ion binding [Evidence IDA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP] codon_start : 1 note : flap endonuclease 1 product : flap structure specific endonuclease 1 protein_id : NP_032025.2

name	1810006K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63737442 GeneID:69038 MGI:1916288
definition	codon_start : 1 product : hypothetical protein LOC69038 protein_id : XP_622862.1

name	Gm98 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270387 GeneID:225908 MGI:2684944
definition	codon_start : 1 product : hypothetical protein LOC225908 isoform 2 protein_id : XP_893679.2

name	Dagla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674271 CCDS:CCDS29574.1 GeneID:269060 MGI:2677061
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004806 - triacylglycerol lipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : neural stem cell-derived dendrite regulator protein_id : NP_932782.1

name	Syt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281824 CCDS:CCDS29576.1 GeneID:54525 MGI:1859545
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : beta isoform is encoded by transcript variant 2; synaptotagmin 7 product : synaptotagmin VII beta isoform protein_id : NP_775090.1

name	Syt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281840 GeneID:54525 MGI:1859545
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : gamma isoform is encoded by transcript variant 3; synaptotagmin 7 product : synaptotagmin VII gamma isoform protein_id : NP_775091.1

name	Syt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055364 CCDS:CCDS29575.1 GeneID:54525 MGI:1859545
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : alpha isoform is encoded by transcript variant 1; synaptotagmin 7 product : synaptotagmin VII alpha isoform protein_id : NP_061271.1

name	Gm705 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270375 GeneID:278795 MGI:2685551
definition	codon_start : 1 product : hypothetical protein protein_id : XP_204937.5

name	4930579J09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526858 CCDS:CCDS29577.1 GeneID:67752 MGI:1915002
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : IIIG9 protein protein_id : NP_598450.1

name	0610038F07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560262 CCDS:CCDS29578.1 GeneID:66072 MGI:1913322
definition	codon_start : 1 product : hypothetical protein LOC66072 protein_id : NP_079609.2

name	5730453I16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982055 CCDS:CCDS29579.1 GeneID:269061 MGI:1917826
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pre-mRNA cleavage factor I, 59 kDa subunit protein_id : NP_758506.2

name	2810441K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312086 GeneID:68642 MGI:1920020
definition	codon_start : 1 product : hypothetical protein LOC68642 protein_id : NP_081074.1

name	Tmem138 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21624623 CCDS:CCDS29581.1 GeneID:72982 MGI:1920232
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72982 protein_id : NP_082687.1

name	Cybasc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235724 CCDS:CCDS29582.1 GeneID:225912 MGI:2686925
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome b, ascorbate dependent 3 protein protein_id : NP_958739.1

name	Dak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703976 GeneID:225913 MGI:2385084
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004371 - glycerone kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006071 - glycerol metabolism [Evidence IEA] codon_start : 1 product : dihydroxyacetone kinase 2 homolog protein_id : NP_663471.1

name	Ddb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657011 GeneID:13194 MGI:1202384
definition	codon_start : 1 note : damage specific DNA binding protein 1 (127 kDa); DNA repair protein; damage-specific DNA-binding protein, DNA repair; damaged-DNA recognition protein 1 product : damage specific DNA binding protein 1 protein_id : NP_056550.1

name	Vwce (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998150 GeneID:71768 MGI:1919018
definition	codon_start : 1 product : von Willebrand factor C and EGF domains isoform 2 protein_id : XP_894372.1

name	Pga5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981154 CCDS:CCDS29584.1 GeneID:58803 MGI:1915935
definition	GO_component : GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IDA] GO_process : GO:0019538 - protein metabolism [Evidence TAS] codon_start : 1 note : pepsinogen A5; pepsinogen F product : pepsinogen 5, group I protein_id : NP_067428.2

name	2210404E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270389 GeneID:72305 MGI:1919555
definition	codon_start : 1 product : hypothetical protein LOC72305 protein_id : XP_001475618.1

name	Vps37c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088908 CCDS:CCDS29585.1 GeneID:107305 MGI:2147661
definition	codon_start : 1 product : vacuolar protein sorting 37C protein_id : NP_852068.1

name	Cd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517489 CCDS:CCDS29586.1 GeneID:12507 MGI:88340
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0008624 - induction of apoptosis by extracellular signals [Evidence IDA]; GO:0031295 - T cell costimulation [Evidence IDA] codon_start : 1 product : CD5 antigen protein_id : NP_031676.3

name	Cd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699412 GeneID:12511 MGI:103566
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : CD6 antigen isoform 1 protein_id : NP_001032890.1

name	Cd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126513130 GeneID:12511 MGI:103566
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : CD6 antigen isoform 2 protein_id : NP_033982.3

name	Slc15a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746420 CCDS:CCDS29588.1 GeneID:65221 MGI:1929691
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cAMP inducible gene 1 product : solute carrier family 15, member 3 protein_id : NP_075531.1

name	Tmem132a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196788 CCDS:CCDS29589.1 GeneID:98170 MGI:2147810
definition	codon_start : 1 note : heat shock protein 5 binding protein 1 product : heat shock 70kDa protein 5 binding protein 1 protein_id : NP_598565.2

name	Tmem109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527378 CCDS:CCDS29590.1 GeneID:68539 MGI:1915789
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 109 protein_id : NP_598903.1

name	Prpf19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527358 GeneID:28000 MGI:106247
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : PRP19/PSO4 homolog product : nuclear matrix protein SNEV protein_id : NP_598890.1

name	Zp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249092 GeneID:22786 MGI:103073
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0007338 - fertilization (sensu Metazoa) [Evidence IEA] codon_start : 1 product : zona pellucida glycoprotein 1 protein_id : NP_033606.2

name	Gpr44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753528 CCDS:CCDS29592.1 GeneID:14764 MGI:1330275
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IDA] [Evidence ISS]; GO:0004982 - N-formyl peptide receptor activity [Evidence IEA]; GO:0004956 - prostaglandin D receptor activity [Evidence IDA]; GO:0004958 - prostaglandin F receptor activity [Evidence IDA]; GO:0001785 - prostaglandin J receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0019722 - calcium-mediated signaling [Evidence IDA]; GO:0006935 - chemotaxis [Evidence IDA] [Evidence ISS]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0007193 - G-protein signaling, adenylate cyclase inhibiting pathway [Evidence IDA]; GO:0045745 - positive regulation of G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemoattractant receptor-homologous molecule expressed on TH2 cells; prostaglandin D2 receptor CRTH2 product : G protein-coupled receptor 44 protein_id : NP_034092.1

name	Ccdc86 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38093630 CCDS:CCDS29593.1 GeneID:108673 MGI:1277220
definition	codon_start : 1 exception : mismatches in translation note : cyclon product : coiled-coil domain containing 86 protein_id : NP_076220.1

name	Ms4a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647224 GeneID:69826 MGI:1917076
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 10 protein_id : NP_076018.2

name	E530011F12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702258 CCDS:CCDS29594.1 GeneID:545279 MGI:3617853
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC545279 protein_id : NP_001030070.1

name	5033428B15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085783 GeneID:76002 MGI:1923252
definition	codon_start : 1 product : hypothetical protein LOC76002 protein_id : XP_129208.2

name	AW112010 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998257 GeneID:107350 MGI:2147706
definition	codon_start : 1 product : hypothetical protein LOC107350 protein_id : XP_893978.1

name	Ms4a8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953177 GeneID:64381 MGI:1927657
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MS4a8B protein product : membrane-spanning 4-domains, subfamily A, member 8A protein_id : NP_071875.2

name	Gm336 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20887521 GeneID:240539 MGI:2685182
definition	codon_start : 1 product : hypothetical protein protein_id : XP_140607.1

name	1700025F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469001 GeneID:69416 MGI:1916666
definition	codon_start : 1 product : hypothetical protein LOC69416 protein_id : NP_081350.1

name	Ms4a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793424 CCDS:CCDS29595.1 GeneID:73466 MGI:1920716
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 note : testis-expressed transmembrane 4 product : membrane-spanning 4-domains, subfamily A, member 13 protein_id : NP_937867.2

name	Ms4a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270380 GeneID:381213 MGI:2685812
definition	codon_start : 1 product : similar to Membrane-spanning 4-domains, subfamily A, member 12 protein_id : XP_001474664.1

name	Ms4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671710 GeneID:12482 MGI:88321
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : CD20 antigen; membrane-spanning 4-domains, subfamily A, member 2 product : membrane-spanning 4-domains, subfamily A, member 1 protein_id : NP_031667.1

name	Ms4a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147252 CCDS:CCDS29596.1 GeneID:269063 MGI:2670985
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 5 protein_id : NP_899013.1

name	Gm1276 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998267 GeneID:383435 MGI:2686122
definition	codon_start : 1 product : similar to sperm protein SSP3111 protein_id : XP_357051.3

name	Ms4a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043948 CCDS:CCDS29597.1 GeneID:109225 MGI:1918846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : membrane-spanning 4-domains, subfamily A, member 7 isoform b protein_id : NP_001020781.1

name	Ms4a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043882 CCDS:CCDS29598.1 GeneID:109225 MGI:1918846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : membrane-spanning 4-domains, subfamily A, member 7 isoform a protein_id : NP_082112.3

name	Ms4a4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270382 GeneID:666907 MGI:3643932
definition	codon_start : 1 product : similar to MS4A4A protein protein_id : XP_992035.2

name	Ms4a4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386406 CCDS:CCDS29599.1 GeneID:64380 MGI:1927656
definition	codon_start : 1 note : membrane-spanning 4-domains, subfamily A, member 9 product : membrane-spanning 4-domains, subfamily A, member 4C protein_id : NP_083775.1

name	Ms4a4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11096338 CCDS:CCDS29600.1 GeneID:60361 MGI:1913083
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : lymphocyte antigen 116 product : membrane-spanning 4-domains, subfamily A, member 4B protein_id : NP_068364.1

name	Ms4a6c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430755 GeneID:73656 MGI:2385644
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 6C protein_id : NP_082871.2

name	EG666926 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270385 GeneID:666926 MGI:3645380
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992141.2

name	Ms4a6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982630 CCDS:CCDS29601.1 GeneID:69774 MGI:1917024
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 6B protein_id : NP_081485.2

name	Ms4a4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754122 CCDS:CCDS29602.1 GeneID:66607 MGI:1913857
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : membrane-spanning 4-domains, subfamily A, member 4D protein_id : NP_079934.2

name	Ms4a6d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386172 CCDS:CCDS29603.1 GeneID:68774 MGI:1916024
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : membrane-spanning 4-domains, subfamily A, member 11 product : MS4A6D protein protein_id : NP_081111.1

name	Ms4a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305049 CCDS:CCDS29604.1 GeneID:14126 MGI:95495
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0045121 - lipid raft [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019863 - IgE binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : Fc receptor, IgE, high affinity I, beta polypeptide; membrane-spanning 4-domains, subfamily A, member 1 product : membrane-spanning 4-domains, subfamily A, member 2 protein_id : NP_038544.1

name	Ms4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875420 CCDS:CCDS29605.1 GeneID:170813 MGI:2158468
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : haematopoietic cell-specific transmembrane-4; membrane-spanning 4-domains subfamily A member 3 product : membrane-spanning 4-domains, subfamily A, member 3 protein_id : NP_573509.1

name	Plac1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701586 CCDS:CCDS29606.1 GeneID:225922 MGI:2684945
definition	codon_start : 1 note : transmembrane protein 122 product : placenta-specific 1-like protein_id : NP_001032723.1

name	Oosp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373157 CCDS:CCDS29607.1 GeneID:170834 MGI:2149290
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] codon_start : 1 note : oocyte secretory protein 1 product : oocyte secreted protein 1 protein_id : NP_579931.1

name	Gm97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185934 CCDS:CCDS29608.1 GeneID:225923 MGI:2684943
definition	codon_start : 1 product : hypothetical protein LOC225923 protein_id : NP_001028455.2

name	Gif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982338 CCDS:CCDS29609.1 GeneID:14603 MGI:1202394
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0050897 - cobalt ion binding [Evidence IEA]; GO:0015087 - cobalt ion transporter activity [Evidence IEA] GO_process : GO:0006824 - cobalt ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : gastric intrinsic factor protein_id : NP_032144.2

name	Mrpl16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424352 CCDS:CCDS29610.1 GeneID:94063 MGI:2137219
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 note : mitochondiral ribosomal protein L16 product : mitochondrial ribosomal protein L16 protein_id : NP_079882.2

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22726207 CCDS:CCDS29612.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform C is encoded by transcript variant C; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform C protein_id : NP_035632.1

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778802 CCDS:CCDS29611.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant B; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform B protein_id : NP_001020478.1

name	Stx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778911 CCDS:CCDS29613.1 GeneID:20908 MGI:103077
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant A; syntaxin 3A; syntaxin 3B product : syntaxin 3 isoform A protein_id : NP_689344.1

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 5 pseudo : _no_value

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 4 pseudo : _no_value

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 3 pseudo : _no_value

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 2 pseudo : _no_value

name	LOC100040227 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040227
definition	number : 1 pseudo : _no_value

name	LOC435588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435588
definition	number : 2 pseudo : _no_value

name	LOC435588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435588
definition	number : 1 pseudo : _no_value

name	LOC100040454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040454
definition	number : 1 pseudo : _no_value

name	LOC100040454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040454
definition	number : 2 pseudo : _no_value

name	LOC100040454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040454
definition	number : 3 pseudo : _no_value

name	EG666958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666958
definition	number : 1 pseudo : _no_value

name	EG666958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666958
definition	number : 2 pseudo : _no_value

name	EG666958 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666958
definition	number : 3 pseudo : _no_value

name	LOC433221 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270383 GeneID:433221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 24 Proteins product : similar to heat shock protein 86 pseudo : _no_value transcript_id : XR_031867.1

clone name	MSMg01-262G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127I11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-347L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-543N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-492G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372H09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-391H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334P01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171J09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386O24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-350J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450H14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-501A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-421O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E08
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-199O11.b	B6Ng01-199O11.g
ACC	GA021113	GA021114
length	729	458
definition	B6Ng01-199O11.b	B6Ng01-199O11.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(10,876,479 - 10,876,888)	(131,691,954 - 131,692,416)
sequence	gaattctagtggaagttttagagcttcccagcccttagtaacacatggtg cttctcccagctcccaactcaagctcagtgcctagagttgactttcaggg ttggctgagtgagcagcagatttgttaggcagcatggaggtgtcaccagg gtgtctgccgggagtaccattgcatgatggacctcgggattctgcgctgc ctggaacctgaccatccttaaggcaacccgcatctgtctatgagaatggt gttcaaggcgtagaacatattcctttcatctcagtactgaggaggcagag ataggtggatcagcctgatctacatagtaagtttcaggttagccagagct atgctactcagtaagatgatatcaaaacaagcaagcaaacaaacaaaaga ggagacagggaggggcctggagagatggctcagcagttctgagcccttgt gaatagtgtagagtagtaattcaatgctttgcatccacagtgagttacaa ccacccatcacttcagtctagcctccaaggacaccaggcttgtatatggc acacatatacagctagcaaaacattcatataagaagtggctcgggctggt gagatggctcagtgggtaagagcacccgactgctcttccaaaggtccaga gttcaaatcccagcaaccacatggtggctcacaccatctgtaaatgagat cttcccccctccttctgggggtgtctgaa	atgtgcaccatggtttgtgcagcagcccacaaaagtctgagagggagtca gatcccttggaactgaagttacagaaagttatgagtccccatgtgggcac ttggaacagaacctgagtcttctacaagagcagtaagcacccctaaacac agggccatctctccaatctctaaataaatgcaattcttaaattttttaaa ttaataagtgttcagccgcagccctccatgtttcaacttgcatttggtaa cagtgtttctcctgaataggaaggagacccaggcttcctttgctgtggtt cctttgggttctattgtgggacagggtcccactctgcagtcctggctggc ctggaactcacagaaatctgcctgtctctgcctcccaaattctgagttca agaggtatgagtgcagctgaggtttttgttgtttttaagatatatatata tggcggga
quality values	Open. Hide. 39 20 15 17 51 58 54 36 37 32 58 44 45 45 39 52 58 58 54 47 39 62 54 62 62 62 62 62 56 47 62 62 42 20 21 16 13 10 19 13 16 16 16 22 36 38 49 46 56 62 62 62 62 62 62 62 49 44 59 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 59 59 56 59 62 56 59 59 56 34 46 59 59 62 62 59 49 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 54 54 62 62 62 62 59 59 56 62 59 59 62 62 62 62 62 59 54 33 49 59 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 54 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 62 56 62 62 62 62 62 62 62 59 62 59 62 62 62 59 59 62 62 62 62 46 59 62 62 62 62 62 62 62 62 62 51 59 62 59 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 56 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 41 56 62 56 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 56 43 62 62 62 54 62 54 62 62 62 54 56 56 56 62 41 42 62 62 62 62 62 62 56 62 62 62 47 56 62 52 62 62 62 47 62 62 62 62 52 62 54 62 62 62 62 62 62 62 62 62 54 54 62 62 52 52 62 62 62 62 52 54 54 58 58 58 42 58 58 46 54 58 22 41 58 54 45 58 54 54 41 42 41 42 49 54 35 48 29 54 54 24 58 39 32 19 12 33 19 21 13 12 19 21 54 37 30 24 19 22 22 15 38 42 25 34 42 49 54 54 46 47 39 33 25 22 13 25 10 22 28 35 46 54 38 48 33 39 31 23 40 47 33 48 33 24 31 50 30 19 16 15 15 23 23 40 46 11 9 47 26 24 40 30 21 12 18 5 12 16 19 25 32 27 18 14 18 13 9 14 12 10 15 9 18 10 12 6 6 6 13 27 16 9 13 11 12 15 18 16 10 16 16 9 9 13 21 14 21 27 19 28 23	Open. Hide. 43 44 62 62 62 59 34 43 43 19 28 17 10 5 5 13 23 56 62 62 46 59 62 62 62 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 59 59 62 62 62 54 54 54 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 49 43 62 59 62 62 59 59 59 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 62 62 62 62 62 43 47 43 47 46 43 62 54 58 53 58 58 58 54 52 58 58 58 58 40 58 54 58 54 58 58 58 54 58 58 58 58 58 58 54 40 58 47 58 42 54 54 58 58 58 58 58 58 58 58 58 58 52 54 41 11 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_10876479_10876888
seq2: B6Ng01-199O11.b_419_774

seq1  AAAACAAGCAAGCAAACAAACATTTGCCTTCCCCATGAATCTGCTTTGTG  50
      ||||||||||||||||||||||                            
seq2  AAAACAAGCAAGCAAACAAACA----------------------------  22

seq1  ATATTAAGATGCCTGGACCTAAAGAGAAAGCAGTG-CTGGATGGGAGAGA  99
                          |||||| |  ||| |   ||   |||||||
seq2  --------------------AAAGAGGAGACAGGGAGGGGCCTGGAGAGA  52

seq1  CGGCTCAGCAGGTAGAGGCACTTGCTGCCAAGTCTGATGACCTGAGATCA  149
       |||||||||| |    || |||| ||   ||| |   |   | |  |||
seq2  TGGCTCAGCAGTTCTGAGCCCTTG-TGAATAGTGTAGAGTAGT-AATTCA  100

seq1  GTCCCCAGGACTCACAGGGTGGAAAGAGAGAACTGACC-TCAATGGGTTG  198
       | |   | |  ||||| |     ||  | |||   || |||      | 
seq2  ATGCTTTGCATCCACAGTG-----AGTTACAACCACCCATCA-----CTT  140

seq1  CCCTCT-GACTTCACGCACAC--GTCGTGGAACAAACACACGCAAACAAA  245
      |  ||| | || || | ||||  | | || |     |||||  | |||  
seq2  CAGTCTAGCCTCCAAGGACACCAGGCTTGTATATGGCACACATATACAGC  190

seq1  TAAATATAATTTGCTAAAAAGAAAACAATGGGGCTGGTGAGATGGCTCAG  295
      | |  | ||  | |  | |||||     | ||||||||||||||||||||
seq2  T-AGCAAAACATTCATATAAGAAGTGGCTCGGGCTGGTGAGATGGCTCAG  239

seq1  TGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCGAAGTTCAAATCCCA  345
      ||||||||||||||||||||||||||| |||||||  |||||||||||||
seq2  TGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCA  289

seq1  GCAACCACATGGTGGCTCACAACCATCTGT-AATGAGATCTGACTCCCT-  393
      |||||||||||||||||||| ||||||||| ||||||||||  | |||| 
seq2  GCAACCACATGGTGGCTCAC-ACCATCTGTAAATGAGATCTTCCCCCCTC  338

seq1  CTTCT-GGAGTGTCTGAA  410
      ||||| || |||||||||
seq2  CTTCTGGGGGTGTCTGAA  356

seq1: chr4_131691954_131692416
seq2: B6Ng01-199O11.g_66_529

seq1  GAATTCATGTGCACCATGG-GTGTGCAGCAGCCCACAAAAGTCTGAGAGG  49
      |||||||||||||||||||  |||||||||||||||||||||||||||||
seq2  GAATTCATGTGCACCATGGTTTGTGCAGCAGCCCACAAAAGTCTGAGAGG  50

seq1  GAGTCAGATCCCTTGGAACTGAAGTTACAGAAAGTTATGAGTCCCCATGT  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCAGATCCCTTGGAACTGAAGTTACAGAAAGTTATGAGTCCCCATGT  100

seq1  GGGCACTTGGAACAGAACCTGAGTCTTCTACAAGAGCAGTAAGCACCCCT  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCACTTGGAACAGAACCTGAGTCTTCTACAAGAGCAGTAAGCACCCCT  150

seq1  AAACACAGGGCCATCTCTCCAATCTCTAAATAAATGCAATTCTTAAATTT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACACAGGGCCATCTCTCCAATCTCTAAATAAATGCAATTCTTAAATTT  200

seq1  TTTAAATTAATAAGTGTTCAGCCGCAGCCCTCCATGTTTCAACTTGCATT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAATTAATAAGTGTTCAGCCGCAGCCCTCCATGTTTCAACTTGCATT  250

seq1  TGGTAACAGTGTTTCTCCTGAATAGGAAGGAGACCCAGGCTTCCTTTGCT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTAACAGTGTTTCTCCTGAATAGGAAGGAGACCCAGGCTTCCTTTGCT  300

seq1  GTGGTTCCTTTGGGTTCTATTGTGGGACAGGGTCCCACTCTGCAGTCCTG  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTTCCTTTGGGTTCTATTGTGGGACAGGGTCCCACTCTGCAGTCCTG  350

seq1  GCTGGCCTGGAACTCACAGAAATCTGCCTGTCTCTGCCTCCCAAATTCTG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGCCTGGAACTCACAGAAATCTGCCTGTCTCTGCCTCCCAAATTCTG  400

seq1  AGTTCAAGAGGTATGAGTGCAGCTGAGGTTTTTGTTGTTTTTAAGATATA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCAAGAGGTATGAGTGCAGCTGAGGTTTTTGTTGTTTTTAAGATATA  450

seq1  TATATATGGCGGGA  463
      ||||||||||||||
seq2  TATATATGGCGGGA  464

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information