MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-209J21
Chromosome	19 (Build37)
Map Location	8,722,912 - 8,857,220
singlet/doublet	doublet
Overlap gene	Chrm1, Slc3a2, Snord22, Wdr74, 1700092M07Rik, Stx5a, LOC100039902, Nxf1, 0610006I08Rik, 1810059G22Rik, Taf6l, LOC100039957
Upstream gene	LOC433217, Slc22a19, LOC666543, BC014805, LOC632903, AB056442, LOC620946, LOC623030, 9530053H05Rik, EG434674, LOC100039705, D630002G06Rik, EG633120, EG666601, LOC100039749, C730048C13Rik, LOC100040004, LOC666612, EG623402, Slc22a8, Slc22a6
Downstream gene	Polr2g, Zbtb3, Ttc9c, Hnrpul2, Gng3, Bscl2, 1110067I12Rik, D19Ertd721e, AI462493, 1810009A15Rik, Ints5, Ganab, B3gat3, Rom1, Eml3, Mta2, Tut1, Eef1g, Ahnak, Scgb1a1, Asrgl1, EG621699, LOC100040104, LOC623810, Pcna-ps2, LOC100040130, LOC100040137, LOC100040143, LOC100040152, Stxbp3b, LOC623688, LOC100040178, LOC100040192
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC433217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 101 ESTs, 8 Proteins

name	Slc22a19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207151 MGI:2442751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 10 Proteins pseudo : _no_value

name	BC014805 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236149 MGI:2385316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	AB056442 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171405 MGI:3042283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 14 Proteins

name	LOC620946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 382 ESTs, 22 Proteins pseudo : _no_value

name	LOC623030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	9530053H05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78425 MGI:1925675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	EG434674 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434674 MGI:3645714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039705 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	D630002G06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236293 MGI:3605624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG633120 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633120 MGI:3644446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 676 ESTs, 14 Proteins pseudo : _no_value

name	EG666601 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666601 MGI:3643112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100039749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein pseudo : _no_value

name	C730048C13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319800 MGI:2442750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040004 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040004
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC666612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG623402 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623402 MGI:3646016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Slc22a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19879 MGI:1336187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc22a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18399 MGI:892001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12669 MGI:88396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc3a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17254 MGI:96955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snord22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83673 MGI:1933385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr74 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107071 MGI:2147427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700092M07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74307 MGI:1921557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Stx5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56389 MGI:1928483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Nxf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53319 MGI:1858330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610006I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66836 MGI:1914086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810059G22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67706 MGI:1914956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf6l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225895 MGI:2444957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Polr2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67710 MGI:1914960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75291 MGI:1922541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc9c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70387 MGI:1917637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpul2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68693 MGI:1915943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gng3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14704 MGI:102704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bscl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14705 MGI:1298392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110067I12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68852 MGI:1916102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D19Ertd721e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225896 MGI:1289301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI462493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107197 MGI:2147553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 91 ESTs, 1 Protein

name	1810009A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66276 MGI:1913526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109077 MGI:1923578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ganab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14376 MGI:1097667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gat3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72727 MGI:1919977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rom1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19881 MGI:97998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eml3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225898 MGI:2387612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mta2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23942 MGI:1346340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tut1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70044 MGI:1917294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eef1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67160 MGI:1914410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahnak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66395 MGI:1316648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Scgb1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22287 MGI:98919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asrgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66514 MGI:1913764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621699 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621699 MGI:3644748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1534 ESTs, 5 Proteins

name	LOC100040104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC623810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Pcna-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18540 MGI:97505
definition	note : proliferating cell nuclear antigen pseudogene 2 pseudo : _no_value

name	LOC100040130 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040143 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040152 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Stxbp3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619371 MGI:3586869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins

name	LOC623688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100040192 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC433217 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270345 GeneID:433217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 101 ESTs, 8 Proteins product : similar to nitrogen fixation cluster-like transcript_id : XM_001473815.1

name	Slc22a19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450130 GeneID:207151 MGI:2442751
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion transporter), member 19 transcript_id : NM_144785.1

name	BC014805 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122800 GeneID:236149 MGI:2385316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC014805 transcript_id : NM_146232.1

name	AB056442 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405827 GeneID:171405 MGI:3042283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 13 Proteins product : cDNA sequence AB056442 transcript_id : XM_984546.1

name	EG434674 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345757 GeneID:434674 MGI:3645714
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434674 transcript_id : NM_001013820.2

name	LOC100039705 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270340 GeneID:100039705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to pol polyprotein transcript_id : XM_001473723.1

name	D630002G06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344222 GeneID:236293 MGI:3605624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D630002G06 gene transcript_id : NM_172776.2

name	C730048C13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358998 GeneID:319800 MGI:2442750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730048C13 gene transcript_id : NM_177002.3

name	EG623402 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405831 GeneID:623402 MGI:3646016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG623402 transcript_id : XM_887851.2

name	Slc22a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345666 GeneID:19879 MGI:1336187
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion transporter), member 8 transcript_id : NM_031194.3

name	Slc22a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982136 GeneID:18399 MGI:892001
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion transporter), member 6 transcript_id : NM_008766.2

name	Chrm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542387 GeneID:12669 MGI:88396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, muscarinic 1, CNS transcript_id : NM_007698.2

name	Slc3a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385690 GeneID:17254 MGI:96955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 transcript_id : NM_008577.3

name	Wdr74 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527373 GeneID:107071 MGI:2147427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 74 transcript_id : NM_134139.1

name	1700092M07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405833 GeneID:74307 MGI:1921557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : RIKEN cDNA 1700092M07 gene transcript_id : XM_897786.2

name	Stx5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328464 GeneID:56389 MGI:1928483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 5A transcript_id : NM_019829.3

name	LOC100039902 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270343 GeneID:100039902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039902 transcript_id : XM_001474163.1

name	Nxf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980797 GeneID:53319 MGI:1858330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 1 homolog (S. cerevisiae) transcript_id : NM_016813.2

name	0610006I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385261 GeneID:66836 MGI:1914086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610006I08 gene transcript_id : NM_025791.1

name	1810059G22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353761 GeneID:67706 MGI:1914956
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810059G22 gene transcript_id : NM_026325.2

name	Taf6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122596 GeneID:225895 MGI:2444957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor transcript_id : NM_146092.1

name	Polr2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802245 GeneID:67710 MGI:1914960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide G transcript_id : NM_026329.2

name	Zbtb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802199 GeneID:75291 MGI:1922541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 3 transcript_id : NM_133759.2

name	Ttc9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378463 GeneID:70387 MGI:1917637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 9C transcript_id : NM_027412.3

name	Hnrpul2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487098 GeneID:68693 MGI:1915943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein U-like 2 transcript_id : NM_001081196.1

name	Gng3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579907 GeneID:14704 MGI:102704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 3 subunit transcript_id : NM_010316.3

name	Bscl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475903 GeneID:14705 MGI:1298392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bernardinelli-Seip congenital lipodystrophy 2 homolog (human) transcript_id : NM_008144.3

name	1110067I12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311555 GeneID:68852 MGI:1916102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110067I12 gene transcript_id : NM_001013019.2

name	D19Ertd721e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122590 GeneID:225896 MGI:1289301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 19, ERATO Doi 721, expressed transcript_id : NM_146093.1

name	AI462493 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405835 GeneID:107197 MGI:2147553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 91 ESTs, 1 Protein product : expressed sequence AI462493, transcript variant 1 transcript_id : XM_887080.2

name	1810009A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370464 GeneID:66276 MGI:1913526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810009A15 gene transcript_id : NM_025463.2

name	Ints5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341150 GeneID:109077 MGI:1923578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 5 transcript_id : NM_176843.2

name	Ganab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679890 GeneID:14376 MGI:1097667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha glucosidase 2 alpha neutral subunit transcript_id : NM_008060.1

name	B3gat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980750 GeneID:72727 MGI:1919977
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) transcript_id : NM_024256.2

name	Rom1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374669 GeneID:19881 MGI:97998
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rod outer segment membrane protein 1 transcript_id : NM_009073.3

name	Eml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450110 GeneID:225898 MGI:2387612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : echinoderm microtubule associated protein like 3 transcript_id : NM_144872.1

name	Mta2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491879 GeneID:23942 MGI:1346340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metastasis-associated gene family, member 2 transcript_id : NM_011842.3

name	Tut1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350735 GeneID:70044 MGI:1917294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : terminal uridylyl transferase 1, U6 snRNA-specific transcript_id : NM_197993.2

name	Eef1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345473 GeneID:67160 MGI:1914410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation elongation factor 1 gamma transcript_id : NM_026007.4

name	Ahnak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403606 GeneID:66395 MGI:1316648
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AHNAK nucleoprotein (desmoyokin) transcript_id : NM_001039959.1

name	Ahnak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61743960 GeneID:66395 MGI:1316648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AHNAK nucleoprotein (desmoyokin) transcript_id : NM_009643.1

name	Scgb1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053927 GeneID:22287 MGI:98919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretoglobin, family 1A, member 1 (uteroglobin) transcript_id : NM_011681.2

name	Asrgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803298 GeneID:66514 MGI:1913764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparaginase like 1 transcript_id : NM_025610.3

name	LOC100040104 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270349 GeneID:100040104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040104 transcript_id : XM_001474095.1

name	LOC623810 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270351 GeneID:623810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to steroid-binding protein C1 transcript_id : XM_001474111.1

name	LOC100040130 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270353 GeneID:100040130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to prostatic steroid binding protein transcript_id : XM_001474129.1

name	LOC100040137 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270355 GeneID:100040137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to steroid-binding protein C1 transcript_id : XM_001474140.1

name	LOC100040143 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270357 GeneID:100040143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to steroid-binding protein C1 transcript_id : XM_001474156.1

name	LOC100040152 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270359 GeneID:100040152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to pol protein transcript_id : XM_001474171.1

name	Stxbp3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270361 GeneID:619371 MGI:3586869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins product : syntaxin-binding protein 3B transcript_id : XM_001474190.1

name	LOC623688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270363 GeneID:623688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to prostatic steroid binding protein transcript_id : XM_001474206.1

name	LOC100040178 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270365 GeneID:100040178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to prostatic steroid-binding protein C1 chain transcript_id : XM_001474226.1

name	LOC100040192 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270367 GeneID:100040192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040192 transcript_id : XM_001474243.1

name	LOC433217 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270346 GeneID:433217
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473865.1

name	Slc22a19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450131 CCDS:CCDS29532.1 GeneID:207151 MGI:2442751
definition	codon_start : 1 note : solute carrier family 22 (organic cation transporter), member 19 product : solute carrier family 22 (organic anion transporter), member 19 protein_id : NP_659034.1

name	BC014805 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122801 CCDS:CCDS29533.1 GeneID:236149 MGI:2385316
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC236149 protein_id : NP_666344.1

name	AB056442 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270337 GeneID:171405 MGI:3042283
definition	codon_start : 1 product : organic anion transporter 6 protein_id : XP_989640.2

name	EG434674 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701504 CCDS:CCDS29534.1 GeneID:434674 MGI:3645714
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC434674 protein_id : NP_001013842.1

name	LOC100039705 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270341 GeneID:100039705
definition	codon_start : 1 product : similar to pol polyprotein protein_id : XP_001473773.1

name	D630002G06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370150 CCDS:CCDS29535.1 GeneID:236293 MGI:3605624
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC236293 protein_id : NP_766364.1

name	C730048C13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892857 CCDS:CCDS29536.1 GeneID:319800 MGI:2442750
definition	codon_start : 1 product : integral membrane transport protein UST1R protein_id : NP_795976.1

name	EG623402 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405832 GeneID:623402 MGI:3646016
definition	codon_start : 1 product : similar to adenine nucleotide translocator protein_id : XP_892944.2

name	Slc22a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543719 CCDS:CCDS29537.1 GeneID:19879 MGI:1336187
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : organic anion transporter 3; reduced in osteosclerosis transporter product : solute carrier family 22 member 8 protein_id : NP_112471.2

name	Slc22a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982137 CCDS:CCDS29538.1 GeneID:18399 MGI:892001
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008514 - organic anion transporter activity [Evidence ISS] [Evidence IDA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IDA]; GO:0015711 - organic anion transport [Evidence ISS]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 note : organic cationic transporter-like 1 product : solute carrier family 22 member 6 protein_id : NP_032792.2

name	Chrm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542388 CCDS:CCDS29539.1 GeneID:12669 MGI:88396
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0040012 - regulation of locomotion [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : AChR M1; muscarinic acetylcholine receptor 1; m1 muscarinic acetylcholine receptor protein product : cholinergic receptor, muscarinic 1, CNS protein_id : NP_031724.2

name	Slc3a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560670 CCDS:CCDS29540.1 GeneID:17254 MGI:96955
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0043169 - cation binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CD98 antigen; antigen identified by monoclonal antibodies 4F2; CD98 heavy chain; type II transmembrane protein product : solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 protein_id : NP_032603.2

name	Wdr74 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527374 CCDS:CCDS29541.1 GeneID:107071 MGI:2147427
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : WD repeat domain 74 protein_id : NP_598900.1

name	1700092M07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998213 GeneID:74307 MGI:1921557
definition	codon_start : 1 product : hypothetical protein LOC74307 protein_id : XP_902879.1

name	Stx5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328465 CCDS:CCDS29542.1 GeneID:56389 MGI:1928483
definition	GO_component : GO:0000139 - Golgi membrane [Evidence TAS] GO_process : GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 exception : mismatches in translation product : syntaxin 5 protein_id : NP_062803.3

name	LOC100039902 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270344 GeneID:100039902
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474213.1

name	Nxf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980798 CCDS:CCDS29543.1 GeneID:53319 MGI:1858330
definition	GO_component : GO:0042405 - nuclear inclusion body [Evidence IDA]; GO:0005643 - nuclear pore [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005487 - nucleocytoplasmic transporter activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IPI]; GO:0006405 - RNA export from nucleus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : tip associating protein; Mex 67 homolog; tip associated protein; modifier of vibrator 1 product : nuclear RNA export factor 1 protein_id : NP_058093.2

name	0610006I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385262 CCDS:CCDS29544.1 GeneID:66836 MGI:1914086
definition	codon_start : 1 product : hypothetical protein LOC66836 protein_id : NP_080067.1

name	1810059G22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385822 CCDS:CCDS29545.1 GeneID:67706 MGI:1914956
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67706 protein_id : NP_080601.1

name	Taf6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122597 CCDS:CCDS29546.1 GeneID:225895 MGI:2444957
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0016986 - transcription initiation factor activity [Evidence IEA] GO_process : GO:0015671 - oxygen transport [Evidence IEA]; GO:0051090 - regulation of transcription factor activity [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 product : TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor protein_id : NP_666204.1

name	Polr2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385826 CCDS:CCDS29547.1 GeneID:67710 MGI:1914960
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA] codon_start : 1 product : polymerase (RNA) II (DNA directed) polypeptide G protein_id : NP_080605.1

name	Zbtb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789327 CCDS:CCDS29548.1 GeneID:75291 MGI:1922541
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 3 protein_id : NP_598520.1

name	Ttc9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625776 CCDS:CCDS29549.1 GeneID:70387 MGI:1917637
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 9C protein_id : NP_081688.2

name	Hnrpul2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487099 GeneID:68693 MGI:1915943
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein U-like 2 protein_id : NP_001074665.1

name	Gng3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754022 CCDS:CCDS29550.1 GeneID:14704 MGI:102704
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 3 subunit protein_id : NP_034446.1

name	Bscl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949041 CCDS:CCDS29551.1 GeneID:14705 MGI:1298392
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : G protein gamma 3 linked product : seipin protein_id : NP_032170.2

name	1110067I12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846117 GeneID:68852 MGI:1916102
definition	codon_start : 1 product : hypothetical protein LOC68852 protein_id : NP_001013037.1

name	D19Ertd721e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122591 CCDS:CCDS29553.1 GeneID:225896 MGI:1289301
definition	codon_start : 1 product : 2B28 protein_id : NP_666205.1

name	AI462493 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998119 GeneID:107197 MGI:2147553
definition	codon_start : 1 product : hypothetical protein LOC107197 isoform 1 protein_id : XP_892173.1

name	1810009A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384876 CCDS:CCDS29555.1 GeneID:66276 MGI:1913526
definition	codon_start : 1 product : hypothetical protein LOC66276 protein_id : NP_079739.1

name	Ints5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849895 CCDS:CCDS29556.1 GeneID:109077 MGI:1923578
definition	GO_component : GO:0032039 - integrator complex [Evidence ISS] GO_process : GO:0016180 - snRNA processing [Evidence ISS] codon_start : 1 product : integrator complex subunit 5 protein_id : NP_789813.1

name	Ganab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679891 CCDS:CCDS29557.1 GeneID:14376 MGI:1097667
definition	GO_component : GO:0017177 - alpha-glucosidase II complex [Evidence IPI]; GO:0005783 - endoplasmic reticulum [Evidence TAS] GO_function : GO:0015926 - glucosidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006491 - N-glycan processing [Evidence TAS] codon_start : 1 note : glucosidase II alpha-subunit; carbohydrate processing enzyme of the endoplasmic reticulum product : alpha glucosidase 2 alpha neutral subunit protein_id : NP_032086.1

name	B3gat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195672 CCDS:CCDS29558.1 GeneID:72727 MGI:1919977
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015018 - galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) protein_id : NP_077218.1

name	Rom1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699400 CCDS:CCDS29559.1 GeneID:19881 MGI:97998
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 exception : mismatches in translation product : rod outer segment membrane protein 1 protein_id : NP_033099.2

name	Eml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450111 CCDS:CCDS29560.1 GeneID:225898 MGI:2387612
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : echinoderm microtubule associated protein like 3 protein_id : NP_659121.1

name	Mta2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491880 CCDS:CCDS29561.1 GeneID:23942 MGI:1346340
definition	GO_component : GO:0016585 - chromatin remodeling complex [Evidence IPI]; GO:0000118 - histone deacetylase complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA]; GO:0016581 - NuRD complex [Evidence IPI] [Evidence IDA] GO_function : GO:0004407 - histone deacetylase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence TAS]; GO:0006323 - DNA packaging [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : metastasis associated 1-like 1; metastais-associated gene family, member 2 product : metastasis-associated protein 2 protein_id : NP_035972.3

name	Tut1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574078 CCDS:CCDS29562.1 GeneID:70044 MGI:1917294
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 21 protein_id : NP_932110.1

name	Eef1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625979 CCDS:CCDS29563.1 GeneID:67160 MGI:1914410
definition	GO_component : GO:0005853 - eukaryotic translation elongation factor 1 complex [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 product : eukaryotic translation elongation factor 1 gamma protein_id : NP_080283.3

name	Ahnak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90403607 GeneID:66395 MGI:1316648
definition	GO_component : GO:0005911 - intercellular junction [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; desmoyokin product : AHNAK nucleoprotein isoform 3 protein_id : NP_001035048.1

name	Ahnak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61743961 CCDS:CCDS29564.1 GeneID:66395 MGI:1316648
definition	GO_component : GO:0005911 - intercellular junction [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; desmoyokin product : AHNAK nucleoprotein isoform 1 protein_id : NP_033773.1

name	Scgb1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755947 GeneID:22287 MGI:98919
definition	GO_function : GO:0019834 - phospholipase A2 inhibitor activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] codon_start : 1 note : uteroglobin; Blastokinin; clara cell secretory protein product : secretoglobin, family 1A, member 1 (uteroglobin) protein_id : NP_035811.1

name	Asrgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560239 CCDS:CCDS29566.1 GeneID:66514 MGI:1913764
definition	codon_start : 1 product : asparaginase like 1 protein_id : NP_079886.2

name	LOC100040104 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270350 GeneID:100040104
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474145.1

name	LOC623810 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270352 GeneID:623810
definition	codon_start : 1 product : similar to steroid-binding protein C1 protein_id : XP_001474161.1

name	LOC100040130 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270354 GeneID:100040130
definition	codon_start : 1 product : similar to prostatic steroid binding protein protein_id : XP_001474179.1

name	LOC100040137 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270356 GeneID:100040137
definition	codon_start : 1 product : similar to steroid-binding protein C1 protein_id : XP_001474190.1

name	LOC100040143 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270358 GeneID:100040143
definition	codon_start : 1 product : similar to steroid-binding protein C1 protein_id : XP_001474206.1

name	LOC100040152 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270360 GeneID:100040152
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001474221.1

name	Stxbp3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270362 GeneID:619371 MGI:3586869
definition	codon_start : 1 product : syntaxin-binding protein 3B protein_id : XP_001474240.1

name	LOC623688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270364 GeneID:623688
definition	codon_start : 1 product : similar to prostatic steroid binding protein protein_id : XP_001474256.1

name	LOC100040178 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270366 GeneID:100040178
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474276.1

name	LOC100040192 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270368 GeneID:100040192
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474293.1

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 10 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 9 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 8 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 7 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 6 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 5 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 4 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 3 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 2 pseudo : _no_value

name	LOC632903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632903
definition	number : 1 pseudo : _no_value

name	LOC623030 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623030
definition	number : 1 pseudo : _no_value

name	EG666601 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666601
definition	number : 1 pseudo : _no_value

name	LOC100040004 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040004
definition	number : 1 pseudo : _no_value

name	LOC100040004 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040004
definition	number : 2 pseudo : _no_value

name	LOC100040004 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040004
definition	number : 3 pseudo : _no_value

name	LOC100040004 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040004
definition	number : 4 pseudo : _no_value

name	LOC100040004 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040004
definition	number : 5 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 11 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 10 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 9 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 8 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 7 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 6 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 5 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 4 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 3 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 2 pseudo : _no_value

name	LOC666612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666612
definition	number : 1 pseudo : _no_value

name	Pcna-ps2 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	note : homology to exons of PCNA gene pseudo : _no_value

name	LOC666543 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270336 GeneID:666543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_031235.1

name	LOC620946 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270338 GeneID:620946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 382 ESTs, 22 Proteins product : similar to hCG2043493 pseudo : _no_value transcript_id : XR_031281.1

name	9530053H05Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270339 GeneID:78425 MGI:1925675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 9530053H05 gene transcript_id : XR_035210.1

name	EG633120 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270348 GeneID:633120 MGI:3644446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 676 ESTs, 14 Proteins product : predicted gene, EG633120 pseudo : _no_value transcript_id : XR_031437.1

name	LOC100039749 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270342 GeneID:100039749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : similar to LOC434536 protein pseudo : _no_value transcript_id : XR_031386.1

name	Snord22 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:144226235 GeneID:83673 MGI:1933385
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, C/D box 22 transcript_id : NR_002896.2

name	LOC100039957 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270347 GeneID:100039957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Interferon induced transmembrane protein 2 pseudo : _no_value transcript_id : XR_031693.1

name	EG621699 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94405836 GeneID:621699 MGI:3644748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1534 ESTs, 5 Proteins product : predicted gene, EG621699 transcript_id : XR_001587.1

clone name	MSMg01-145C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523D22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-422K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-066B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-292M18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-515I11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-487M10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-152J02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503C17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-066B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-515I11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543C13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-103B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-492F09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-046J02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527I08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-057G14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-388G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-206G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321P12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-421J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-371M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540E02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-293I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531A04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-317M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522A10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-338N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516E24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-297M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-293O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295N12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476D04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-309E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-464B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-209J21.b	B6Ng01-209J21.g
ACC	GA028187	GA028188
length	1,078	804
definition	B6Ng01-209J21.b	B6Ng01-209J21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(8,722,912 - 8,724,003)	(8,856,417 - 8,857,220)
sequence	gaattcaactgttacttgagtaccctagaaggaggaaggcagacacatag accaccaccaccattaccaccaccaccaaagaactaaaaaaaaaaaaaaa aaaaatagtaaggaggagcctggagaaatggctcagcatctaagagcact ggtggctcttgctgaggaacaaggtatggctcccagcacccacacgctgg cgcacagtcttctgtaactccagatccagggaatttgacaccctcgtctg gcctcctagggcaccaggtatgtttacacatacacagagagagagagaga gagagagagagagagacagagagagagacagagagagacagagagagaca gagacagagagagagacagacagagacagacagagacagagacacagaga gacacagagagaaagcaacaccaagagacagagagacgcaaaactctcat atacattagaaaataaaaataaaatagcagactagacatagtagaggcag agatacatgaatctctatgaattcaaggccaaccagagctatacacagtg agacccttcccaaaaatcaattttttcgctaaaaaaggatagtgtggaaa gagtaggtcaatcacccgacaggtgggaacctagatgggtgaaccatcca gttcagtgcggaaagagtccaggtgaggctgcctatgtacagcatcttca gcagaagggccagtcatttgtcatgagactaggggcttaacacatactcc actttaaaaaaaaaatacaagaaaattaaaggattataacataagacttt aaaatgtcattacttagaaggagtctgatcacttacctagttaagccaac aaaatcaatatacaaataaaagtaatgaaaaagccacacaagaatattgg gattgaaaaaccaaattatcaaaacagcaatagcaataagttgaaactac tgtgttaaaacatgactttgaaggtaccacaacagtacccaaagctcacg ttacttagcagttaggatactcacaatcagagagaaaaaaaaaaactgta gatattttacgatccaatatctcttagt	gaattcaccctgcttgtcaattctctctctctccaggctgtgtgtggcta tgggtcccaggaggcattgcccttgcgccctgcaagggagggtgatctct acttcccggaggatcgagaagtgagcctggtggagctggcactagccacc aacatccccaagggctgtgcagagacagctgtcagaggttgctgctaggc tccttcctgggcttaggacaggaattgggtggtctgagtggtgctgatgg gccagctttcacgtagggcagaatttggaggggtaaaatcccagctgacc tccatctgtatcatctgattctagttcatgtctcctatctggatggcaaa ggaaacctggcacctcagggatcaggtaaggcagtgtggatagtaaggct gtctagaagagcgtatgctgagcctgaggcaggaatctgtggggccgagg gtgggtgggagtagatggagctgagacccatggaacctacctgatcagag tgcagctggagcctgtgcctgcttgtcctgcttacatggggttcttgtgg gtgggttgtagttctggtcagggggcagcagcctccagaaggctatacct ccatctgtgactacttccttcctgtctcctcacagtgcccagtgcagtgt cttcactgacagatgacctgctcaaatactaccagcaagtgacacgggct gtactgggagatgacccacagctgatgaaggtgaaagagtgagcctgact aggcataaagtgaaagttttaaaacttgagatatttcagctatcttggtt cctg
quality values	Open. Hide. 62 47 27 39 62 37 23 54 62 62 62 62 54 56 54 62 62 62 62 62 62 44 59 62 62 62 62 62 59 62 59 62 43 39 50 28 27 28 33 28 27 34 59 59 59 62 59 62 62 62 59 62 59 59 62 59 62 62 59 62 62 59 59 62 59 62 62 59 59 62 59 59 62 59 59 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 56 62 59 59 62 59 48 49 42 54 59 62 48 62 50 46 38 54 43 48 46 62 62 51 59 59 59 41 62 50 59 59 43 49 51 36 54 43 51 50 59 59 59 50 35 56 59 49 56 56 48 48 62 56 59 62 62 46 62 62 59 59 59 59 62 62 49 59 54 62 62 56 62 62 62 62 59 59 59 59 62 62 62 59 62 59 62 51 56 54 62 62 56 56 62 59 62 62 59 59 62 59 59 59 59 62 59 59 59 59 56 59 59 43 51 54 59 59 62 59 59 62 59 59 62 62 62 62 62 62 62 56 62 59 59 56 59 51 43 50 50 62 59 56 59 56 56 59 62 62 62 62 62 59 59 62 62 59 62 62 49 51 51 59 43 43 54 56 62 50 62 51 59 50 54 45 59 43 51 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 46 62 50 62 62 59 62 62 62 59 59 56 46 62 45 59 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 46 59 62 59 59 62 56 62 62 59 62 59 62 56 62 59 59 59 59 59 43 49 56 62 47 47 44 62 56 62 62 62 56 62 54 54 47 62 56 62 62 45 47 62 56 62 56 62 62 54 47 62 47 62 56 62 62 62 62 62 43 62 62 62 62 62 62 30 27 50 21 50 51 56 56 56 62 51 47 62 62 62 54 47 54 56 43 47 50 62 56 30 47 38 40 46 32 40 47 41 56 56 56 56 62 43 62 56 62 56 62 62 62 35 56 62 62 62 46 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 47 40 62 54 52 62 52 54 62 52 47 62 62 54 52 52 52 62 47 36 54 52 52 46 54 58 48 47 52 52 47 42 50 42 58 54 58 52 58 48 47 42 38 46 58 42 41 48 52 52 52 52 40 58 41 48 54 46 58 54 58 54 58 54 58 52 58 47 54 41 44 52 52 48 42 52 52 46 50 54 58 58 52 42 42 47 47 58 58 58 58 58 52 46 37 45 42 40 58 50 50 50 48 49 58 38 25 58 58 51 58 50 58 41 39 54 51 52 51 50 52 53 41 37 41 50 50 50 52 51 50 49 52 49 48 44 42 26 49 58 34 58 58 42 48 42 44 48 48 50 35 28 25 48 49 51 39 49 58 40 23 49 46 50 49 41 46 53 58 50 50 50 51 50 58 53 54 26 49 41 54 50 51 41 39 50 49 31 49 49 40 51 36 19 58 31 50 41 29 39 44 39 53 58 46 39 51 36 41 50 40 50 37 51 38 41 41 46 35 53 23 54 22 31 54 34 26 52 26 37 39 37 22 53 54 42 49 45 34 34 39 53 35 20 35 26 37 42 38 54 54 41 31 51 41 31 31 41 32 53 45 53 40 36 38 41 36 38 33 47 52 39 32 52 44 42 42 39 54 54 54 25 30 31 40 21 20 18 40 34 47 32 38 31 12 47 12 27 31 31 31 34 31 42 29 34 52 33 45 21 29 34 52 31 53 52 35 31 51 51 33 24 45 26 32 20 33 31 30 42 31 40 26 20 41 31 30 31 31 31 31 43 36 42 30 29 30 21 29 28 30 21 30 24 31 27 30 31 35 30 22 12 16 37 30 18 28 24 48 47 26 25 28 14 30 31 43 34 26 27 25 41 24 30 29 46 46 32 28 31 32 15 22 31 9 46 41 39 33 21 24 27 12 16 14 18 13 17 22 33 30 26 27 21 31 14 44 20 25 9 25 15 19 44 41 29 23 18 5 5 24 21 30 31 27 32 21 15 33 38 15 24 16 38 25 10 12 22 29 32 32 11 14 20 12 16 21 12 19 25 21 37 24 32 23 18 18 21 33 17 31 13 16 23 48 39 21 12 11 32 23 30 32 32 48 30 22 15 14 25 26 14 16 29 17 15 18 5 18 18 13 11 10 14 25 26 18 7 26 14 14 23 15 8 27 6 11 14 15 20 27 11 17 8 7 6 14 10 15 6 25 21 17 6 7 10 21 22 10 4 3 3 7 16 27 7 13 9 5 9 19 17 15 4 3 7 25 20 14 17 29 10 14 15 11 6 21 7 22 5 22 24 30 14 16 14 22 7 22 20 8 5 5 15 4 6 15 14 4 8 5 11 10 4 8	Open. Hide. 62 49 39 41 62 47 42 54 62 62 62 62 34 42 38 34 21 21 21 21 32 34 49 62 62 62 62 62 62 62 62 62 62 59 43 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 59 62 33 37 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 54 54 62 62 62 62 49 54 62 62 62 59 59 62 59 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 43 51 50 28 34 43 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 54 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 50 38 38 59 59 47 44 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 47 44 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 54 56 62 62 62 62 62 62 62 62 31 47 47 62 62 39 62 62 62 54 62 54 62 62 56 62 62 62 54 47 62 62 62 56 62 56 62 62 56 62 50 62 62 62 62 47 43 62 62 62 62 62 54 62 62 62 62 62 62 62 54 52 52 52 52 62 62 62 54 47 62 49 52 58 58 58 54 58 47 52 58 58 58 58 58 58 58 52 58 58 54 42 58 54 52 54 52 58 41 46 50 54 52 39 28 50 40 58 52 52 22 14 11 4 6 13 18 46 37 42 35 22 17 17 54 54 22 58 52 54 27 39 24 25 27 32 46 54 33 58 48 49 54 50 41 54 18 19 13 21 17 31 47 47 47 38 50 29 47 58 29 42 47 43 50 53 52 24 53 22 47 34 52 32 50 26 39 17 12 42 31 32 16 26 50 52 58 46 41 47 37 50 39 53 50 39 46 27 27 27 32 41 32 35 39 50 29 52 32 53 53 51 51 41 39 22 24 33 31 32 26 25 28 31 22 11 29 42 34 28 29 14 35 17 24 46 53 34 32 31 31 50 30 37 50 29 49 34 41 32 16 35 17 21 31 24 18 26 37 32 41 37 34 35 37 13 22 13 18 40 20 16 23 34 18 29 45 39 27 54 26 40 40 30 18 31 20 14 31 40 14 13 6 40 40 14 9 7 22 38 31 17 18 39 38 42 22 35 16 23 14 14 28 31 30 18 42 24 21 12 22 8 12 13 18 6 13 6 16 9 5 8 9 18 10 22 29 28 22 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_8722912_8724003
seq2: B6Ng01-209J21.b_47_1124

seq1  GAATTCAACTGTTACTTGAGTACCCTAGAAGGAGGAAGGCAGACACATAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAACTGTTACTTGAGTACCCTAGAAGGAGGAAGGCAGACACATAG  50

seq1  ACCACCACCACCATTACCACCACCACCAAAGAACTAAAAAAAAAAAAAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACCACCACCATTACCACCACCACCAAAGAACTAAAAAAAAAAAAAAA  100

seq1  AAAAATAGTAAGGAGGAGCCTGGAGAAATGGCTCAGCATCTAAGAGCACT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATAGTAAGGAGGAGCCTGGAGAAATGGCTCAGCATCTAAGAGCACT  150

seq1  GGTGGCTCTTGCTGAGGAACAAGGTATGGCTCCCAGCACCCACACGCTGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCTCTTGCTGAGGAACAAGGTATGGCTCCCAGCACCCACACGCTGG  200

seq1  CGCACAGTCTTCTGTAACTCCAGATCCAGGGAATTTGACACCCTCGTCTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCACAGTCTTCTGTAACTCCAGATCCAGGGAATTTGACACCCTCGTCTG  250

seq1  GCCTCCTAGGGCACCAGGTATGTTTACACATACACAGAGAGAGAGAGAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCCTAGGGCACCAGGTATGTTTACACATACACAGAGAGAGAGAGAGA  300

seq1  GAGAGAGAGAGAGAGACAGAGAGAGAGACAGAGAGAGACAGAGAGAGACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGAGAGAGAGACAGAGAGAGAGACAGAGAGAGACAGAGAGAGACA  350

seq1  GAGACAGAGAGAGAGACAGACAGAGACAGACAGAGACAGAGACACAGAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACAGAGAGAGAGACAGACAGAGACAGACAGAGACAGAGACACAGAGA  400

seq1  GACACAGAGAGAAAGCAACACCAAGAGACAGAGAGACGCAAAACTCTCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACAGAGAGAAAGCAACACCAAGAGACAGAGAGACGCAAAACTCTCAT  450

seq1  ATACATTAGAAAATAAAAATAAAATAGCAGACTAGACATAGTAGAGGCAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACATTAGAAAATAAAAATAAAATAGCAGACTAGACATAGTAGAGGCAG  500

seq1  AGATACATGAATCTCTATGAATTCAAGGCCAACCAGAGCTATACACAGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATACATGAATCTCTATGAATTCAAGGCCAACCAGAGCTATACACAGTG  550

seq1  AGACCCTTCCCAAAAATCAATTTTTTCGCTAAAAAAGGATAGTGTGGAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCCTTCCCAAAAATCAATTTTTTCGCTAAAAAAGGATAGTGTGGAAA  600

seq1  GAGTAGGTCAATCACCCGACAGGTGGGAACCTAGATGGGTGAACCATCCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTAGGTCAATCACCCGACAGGTGGGAACCTAGATGGGTGAACCATCCA  650

seq1  GTTCAGTGCGGAAAGAGTCCAGGTGAGGCTGCCTATGTACAGCATCTTCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAGTGCGGAAAGAGTCCAGGTGAGGCTGCCTATGTACAGCATCTTCA  700

seq1  GCAGAAGGGCCAGTCATTTGTCATGAGACTAGGGGCTTAACACATACTCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAAGGGCCAGTCATTTGTCATGAGACTAGGGGCTTAACACATACTCC  750

seq1  ACTTTAAAAAAAAAATACAAGAAAATT-AAGGATTATAACATAAGACTTT  799
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  ACTTTAAAAAAAAAATACAAGAAAATTAAAGGATTATAACATAAGACTTT  800

seq1  AAAATGTCATTACTTAGAAGGAGTCTGATCACTTACCTAGTTAAGCCAAC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATGTCATTACTTAGAAGGAGTCTGATCACTTACCTAGTTAAGCCAAC  850

seq1  AAAATCAATATACAAATAAAAGTAATGAAAAAGCCACACAAGAATATT-G  898
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AAAATCAATATACAAATAAAAGTAATGAAAAAGCCACACAAGAATATTGG  900

seq1  GATTGAAAAACCAAATTATCAAAACAGCAATAGCAATAAGTTGAAACTAC  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGAAAAACCAAATTATCAAAACAGCAATAGCAATAAGTTGAAACTAC  950

seq1  TGTGTTAAAACATGACTTTGAAGGTACCACAACAGTACCCAAAGCTCAAC  998
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  TGTGTTAAAACATGACTTTGAAGGTACCACAACAGTACCCAAAGCTC-AC  999

seq1  GTTACTTAGGCAGTTAAGGATACTCAACCATCCAGAGAGGAAAAAAAAAA  1048
      |||||||| |||||| ||||||||||  ||  |||||||     ||||||
seq2  GTTACTTA-GCAGTT-AGGATACTCA--CAATCAGAGAG-----AAAAAA  1040

seq1  AAAAACTGTAAGATAATTTTTACGATCACAAATATCCTCTTAGT  1092
      ||||||||| |||||  |||||||||  | ||||| ||||||||
seq2  AAAAACTGT-AGATA--TTTTACGAT--CCAATAT-CTCTTAGT  1078

seq1: chr19_8856417_8857220
seq2: B6Ng01-209J21.g_67_870 (reverse)

seq1  CAGGAACC-AGATAGCTGAAAATATCTCAAGTTTTAAAACTTTCACTTTA  49
      |||||||| ||||||||| |||||||||||||||||||||||||||||||
seq2  CAGGAACCAAGATAGCTG-AAATATCTCAAGTTTTAAAACTTTCACTTTA  49

seq1  TGCCTAGTCAGGCTCACTCTTTCACCTTCATCAGCTGTGGGTCATCTCCC  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTAGTCAGGCTCACTCTTTCACCTTCATCAGCTGTGGGTCATCTCCC  99

seq1  AGTACAGCCCGTGTCACTTGCTGGTAGTATTTGAGCAGGTCATCTGTCAG  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACAGCCCGTGTCACTTGCTGGTAGTATTTGAGCAGGTCATCTGTCAG  149

seq1  TGAAGACACTGCACTGGGCACTGTGAGGAGACAGGAAGGAAGTAGTCACA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGACACTGCACTGGGCACTGTGAGGAGACAGGAAGGAAGTAGTCACA  199

seq1  GATGGAGGTATAGCCTTCTGGAGGCTGCTGCCCCCTGACCAGAACTACAA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGAGGTATAGCCTTCTGGAGGCTGCTGCCCCCTGACCAGAACTACAA  249

seq1  CCCACCCACAAGAACCCCATGTAAGCAGGACAAGCAGGCACAGGCTCCAG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACCCACAAGAACCCCATGTAAGCAGGACAAGCAGGCACAGGCTCCAG  299

seq1  CTGCACTCTGATCAGGTAGGTTCCATGGGTCTCAGCTCCATCTACTCCCA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCACTCTGATCAGGTAGGTTCCATGGGTCTCAGCTCCATCTACTCCCA  349

seq1  CCCACCCTCGGCCCCACAGATTCCTGCCTCAGGCTCAGCATACGCTCTTC  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACCCTCGGCCCCACAGATTCCTGCCTCAGGCTCAGCATACGCTCTTC  399

seq1  TAGACAGCCTTACTATCCACACTGCCTTACCTGATCCCTGAGGTGCCAGG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGACAGCCTTACTATCCACACTGCCTTACCTGATCCCTGAGGTGCCAGG  449

seq1  TTTCCTTTGCCATCCAGATAGGAGACATGAACTAGAATCAGATGATACAG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCTTTGCCATCCAGATAGGAGACATGAACTAGAATCAGATGATACAG  499

seq1  ATGGAGGTCAGCTGGGATTTTACCCCTCCAAATTCTGCCCTACGTGAAAG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGGTCAGCTGGGATTTTACCCCTCCAAATTCTGCCCTACGTGAAAG  549

seq1  CTGGCCCATCAGCACCACTCAGACCACCCAATTCCTGTCCTAAGCCCAGG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCCCATCAGCACCACTCAGACCACCCAATTCCTGTCCTAAGCCCAGG  599

seq1  AAGGAGCCTAGCAGCAACCTCTGACAGCTGTCTCTGCACAGCCCTTGGGG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGCCTAGCAGCAACCTCTGACAGCTGTCTCTGCACAGCCCTTGGGG  649

seq1  ATGTTGGTGGCTAGTGCCAGCTCCACCAGGCTCACTTCTCGATCCTCCGG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTGGTGGCTAGTGCCAGCTCCACCAGGCTCACTTCTCGATCCTCCGG  699

seq1  GAAGTAGAGATCACCCTCCCTTGCAGGGCGCAAGGGCAATGCCTCCTGGG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTAGAGATCACCCTCCCTTGCAGGGCGCAAGGGCAATGCCTCCTGGG  749

seq1  ACCCATAGCCACACACAGCCTGGAGAGAGAGAGAATTGACAAGCAGGGTG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCATAGCCACACACAGCCTGGAGAGAGAGAGAATTGACAAGCAGGGTG  799

seq1  AATTC  804
      |||||
seq2  AATTC  804

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information