MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-221I19
Chromosome	19 (Build37)
Map Location	41,863,266 - 42,005,798
singlet/doublet	doublet
Overlap gene	Arhgap19, Frat1, Frat2, Rrp12, LOC100042609, Pgam1, Exosc1
Upstream gene	EG668310, EG668311, Ccnj, LOC664819, E030044B06Rik, E130314M14Rik, Zfp518, Blnk, LOC100043155, Dntt, Tmem10, Tll2, Tm9sf3, Pik3ap1, LOC100043167, EG627352, Lcor, AI606181, Slit1
Downstream gene	Zdhhc16, Mms19l, Ubtd1, Ankrd2, 0610010D20Rik, 4933411K16Rik, BC023055, Pi4k2a, Avpi1, Marveld1, EG628994, LOC100042633, Zfyve27, Sfrp5, 4933417O08Rik, Crtac1, D19Ertd386e, Loxl4, 4833409A17Rik, Hps1, LOC545291
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG668310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668310 MGI:3645359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	EG668311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668311 MGI:3645360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ccnj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240665 MGI:2443297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664819 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	E030044B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381223 MGI:2686464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	E130314M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:449522 MGI:3053211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	Zfp518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72672 MGI:1919922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blnk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17060 MGI:96878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043155 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Dntt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21673 MGI:98659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226115 MGI:2657025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tll2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24087 MGI:1346044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm9sf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107358 MGI:1914262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3ap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83490 MGI:1933177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins

name	EG627352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627352 MGI:3648734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 mRNAs, 1030 ESTs, 3 Proteins

name	Lcor (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212391 MGI:2443930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI606181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226118 MGI:2147586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20562 MGI:1315203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71085 MGI:1918335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14296 MGI:109450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212398 MGI:2673967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rrp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107094 MGI:2147437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042609 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Pgam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18648 MGI:97552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66583 MGI:1913833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74168 MGI:1921418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mms19l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72199 MGI:1919449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubtd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226122 MGI:2385092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56642 MGI:1861447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610010D20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67432 MGI:1914682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933411K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66765 MGI:1914015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs, 2 Proteins

name	BC023055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226123 MGI:2449568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pi4k2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84095 MGI:1934031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Avpi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69534 MGI:1916784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Marveld1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277010 MGI:2147570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 45 ESTs, 2 Proteins

name	EG628994 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628994 MGI:3647230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042633 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042633
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Zfyve27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319740 MGI:1919602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54612 MGI:1860298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933417O08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71146 MGI:1918396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crtac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72832 MGI:1920082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D19Ertd386e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52013 MGI:1196316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Loxl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67573 MGI:1914823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833409A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74580 MGI:1921830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192236 MGI:2177763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406003 GeneID:668310 MGI:3645359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG668310 transcript_id : XM_001000795.1

name	EG668311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406005 GeneID:668311 MGI:3645360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG668311 transcript_id : XM_001000809.1

name	Ccnj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348879 GeneID:240665 MGI:2443297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin J transcript_id : NM_172839.2

name	LOC664819 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270470 GeneID:664819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC664819 transcript_id : XM_001478451.1

name	E030044B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406007 GeneID:381223 MGI:2686464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA E030044B06 gene transcript_id : XM_358529.3

name	E130314M14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406009 GeneID:449522 MGI:3053211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : RIKEN cDNA E130314M14 gene transcript_id : XM_001000855.1

name	Zfp518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133507239 GeneID:72672 MGI:1919922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 518 transcript_id : NM_028319.1

name	Blnk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130752 GeneID:17060 MGI:96878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell linker transcript_id : NM_008528.4

name	Dntt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734846 GeneID:21673 MGI:98659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxynucleotidyltransferase, terminal transcript_id : NM_009345.2

name	Dntt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734840 GeneID:21673 MGI:98659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxynucleotidyltransferase, terminal transcript_id : NM_001043228.1

name	Tmem10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943843 GeneID:226115 MGI:2657025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 10 transcript_id : NM_153520.1

name	Tll2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385783 GeneID:24087 MGI:1346044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tolloid-like 2 transcript_id : NM_011904.2

name	Tm9sf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490411 GeneID:107358 MGI:1914262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane 9 superfamily member 3 transcript_id : NM_133352.2

name	Pik3ap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872201 GeneID:83490 MGI:1933177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoinositide-3-kinase adaptor protein 1 transcript_id : NM_031376.2

name	LOC100043167 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270550 GeneID:100043167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 2 Proteins product : similar to developmental pluripotency-associated 2 transcript_id : XM_001479887.1

name	EG627352 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270552 GeneID:627352 MGI:3648734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 mRNAs, 1030 ESTs, 3 Proteins product : predicted gene, EG627352 transcript_id : XM_894313.3

name	Lcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348649 GeneID:212391 MGI:2443930
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligand dependent nuclear receptor corepressor transcript_id : NM_172154.3

name	Slit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801919 GeneID:20562 MGI:1315203
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slit homolog 1 (Drosophila) transcript_id : NM_015748.2

name	Arhgap19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803334 GeneID:71085 MGI:1918335
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 19 transcript_id : NM_027667.2

name	Frat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37059811 GeneID:14296 MGI:109450
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frequently rearranged in advanced T-cell lymphomas transcript_id : NM_008043.2

name	Frat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802346 GeneID:212398 MGI:2673967
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frequently rearranged in advanced T-cell lymphomas 2 transcript_id : NM_177603.2

name	Rrp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40804766 GeneID:107094 MGI:2147437
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal RNA processing 12 homolog (S. cerevisiae) transcript_id : NM_199447.2

name	Pgam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326545 GeneID:18648 MGI:97552
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoglycerate mutase 1 transcript_id : NM_023418.2

name	Exosc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981244 GeneID:66583 MGI:1913833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 1 transcript_id : NM_025644.3

name	Zdhhc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963806 GeneID:74168 MGI:1921418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 16 transcript_id : NM_023740.1

name	Mms19l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892783 GeneID:72199 MGI:1919449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MMS19 (MET18 S. cerevisiae)-like transcript_id : NM_028152.3

name	Ubtd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893218 GeneID:226122 MGI:2385092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin domain containing 1 transcript_id : NM_145500.3

name	Ankrd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910129 GeneID:56642 MGI:1861447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 2 (stretch responsive muscle) transcript_id : NM_020033.1

name	0610010D20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385655 GeneID:67432 MGI:1914682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610010D20 gene transcript_id : NM_026152.1

name	4933411K16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405931 GeneID:66765 MGI:1914015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 ESTs, 2 Proteins product : RIKEN cDNA 4933411K16 gene transcript_id : XM_894441.2

name	BC023055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674221 GeneID:226123 MGI:2449568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023055 transcript_id : NM_198108.1

name	Pi4k2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262158 GeneID:84095 MGI:1934031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 4-kinase type 2 alpha transcript_id : NM_145501.2

name	Avpi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802580 GeneID:69534 MGI:1916784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine vasopressin-induced 1 transcript_id : NM_027106.2

name	EG628994 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406013 GeneID:628994 MGI:3647230
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG628994 transcript_id : XM_915567.2

name	LOC100042633 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270479 GeneID:100042633
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042633 transcript_id : XM_001478549.1

name	Zfyve27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341138 GeneID:319740 MGI:1919602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 27 transcript_id : NM_177319.2

name	Sfrp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560420 GeneID:54612 MGI:1860298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secreted frizzled-related sequence protein 5 transcript_id : NM_018780.2

name	4933417O08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037238 GeneID:71146 MGI:1918396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933417O08 gene transcript_id : NM_027694.1

name	Crtac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350981 GeneID:72832 MGI:1920082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage acidic protein 1 transcript_id : NM_145123.4

name	D19Ertd386e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803500 GeneID:52013 MGI:1196316
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 19, ERATO Doi 386, expressed transcript_id : NM_177464.3

name	Loxl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48976072 GeneID:67573 MGI:1914823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysyl oxidase-like 4 transcript_id : NM_053083.2

name	4833409A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125858597 GeneID:74580 MGI:1921830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833409A17 gene transcript_id : NM_029011.2

name	Hps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722683 GeneID:192236 MGI:2177763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hermansky-Pudlak syndrome 1 homolog (human) transcript_id : NM_019424.2

name	LOC545291 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124486930 GeneID:545291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to Heparanase-2 (Hpa2) transcript_id : NM_001081257.1

name	EG668310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406004 GeneID:668310 MGI:3645359
definition	codon_start : 1 product : similar to RIKEN cDNA 5730509K17 gene protein_id : XP_001000795.1

name	EG668311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406006 GeneID:668311 MGI:3645360
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000809.1

name	Ccnj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370262 CCDS:CCDS29806.1 GeneID:240665 MGI:2443297
definition	codon_start : 1 product : cyclin J protein_id : NP_766427.1

name	LOC664819 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270471 GeneID:664819
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478501.1

name	E030044B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406008 GeneID:381223 MGI:2686464
definition	codon_start : 1 product : hypothetical protein protein_id : XP_358529.3

name	E130314M14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406010 GeneID:449522 MGI:3053211
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000855.1

name	Zfp518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133507240 GeneID:72672 MGI:1919922
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 518 protein_id : NP_082595.1

name	Blnk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982209 GeneID:17060 MGI:96878
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : lymphocyte antigen 57; B-cell linker protein product : B-cell linker protein_id : NP_032554.2

name	Dntt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734847 CCDS:CCDS29807.1 GeneID:21673 MGI:98659
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003912 - DNA nucleotidylexotransferase activity [Evidence IDA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006259 - DNA metabolism [Evidence IDA]; GO:0006304 - DNA modification [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; terminal deoxynucleotidyl transferase product : terminal deoxynucleotidyltransferase isoform 1 protein_id : NP_033371.2

name	Dntt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734841 GeneID:21673 MGI:98659
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003912 - DNA nucleotidylexotransferase activity [Evidence IDA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006259 - DNA metabolism [Evidence IDA]; GO:0006304 - DNA modification [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; terminal deoxynucleotidyl transferase product : terminal deoxynucleotidyltransferase isoform 2 protein_id : NP_001036693.1

name	Tmem10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943844 GeneID:226115 MGI:2657025
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : transmembrane protein TMP10 product : transmembrane protein 10 protein_id : NP_705740.1

name	Tll2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755807 GeneID:24087 MGI:1346044
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : tolloid-like 2 protein_id : NP_036034.1

name	Tm9sf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111162 CCDS:CCDS29808.1 GeneID:107358 MGI:1914262
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : SM-11044 binding protein product : transmembrane protein 9 superfamily member 3 protein_id : NP_579930.1

name	Pik3ap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878195 GeneID:83490 MGI:1933177
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005066 - transmembrane receptor protein tyrosine kinase signaling protein activity [Evidence IDA] codon_start : 1 note : B cell phosphoinositide 3-kinase adaptor product : phosphoinositide-3-kinase adaptor protein 1 protein_id : NP_113553.1

name	LOC100043167 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270551 GeneID:100043167
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479937.1

name	EG627352 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998543 GeneID:627352 MGI:3648734
definition	codon_start : 1 product : similar to HSPC008 protein_id : XP_899406.1

name	Lcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024345 CCDS:CCDS29810.1 GeneID:212391 MGI:2443930
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : transcription factor MLR2 product : Mblk1-related protein-2 protein_id : NP_742166.1

name	Slit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:35215323 CCDS:CCDS29812.1 GeneID:20562 MGI:1315203
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005102 - receptor binding [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IDA] [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0040023 - establishment of nucleus localization [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 exception : mismatches in translation function : axon guidance molecule product : slit homolog 1 protein_id : NP_056563.1

name	Arhgap19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037233 GeneID:71085 MGI:1918335
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Rho GTPase activating protein 19 protein_id : NP_081943.1

name	Frat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37059812 GeneID:14296 MGI:109450
definition	GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : GSK-3 binding protein FRAT1 protein_id : NP_032069.2

name	Frat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243970 CCDS:CCDS29813.1 GeneID:212398 MGI:2673967
definition	GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : frequently rearranged in advanced T-cell lymphomas 2 protein_id : NP_808271.1

name	Rrp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789092 CCDS:CCDS29814.1 GeneID:107094 MGI:2147437
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : ribosomal RNA processing 12 homolog protein_id : NP_955518.1

name	Pgam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326546 CCDS:CCDS29815.1 GeneID:18648 MGI:97552
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016868 - intramolecular transferase activity, phosphotransferases [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004619 - phosphoglycerate mutase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : phosphoglycerate mutase 1 protein_id : NP_075907.2

name	Exosc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267446 CCDS:CCDS29816.1 GeneID:66583 MGI:1913833
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence ISS]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : exosome component 1 protein_id : NP_079920.1

name	Zdhhc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963807 CCDS:CCDS29817.1 GeneID:74168 MGI:1921418
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Abl-philin 2 protein_id : NP_076229.1

name	Mms19l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15100156 CCDS:CCDS29818.1 GeneID:72199 MGI:1919449
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : MMS19 (MET18 S. cerevisiae)-like protein_id : NP_082428.1

name	Ubtd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703984 CCDS:CCDS29819.1 GeneID:226122 MGI:2385092
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquitin domain containing 1 protein_id : NP_663475.1

name	Ankrd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910130 GeneID:56642 MGI:1861447
definition	GO_component : GO:0030017 - sarcomere [Evidence IDA] codon_start : 1 product : ankyrin repeat domain 2 protein_id : NP_064417.1

name	0610010D20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385656 CCDS:CCDS29820.1 GeneID:67432 MGI:1914682
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67432 protein_id : NP_080428.1

name	4933411K16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998549 GeneID:66765 MGI:1914015
definition	codon_start : 1 product : hypothetical protein LOC66765 protein_id : XP_899534.1

name	BC023055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674222 GeneID:226123 MGI:2449568
definition	codon_start : 1 product : hypothetical protein LOC226123 protein_id : NP_932776.1

name	Pi4k2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703986 CCDS:CCDS29821.1 GeneID:84095 MGI:1934031
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : phosphatidylinositol 4-kinase type II-like product : phosphatidylinositol 4-kinase type 2 alpha protein_id : NP_663476.1

name	Avpi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526465 CCDS:CCDS29822.1 GeneID:69534 MGI:1916784
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA] codon_start : 1 product : Esau protein protein_id : NP_081382.1

name	EG628994 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999391 GeneID:628994 MGI:3647230
definition	codon_start : 1 product : similar to EG628994 protein protein_id : XP_920660.1

name	LOC100042633 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270480 GeneID:100042633
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478599.1

name	Zfyve27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893433 CCDS:CCDS29825.1 GeneID:319740 MGI:1919602
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger, FYVE domain containing 27 protein_id : NP_796293.1

name	Sfrp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560421 CCDS:CCDS29826.1 GeneID:54612 MGI:1860298
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : secreted frizzled-related protein 5 product : secreted frizzled-related sequence protein 5 protein_id : NP_061250.2

name	4933417O08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037239 CCDS:CCDS29827.1 GeneID:71146 MGI:1918396
definition	codon_start : 1 product : hypothetical protein LOC71146 protein_id : NP_081970.1

name	Crtac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626040 CCDS:CCDS29828.1 GeneID:72832 MGI:1920082
definition	codon_start : 1 product : cartilage acidic protein 1 protein_id : NP_660105.3

name	D19Ertd386e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29126193 CCDS:CCDS29829.1 GeneID:52013 MGI:1196316
definition	codon_start : 1 product : growth inhibition and differentiation related protein 86 protein_id : NP_803415.1

name	Loxl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48976073 CCDS:CCDS29830.1 GeneID:67573 MGI:1914823
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004720 - protein-lysine 6-oxidase activity [Evidence IDA]; GO:0005044 - scavenger receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ysyl oxidase-like 4 product : lysyl oxidase-like 4 protein_id : NP_444313.2

name	4833409A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125858598 GeneID:74580 MGI:1921830
definition	GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016705 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen [Evidence IEA] GO_process : GO:0016117 - carotenoid biosynthesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74580 protein_id : NP_083287.2

name	Hps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506573 GeneID:192236 MGI:2177763
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence ISS] GO_process : GO:0030318 - melanocyte differentiation [Evidence IMP]; GO:0006996 - organelle organization and biogenesis [Evidence IMP] codon_start : 1 note : Hermansky-Pudlak syndrome protein homolog product : pale ear protein_id : NP_062297.1

name	LOC545291 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124486931 GeneID:545291
definition	codon_start : 1 product : similar to Heparanase-2 (Hpa2) protein_id : NP_001074726.1

name	LOC100043155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043155
definition	number : 1 pseudo : _no_value

name	LOC100042609 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042609
definition	number : 1 pseudo : _no_value

name	LOC100042609 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042609
definition	number : 2 pseudo : _no_value

name	LOC100042609 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042609
definition	number : 3 pseudo : _no_value

name	AI606181 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270328 GeneID:226118 MGI:2147586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI606181 transcript_id : XR_035116.1

name	Marveld1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270553 GeneID:277010 MGI:2147570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 45 ESTs, 2 Proteins product : MARVEL (membrane-associating) domain containing 1 transcript_id : XR_035422.1

clone name	MSMg01-412D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212J22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-221I19.b	B6Ng01-221I19.g
ACC	GA036811	GA036812
length	757	1,008
definition	B6Ng01-221I19.b	B6Ng01-221I19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(42,005,042 - 42,005,798)	(41,863,266 - 41,864,258)
sequence	gaattcagtagtcgcctggctatatagggctgttgaagtttatttggatg tgttgactcaggcctttaatcccagtacttagaaggcagaggcaggtaga tacgtgaggccagcctggtctactgagtggtttcagaacagccagggctt cctagagaaaccctgtctcaaaagaaaagaaaaatgaaaattttattttt agccaggctacaatatagatacgattcatcctatctgtggtctcagtatc tggaagctgaacagagttattggacagtagttcaagaccagaataggcta cagagtgagaccctgtaccccacagtcccaacgctcttcacattttaagt aatcagtagcaaatcgtggttagtgactgccatattggctggcataggac ttttgtttggggggtgtgggaaagtgatggactcctctgaagtacaccct tgggtctagcaaatgattctttattttgttttgttttatcgcgtgtgaat agtcaccttgtctgcgtcatatgcatgcctggtgccacaatgcctaggga agggtgtggcaccccctgggactgaaggcgcagatgactataggccctcg tgtgcctgctaggaattgaatccagaccctctaccagggcagccagtgct ctgtaactgctgagccatctgtccagccccaggaaatgacatcacagaaa gttttgtaggcataggtgcacactcctcagatggtgcttgatatgtgggg gatctca	gaattcctggaggcataaacttttcttatttaagcacactgatatttaat ttaaaaataagaacctgggctggtgagatggctcagtgggtaagagcacc cgactgctcttctgaaggtcaggagttcaaatcccagcaaccacatggtg gctcacaaccatccgtaacgagatctgactccctcttctggagtttctga agatagctacagtgtacttacatataataaataaataaatcttaaaaaaa aaaaaaaataagaacctgaaggtgattgtcaaatcatgacaattattact agagttgatataggatataatctttttttcttttctttaacatttttaat aattcatgtctttccatgtgtatgtgtgtgggttacacatatgtggtggt gcatatgtatgaggctatggtctttgaatgtttaaatatttcagcctgcc taatgattccctcatatttaataaaataaaacagggcccctttaatacct tatcaaaagtagtacccacacttcctggctgactctgcggcctgtcccat aggagggaagtcatacccaatactgtcagcctggtcaaaagcccatggct aggggggggcccacaggccttcaggagcaacctactattgttttgctaaa ttatccagctgtcaaactgtcttctaaatatttatgctacagatgtgagc tgctttcagcctcagccagaaagccttctttttcaagtgggcatcagtag atgtagaaactcacaatggtcactgtgcttgcaacagctgcttgtgagtg ctcaaccctacacggtacgtcagtatcaacatttctccccaggagattca aggaacttggacaaaaaaaaaaaaaaaaaacccaaaaaccaactgtagga gccagcgattgtggtggaatgctgttgaatgtgcttttctttctggagat gaagttgtattgcccaccacttaccagcctcccagcagctgttggggtgc ctgtcaag
quality values	Open. Hide. 47 20 23 35 54 25 15 39 54 54 40 54 58 34 54 58 62 62 47 62 47 52 62 56 62 54 62 62 49 62 62 56 38 38 26 18 18 27 56 56 62 56 54 62 62 62 43 49 59 62 62 62 62 62 62 59 59 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 59 54 56 59 59 59 59 38 54 62 56 62 59 59 59 59 59 62 62 59 62 62 62 62 62 59 62 62 59 59 62 62 54 59 62 62 62 62 62 62 62 62 62 62 54 62 59 62 59 62 59 54 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 59 59 62 62 54 50 56 48 54 54 56 50 56 59 51 59 48 28 54 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 59 59 62 62 62 62 59 59 62 59 43 51 59 59 59 59 62 62 62 62 59 62 62 62 62 59 51 45 50 34 44 51 51 59 56 44 44 62 62 59 59 59 59 62 45 43 44 24 23 30 16 14 13 21 62 62 62 62 62 62 62 62 56 62 56 47 47 56 39 42 24 19 38 32 56 56 62 56 54 47 62 62 62 56 51 43 56 51 62 51 62 62 62 39 41 62 56 43 37 47 56 37 62 31 42 20 28 8 10 11 12 11 15 47 56 32 56 38 47 47 37 62 41 56 56 43 47 43 24 24 26 38 26 20 22 12 21 14 22 31 20 22 36 31 27 14 35 33 14 31 16 14 34 33 47 42 27 32 49 52 15 52 62 43 48 31 24 24 14 19 39 50 42 31 27 25 41 52 54 25 15 27 35 18 23 24 34 52 26 30 32 23 12 24 28 17 47 24 39 39 33 29 35 30 35 26 28 40 25 32 27 15 25 25 30 16 31 30 35 17 21 21 35 27 42 37 47 36 23 19 33 35 22 13 19 13 27 31 35 52 42 12 21 17 20 15 23 30 32 34 17 8 18 12 12 19 17 25 32 24 32 22 13 22 21 22 43 52 37 38 26 33 21 26 19 19 11 13 26 21 22 25 21 10 11 12 24 27 25 23 9 20 21 20 27 41 29 14 9 23 21 29 27 32 30 14 20 25 9 12 4 6 9 21 21 15 12 13 9 10 14 14 10 6 6 6	Open. Hide. 62 44 51 47 62 62 62 59 62 62 59 59 43 34 23 28 23 25 27 32 45 50 56 62 62 62 62 59 62 62 59 56 59 59 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 59 62 62 54 62 62 62 59 59 43 62 38 59 59 62 62 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 56 56 56 27 62 59 59 62 62 62 62 59 59 62 59 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 51 62 59 62 62 62 62 62 62 62 59 56 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 59 62 62 62 62 59 62 62 62 62 62 62 49 49 62 62 62 62 59 62 62 59 62 56 62 59 59 59 56 56 62 62 62 62 62 62 62 62 62 62 62 62 51 56 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 54 62 62 62 62 62 62 62 62 62 47 51 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 56 56 56 56 56 62 54 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 62 62 43 43 62 62 62 62 62 62 62 49 62 52 62 62 62 62 62 62 62 46 48 54 52 62 42 62 62 62 62 62 52 62 52 52 52 47 25 47 47 58 49 58 54 52 58 54 35 58 40 58 54 40 39 52 46 52 52 58 58 36 37 58 58 46 54 54 58 52 54 50 54 54 58 52 58 39 52 50 50 58 58 58 40 46 58 46 41 48 54 58 42 42 52 42 52 52 52 54 52 58 54 42 54 54 46 46 52 42 52 41 41 42 47 53 32 22 47 32 15 47 47 33 41 58 49 50 53 50 41 25 38 39 33 58 58 58 41 46 41 36 58 52 37 43 40 37 50 39 39 29 50 48 50 32 46 39 51 39 35 39 49 32 53 51 50 53 37 50 58 33 39 41 37 58 35 25 28 37 50 50 40 50 27 28 37 30 50 50 28 51 31 37 35 35 35 49 51 15 39 31 32 49 41 37 39 33 32 52 50 32 25 33 54 51 25 35 46 41 52 42 32 54 54 54 54 29 27 44 31 39 35 42 23 26 35 39 35 31 28 52 42 32 29 34 37 27 52 31 51 51 22 32 19 19 18 19 13 44 31 25 25 26 35 28 40 33 34 30 32 37 37 33 37 32 23 23 31 27 27 33 37 31 31 40 37 31 15 31 31 14 32 42 31 36 34 31 40 45 53 32 31 24 31 14 32 31 41 27 32 31 27 32 42 31 30 34 23 34 40 25 18 23 19 18 30 13 17 36 36 37 40 21 12 6 30 29 16 30 18 18 32 28 29 29 27 41 25 15 18 33 25 40 29 27 26 25 22 31 30 46 46 40 46 41 33 31 37 28 32 32 32 37 13 37 20 31 31 28 32 33 7 15 31 21 24 8 11 8 18 12 12 24 6 25 18 18 18 32 17 30 26 25 20 18 24 11 11 16 16 10 20 7 17 6 10 9 6 10 9 15 32 9 9 16 24 14 20 29 29 22 21 11 32 18 14 15 21 18 10 6 17 11 7 18 19 7 12 16 16 6 8 6 12 14 21 29 9 5 5 6 10 24 32 33 24 8 13 6 14 20 6 8 5 6 13 10 13 7 11 5 5 7 14 10 7 8 36 22 14 16 14 11 22 10 12 6 19 30 20 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_42005042_42005798
seq2: B6Ng01-221I19.b_47_803 (reverse)

seq1  TGAGATCCCCCACCTCTCAAGCACCATCTGAGGAGTGTGCACCTATGCCT  50
      ||||||||||||| | ||||||||||||||||||||||||||||||||||
seq2  TGAGATCCCCCACATATCAAGCACCATCTGAGGAGTGTGCACCTATGCCT  50

seq1  GCAAAACTTTCTGTGATGTCATTTCCTGGGGCTGGACAGATGGCTCAGCA  100
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAACTTTCTGTGATGTCATTTCCTGGGGCTGGACAGATGGCTCAGCA  100

seq1  GTTACAGAGCACTGGCTGCCCTGGTAGAGGGTCTGGATTCAATTCCTAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTACAGAGCACTGGCTGCCCTGGTAGAGGGTCTGGATTCAATTCCTAGC  150

seq1  AGGCACACGAGGGCCTATAGTCATCTGCGCCTTCAGTCCCAGGGGGTGCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCACACGAGGGCCTATAGTCATCTGCGCCTTCAGTCCCAGGGGGTGCC  200

seq1  ACACCCTTCCCTAGGCTTTGTGGCACCAGGCATGCATATGACGCAGACAA  250
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  ACACCCTTCCCTAGGCATTGTGGCACCAGGCATGCATATGACGCAGACAA  250

seq1  GGTGACTATTCACACGCGATAAAACAAAACAAAATAAAGAATCATTTGCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGACTATTCACACGCGATAAAACAAAACAAAATAAAGAATCATTTGCT  300

seq1  AGACCCAAGGGTGTACTTCAGAGGAGTCCATCACTTTCCCACACCCCCCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCCAAGGGTGTACTTCAGAGGAGTCCATCACTTTCCCACACCCCCCA  350

seq1  AACAAAAGTCCTATGCCAGCCAATATGGCAGTCACTAACCACGATTTGCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAAAGTCCTATGCCAGCCAATATGGCAGTCACTAACCACGATTTGCT  400

seq1  ACTGATTACTTAAAATGTGAAGAGCGTTGGGACTGTGGGGTACAGGGTCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGATTACTTAAAATGTGAAGAGCGTTGGGACTGTGGGGTACAGGGTCT  450

seq1  CACTCTGTAGCCTATTCTGGTCTTGAACTACTGTCCAATAACTCTGTTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCTGTAGCCTATTCTGGTCTTGAACTACTGTCCAATAACTCTGTTCA  500

seq1  GCTTCCAGATACTGAGACCACAGATAGGATGAATCGTATCTATATTGTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCCAGATACTGAGACCACAGATAGGATGAATCGTATCTATATTGTAG  550

seq1  CCTGGCTAAAAATAAAATTTTCATTTTTCTTTTCTTTTGAGACAGGGTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCTAAAAATAAAATTTTCATTTTTCTTTTCTTTTGAGACAGGGTTT  600

seq1  CTCTAGGAAGCCCTGGCTGTTCTGAAACCACTCAGTAGACCAGGCTGGCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTAGGAAGCCCTGGCTGTTCTGAAACCACTCAGTAGACCAGGCTGGCC  650

seq1  TCACGTATCTACCTGCCTCTGCCTTCTAAGTACTGGGATTAAAGGCCTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACGTATCTACCTGCCTCTGCCTTCTAAGTACTGGGATTAAAGGCCTGA  700

seq1  GTCAACACATCCAAATAAACTTCAACAGCCCTATATAGCCAGGCGACTAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAACACATCCAAATAAACTTCAACAGCCCTATATAGCCAGGCGACTAC  750

seq1  TGAATTC  757
      |||||||
seq2  TGAATTC  757

seq1: chr19_41863266_41864258
seq2: B6Ng01-221I19.g_66_1073

seq1  GAATTCCTGGAGGCATAAACTTTTCTTATTTAAGCACACTGATATTTAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGGAGGCATAAACTTTTCTTATTTAAGCACACTGATATTTAAT  50

seq1  TTAAAAATAAGAACCTGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAATAAGAACCTGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACC  100

seq1  CGACTGCTCTTCTGAAGGTCAGGAGTTCAAATCCCAGCAACCACATGGTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGACTGCTCTTCTGAAGGTCAGGAGTTCAAATCCCAGCAACCACATGGTG  150

seq1  GCTCACAACCATCCGTAACGAGATCTGACTCCCTCTTCTGGAGTTTCTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCACAACCATCCGTAACGAGATCTGACTCCCTCTTCTGGAGTTTCTGA  200

seq1  AGATAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTAAAAAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTAAAAAAA  250

seq1  AAAAAAAATAAGAACCTGAAGGTGATTGTCAAATCATGACAATTATTACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAATAAGAACCTGAAGGTGATTGTCAAATCATGACAATTATTACT  300

seq1  AGAGTTGATATAGGATATAATCTTTTTTTCTTTTCTTTAACATTTTTAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTTGATATAGGATATAATCTTTTTTTCTTTTCTTTAACATTTTTAAT  350

seq1  AATTCATGTCTTTCCATGTGTATGTGTGTGGGTTACACATATGTGGTGGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCATGTCTTTCCATGTGTATGTGTGTGGGTTACACATATGTGGTGGT  400

seq1  GCATATGTATGAGGCTATGGTCTTTGAATGTTTAAATATTTCAGCCTGCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATATGTATGAGGCTATGGTCTTTGAATGTTTAAATATTTCAGCCTGCC  450

seq1  TAATGATTCCCTCATATTTAATAAAATAAAACAGGGCCCCTTTAATACCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATGATTCCCTCATATTTAATAAAATAAAACAGGGCCCCTTTAATACCT  500

seq1  TATCAAAAGTAGTACCCACACTTCCTGGCTGACTCTGCGGCCTGTCCCAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCAAAAGTAGTACCCACACTTCCTGGCTGACTCTGCGGCCTGTCCCAT  550

seq1  AGGAGGGAAGTCATACCCAATACTGTCAGCCTGGTCAAAAGCCCATGGCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGGGAAGTCATACCCAATACTGTCAGCCTGGTCAAAAGCCCATGGCT  600

seq1  AGGGGGGGGCCCACAGGCCTTCAGGAGCAACCTACTATTGTTTTGCTAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGGGGGCCCACAGGCCTTCAGGAGCAACCTACTATTGTTTTGCTAAA  650

seq1  TTATCCAGCTGTCAAACTGTCTTCTAAATATTTATGCTACAGATGTGAGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCCAGCTGTCAAACTGTCTTCTAAATATTTATGCTACAGATGTGAGC  700

seq1  TGCTTTCAGCCTCAGCCAGAAAGCCTTCTTTTTCAAGTGGGCATCAGTAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTTCAGCCTCAGCCAGAAAGCCTTCTTTTTCAAGTGGGCATCAGTAG  750

seq1  ATGTAGAAACTCACAATGGTCACTGTGCTTGCAACAGCTGCTTGTGAGTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAGAAACTCACAATGGTCACTGTGCTTGCAACAGCTGCTTGTGAGTG  800

seq1  CTCAACCCTACACGGTACGTCAGTATCAACA-TTCTCCCCAGGAGATTCA  849
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  CTCAACCCTACACGGTACGTCAGTATCAACATTTCTCCCCAGGAGATTCA  850

seq1  AGGAACTTGGACAAAAAAAAAAAAAAAAAACC--AAAAACAAC-GTAGGA  896
      ||||||||||||||||||||||||||||||||  |||| |||| ||||||
seq2  AGGAACTTGGACAAAAAAAAAAAAAAAAAACCCAAAAACCAACTGTAGGA  900

seq1  GCCAGCGATTGTGGTGGAATGCTG-TGAA-GTGCTTT--CTTCTGGAGAT  942
      |||||||||||||||||||||||| |||| |||||||   ||||||||||
seq2  GCCAGCGATTGTGGTGGAATGCTGTTGAATGTGCTTTTCTTTCTGGAGAT  950

seq1  GAAG-TGTA-TGCC--ACACTTA-CAGCCTCACAGCAGCTGT--GGGTGC  985
      |||| |||| ||||   |||||| ||||||| ||||||||||  ||||||
seq2  GAAGTTGTATTGCCCACCACTTACCAGCCTCCCAGCAGCTGTTGGGGTGC  1000

seq1  CTGTCAAG  993
      ||||||||
seq2  CTGTCAAG  1008

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information