MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-301G10
Chromosome	19 (Build37)
Map Location	47,485,365 - 47,641,799
singlet/doublet	doublet
Overlap gene	Sh3pxd2a, Obfc1
Upstream gene	Sufu, Trim8, Arl3, Sfxn2, D19Wsu162e, Cyp17a1, EG629359, 2010012O05Rik, As3mt, Cnnm2, Nt5c2, Ina, Pcgf6, LOC100042842, Taf5, Usmg5, Pdcd11, 2810048G17Rik, EG546729, EG240669, EG629389, Neurl, EG329070
Downstream gene	Slk, Col17a1, 6330577E15Rik, D19Ertd652e, LOC677174, Gsto1, Gsto2, BC063749, Gm969, LOC670576, Sorcs3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sufu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24069 MGI:1345643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Trim8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93679 MGI:1933302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56350 MGI:1929699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfxn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94279 MGI:2137678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D19Wsu162e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226178 MGI:107577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp17a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13074 MGI:88586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629359 MGI:3648147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	2010012O05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66439 MGI:1913689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	As3mt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57344 MGI:1929882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnnm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94219 MGI:2151054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76952 MGI:2178563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ina (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226180 MGI:96568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcgf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71041 MGI:1918291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Taf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226182 MGI:2442144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usmg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66477 MGI:1891435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18572 MGI:1341788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810048G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72691 MGI:1919941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546729 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546729 MGI:3643383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG240669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240669 MGI:3645665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG629389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629389 MGI:3645322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins

name	Neurl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18011 MGI:1334263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG329070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329070 MGI:3647497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3pxd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14218 MGI:1298393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Obfc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108689 MGI:1915581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20874 MGI:103241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col17a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12821 MGI:88450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330577E15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67788 MGI:1915038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D19Ertd652e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70806 MGI:1289258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 2 Proteins

name	LOC677174 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gsto1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14873 MGI:1342273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsto2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68214 MGI:1915464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC063749 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414801 MGI:3042776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm969 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381229 MGI:2685815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	LOC670576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Sorcs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66673 MGI:1913923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sufu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794804 GeneID:24069 MGI:1345643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of fused homolog (Drosophila) transcript_id : NM_015752.2

name	Sufu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794806 GeneID:24069 MGI:1345643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of fused homolog (Drosophila) transcript_id : NM_001025391.1

name	Trim8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716392 GeneID:93679 MGI:1933302
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 8 transcript_id : NM_053100.1

name	Arl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254549 GeneID:56350 MGI:1929699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 3 transcript_id : NM_019718.2

name	Sfxn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439983 GeneID:94279 MGI:2137678
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sideroflexin 2 transcript_id : NM_053196.3

name	D19Wsu162e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68341986 GeneID:226178 MGI:107577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 19, Wayne State University 162, expressed transcript_id : NM_146099.2

name	Cyp17a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476041 GeneID:13074 MGI:88586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 17, subfamily a, polypeptide 1 transcript_id : NM_007809.2

name	2010012O05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893035 GeneID:66439 MGI:1913689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010012O05 gene transcript_id : NM_025563.3

name	As3mt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392104 GeneID:57344 MGI:1929882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arsenic (+3 oxidation state) methyltransferase transcript_id : NM_020577.2

name	Cnnm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130766 GeneID:94219 MGI:2151054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin M2 transcript_id : NM_033569.2

name	Nt5c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802147 GeneID:76952 MGI:2178563
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5'-nucleotidase, cytosolic II transcript_id : NM_029810.3

name	Ina (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354520 GeneID:226180 MGI:96568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : internexin neuronal intermediate filament protein, alpha transcript_id : NM_146100.3

name	Pcgf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351956 GeneID:71041 MGI:1918291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycomb group ring finger 6 transcript_id : NM_027654.2

name	Taf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665721 GeneID:226182 MGI:2442144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_177342.3

name	Usmg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351604 GeneID:66477 MGI:1891435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upregulated during skeletal muscle growth 5 transcript_id : NM_023211.4

name	Pdcd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607127 GeneID:18572 MGI:1341788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death protein 11 transcript_id : NM_011053.2

name	2810048G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801704 GeneID:72691 MGI:1919941
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810048G17 gene transcript_id : NM_133746.3

name	EG546729 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486908 GeneID:546729 MGI:3643383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546729 transcript_id : NM_001081271.1

name	EG240669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270501 GeneID:240669 MGI:3645665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG240669 transcript_id : XM_140729.8

name	EG629389 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406028 GeneID:629389 MGI:3645322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins product : predicted gene, EG629389 transcript_id : XM_894271.2

name	Neurl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71534277 GeneID:18011 MGI:1334263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuralized-like homolog (Drosophila) transcript_id : NM_021360.3

name	EG329070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342895 GeneID:329070 MGI:3647497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG329070 transcript_id : NM_177833.2

name	Sh3pxd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351646 GeneID:14218 MGI:1298393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 and PX domains 2A transcript_id : NM_008018.2

name	Obfc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341702 GeneID:108689 MGI:1915581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oligonucleotide/oligosaccharide-binding fold containing 1 transcript_id : NM_175360.2

name	Slk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360252 GeneID:20874 MGI:103241
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : STE20-like kinase (yeast) transcript_id : NM_009289.2

name	Col17a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680963 GeneID:12821 MGI:88450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XVII, alpha 1 transcript_id : NM_007732.1

name	6330577E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125662572 GeneID:67788 MGI:1915038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330577E15 gene transcript_id : NM_026377.2

name	D19Ertd652e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270505 GeneID:70806 MGI:1289258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 2 Proteins product : DNA segment, Chr 19, ERATO Doi 652, expressed transcript_id : XM_129357.7

name	Gsto1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892764 GeneID:14873 MGI:1342273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase omega 1 transcript_id : NM_010362.2

name	Gsto2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311856 GeneID:68214 MGI:1915464
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione S-transferase omega 2 transcript_id : NM_026619.1

name	BC063749 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185915 GeneID:414801 MGI:3042776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC063749 transcript_id : NM_001001738.2

name	Gm969 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406034 GeneID:381229 MGI:2685815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : gene model 969, (NCBI) transcript_id : XM_355166.3

name	LOC670576 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270509 GeneID:670576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC670576 transcript_id : XM_001479010.1

name	Sorcs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130290 GeneID:66673 MGI:1913923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sortilin-related VPS10 domain containing receptor 3 transcript_id : NM_025696.3

name	Sufu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794805 GeneID:24069 MGI:1345643
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045879 - negative regulation of smoothened signaling pathway [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : suppressor of fused homolog isoform 1 protein_id : NP_056567.2

name	Sufu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794807 CCDS:CCDS29879.1 GeneID:24069 MGI:1345643
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045879 - negative regulation of smoothened signaling pathway [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : suppressor of fused homolog isoform 2 protein_id : NP_001020562.1

name	Trim8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716393 GeneID:93679 MGI:1933302
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ring finger protein 27 product : tripartite motif protein 8 protein_id : NP_444330.1

name	Arl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789881 GeneID:56350 MGI:1929699
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IDA]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : ADP-ribosylation factor-like protein 3; ADP-ribosylation-like 3 product : ADP-ribosylation factor-like 3 protein_id : NP_062692.1

name	Sfxn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86439984 CCDS:CCDS29880.1 GeneID:94279 MGI:2137678
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sideroflexin 2 protein_id : NP_444426.3

name	D19Wsu162e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68341987 CCDS:CCDS29881.1 GeneID:226178 MGI:107577
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC226178 protein_id : NP_666211.2

name	Cyp17a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476042 CCDS:CCDS29882.1 GeneID:13074 MGI:88586
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004508 - steroid 17-alpha-monooxygenase activity [Evidence IMP] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 17; cytochrome P450, 17a1 product : cytochrome P450, family 17, subfamily a, polypeptide 1 protein_id : NP_031835.2

name	2010012O05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385000 GeneID:66439 MGI:1913689
definition	codon_start : 1 product : hypothetical protein LOC66439 protein_id : NP_079839.1

name	As3mt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392105 GeneID:57344 MGI:1929882
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0030791 - arsenite methyltransferase activity [Evidence ISS]; GO:0030792 - methylarsonite methyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018872 - arsonoacetate metabolism [Evidence ISS]; GO:0046685 - response to arsenic [Evidence ISS]; GO:0009404 - toxin metabolism [Evidence ISS] codon_start : 1 note : S-adenosylmethionine:arsenic (III) methyltransferase; methylarsonite methyltransferase; methyltransferase Cyt19 product : arsenic (+3 oxidation state) methyltransferase protein_id : NP_065602.2

name	Cnnm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809000 GeneID:94219 MGI:2151054
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ancient conserved domain protein 2 product : cyclin M2 protein_id : NP_291047.1

name	Nt5c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560044 CCDS:CCDS29883.1 GeneID:76952 MGI:2178563
definition	GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : 5'-nucleotidase, cytosolic II protein_id : NP_084086.2

name	Ina (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328368 GeneID:226180 MGI:96568
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045104 - intermediate filament cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : internexin neuronal intermediate filament protein, alpha protein_id : NP_666212.2

name	Pcgf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076973 CCDS:CCDS29885.1 GeneID:71041 MGI:1918291
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0019904 - protein domain specific binding [Evidence ISS]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Mel18- and Bmi1-like RING finger protein; Mel18 and Bmi1-like RING finger protein; ring finger protein 134 product : polycomb group ring finger 6 protein_id : NP_081930.1

name	Taf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665722 CCDS:CCDS29886.1 GeneID:226182 MGI:2442144
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa product : Tbp-associated factor 5 protein_id : NP_796316.2

name	Usmg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404294 GeneID:66477 MGI:1891435
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] codon_start : 1 product : upregulated during skeletal muscle growth 5 protein_id : NP_075700.2

name	Pdcd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607128 CCDS:CCDS29888.1 GeneID:18572 MGI:1341788
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA] [Evidence ISS] [Evidence TAS]; GO:0043123 - positive regulation of I-kappaB kinase/NF-kappaB cascade [Evidence ISS] [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] [Evidence ISS] [Evidence IDA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : programmed cell death protein 7 product : programmed cell death protein 11 protein_id : NP_035183.2

name	2810048G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981572 CCDS:CCDS29889.1 GeneID:72691 MGI:1919941
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72691 protein_id : NP_598507.2

name	EG546729 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486909 GeneID:546729 MGI:3643383
definition	codon_start : 1 product : predicted gene, EG546729 protein_id : NP_001074740.1

name	EG240669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270502 GeneID:240669 MGI:3645665
definition	codon_start : 1 product : similar to Family with sequence similarity 26, member A protein_id : XP_140729.8

name	EG629389 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406029 GeneID:629389 MGI:3645322
definition	codon_start : 1 product : similar to Histone H1 protein_id : XP_899364.2

name	Neurl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71534278 CCDS:CCDS29890.1 GeneID:18011 MGI:1334263
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007595 - lactation [Evidence IMP]; GO:0009605 - response to external stimulus [Evidence IMP]; GO:0007288 - sperm axoneme assembly [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP] codon_start : 1 exception : mismatches in translation product : neuralized homolog protein_id : NP_067335.3

name	EG329070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244408 GeneID:329070 MGI:3647497
definition	codon_start : 1 product : hypothetical protein LOC329070 protein_id : NP_808501.1

name	Sh3pxd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679801 CCDS:CCDS29891.1 GeneID:14218 MGI:1298393
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : five SH3 domains product : SH3 multiple domains 1 protein_id : NP_032044.1

name	Obfc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28827826 CCDS:CCDS29892.1 GeneID:108689 MGI:1915581
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : oligonucleotide/oligosaccharide-binding fold containing 1 protein_id : NP_780569.1

name	Slk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106427 GeneID:20874 MGI:103241
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Ste20-related kinase; serine/threonine kinase 2 product : STE20-like kinase protein_id : NP_033315.1

name	Col17a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680964 GeneID:12821 MGI:88450
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0030056 - hemidesmosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : procollagen, type XVII, alpha 1 protein_id : NP_031758.1

name	6330577E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125662573 GeneID:67788 MGI:1915038
definition	codon_start : 1 product : hypothetical protein LOC67788 protein_id : NP_080653.2

name	D19Ertd652e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270506 GeneID:70806 MGI:1289258
definition	codon_start : 1 product : hypothetical protein LOC70806 protein_id : XP_129357.7

name	Gsto1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754090 CCDS:CCDS29893.1 GeneID:14873 MGI:1342273
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glutathione-S-transferase like; glutathione S-transferase like product : glutathione S-transferase omega 1 protein_id : NP_034492.1

name	Gsto2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311857 CCDS:CCDS29894.1 GeneID:68214 MGI:1915464
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004364 - glutathione transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glutathione S-transferase omega 2 protein_id : NP_080895.1

name	BC063749 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185916 CCDS:CCDS29895.1 GeneID:414801 MGI:3042776
definition	codon_start : 1 product : hypothetical protein LOC414801 protein_id : NP_001001738.2

name	Gm969 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085189 GeneID:381229 MGI:2685815
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355166.1

name	LOC670576 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270510 GeneID:670576
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479060.1

name	Sorcs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956144 GeneID:66673 MGI:1913923
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 product : sortilin-related VPS10 domain containing receptor 3 protein_id : NP_079972.1

name	EG629359 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629359
definition	number : 2 pseudo : _no_value

name	EG629359 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629359
definition	number : 1 pseudo : _no_value

name	LOC100042842 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042842
definition	number : 2 pseudo : _no_value

name	LOC100042842 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042842
definition	number : 1 pseudo : _no_value

name	LOC677174 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677174
definition	number : 1 pseudo : _no_value

clone name	MSMg01-351N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-545A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-440O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-301G10.b	B6Ng01-301G10.g
ACC	GA095722	GA095723
length	1,163	1,050
definition	B6Ng01-301G10.b	B6Ng01-301G10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(47,640,651 - 47,641,799)	(47,485,365 - 47,486,411)
sequence	gaattctggtttctagatttctcttcagcttgtgaaataagcatttgttt ggcttctgtgtgccttgaaaaaaaaaaaccacaccatgaagaggatccaa gtgggactgaaattcattttgtctgtcaggctgaatgcccagagtcccac gtctacccaggcagtcccctttttactggctttaacagggtcaaagtctt gccctgggcatcacagaacttccaggaggccttatttatctgctcactag gtattgttctgttccacctaccagagtgacagagttttaaaatgctctcc ccagtaggtgttagcgaggaagcagaaccagtggggcagctctcctgcac tgctgggggagagataactcgaggtggctgctctgaaagcagcttggcag tttcatagaaaaggaactctctatccaccatatgaccctgttactcctgc acgtactgaagaggagaggagatgtacggccatgcgaaggtttgcctatg aatgttcatattagctggaaagtagtcaccaacgaagaaatggataaaga aatagccagatagtagtggtgcacgcccttaaacccccccgaattcagga ggatgaggtctctgagtttaaggccattctggtctacatagagatccaag gcagccagagctacatagtgagaccctgtcttgaaaagctaaaagaaaaa aaaaaaaacaacaaaaaaaaacaaacaaaaaaacaaaacaaacaaaaaaa aaaaaacaaacaaaaaaaaaaaaccaagaaagaaagaaaagaaagaagaa ttttttttaaaaaaaaattgatggtattgctcataaaaaggagcactttt tactttggcaatacaaaaagaatgagtgatagattacacacagagtacag atgaacctcaaagaatgactgtgcgtgaaaaggcagctccttcttcctta agagtccagcctcttcatacaggcagaatgggagattggaaatacaagca caggtgagaaaagagccagagaactgggattttgactaagaagaggggtg ggtatagcaatggggaggcctttcgagaggccaatggggaactttgggtg acaagccagggtctgattggtggcgatagatccggaggccaaggcgttcc acgatacgtcaac	gaattctcctggaaatgttctggacccacagcaatcaggcagcacagagc ctgtactgaacctccttcagcacaaggccagccatccttcccctagcccc tgcctgccctgcctccagatgtgaatacgccacagctggagaacctggtc tgacaagcctgtcactgagacacaaagctgaactggagggaggggctggc cacctccttcctcctcagccaggcaccacactcctgatgtgtgacccacc acttctgcaaggcagtccacatcttccctggggagcctctagatccccca ggtcccccaggtccaattccctccttatcaccacaatcaaccaatcagct tgcccaaagagcacacttgaacagaaaaaagaaataacaaaaaggatgga gaaaggggcttggattggtccttcagggaccccagtcactgttcaaggtg cagtcctgagaacagcagtgcggacatcagctaagagcctggaagatgca gcatcaccctgcacactgctacacctaaaccagtatctgcagaacggcct gagtggttccacactctgcgaacttgaggaaccctaatgttcttcacccc taaggattccatcagctctctaacaagtgacttgggagccgcccgtagac aaagtcaagagctgcccggaggagtggaaactgaacacacctgcctttga aggtggaagagggtgaagcccctctctgcacaccccataccccaccacca ccacacacaaactctctctagaagtcactgacaaggattcccagctgaca ctgttctagagaatggaaaaataaaaaaattaaagctatgggggctattt cttctcctgaagttcccacgttgtggggaaaatcagagtaagcaaatggc tgatgggataacaggctgagaacaagtgatttgaaggcaaggtagggcag atgtggtcaaagagtctcactgacagacatagggacccatgtcctcattg cttaaggggtccactgtaaagatgttggggaaggggggtatgaggagaga
quality values	Open. Hide. 38 12 15 13 41 54 31 49 29 45 58 58 52 52 41 58 42 41 62 62 62 62 62 62 62 39 30 62 62 62 42 56 31 26 18 26 21 46 51 47 44 62 62 47 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 49 62 59 59 62 62 62 62 62 62 59 56 59 56 54 54 43 62 59 62 59 59 62 59 54 49 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 49 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 59 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 59 59 59 59 62 62 62 48 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 56 62 59 59 59 51 51 62 62 62 62 62 56 56 51 56 59 59 59 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 59 44 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 47 62 56 56 56 62 56 56 54 62 62 62 62 62 62 62 62 62 62 62 51 62 62 56 62 62 62 62 47 62 62 62 47 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 54 54 62 56 62 62 56 56 56 40 56 56 32 56 56 62 56 62 56 62 56 62 62 62 62 62 56 54 41 62 62 42 47 46 62 54 43 62 62 62 62 62 62 50 62 43 44 38 54 62 52 38 62 52 48 62 52 62 48 48 48 48 52 47 58 52 58 47 46 58 52 52 52 52 54 52 54 58 58 52 58 54 58 58 58 58 58 48 54 54 32 42 49 34 36 31 37 42 54 52 58 54 42 58 58 43 54 58 54 52 40 58 58 52 52 58 58 52 52 53 50 54 54 29 51 42 51 51 53 52 58 47 53 58 58 53 58 49 50 46 46 48 50 50 58 46 41 51 39 46 53 50 48 47 48 48 48 58 39 47 51 50 39 40 58 35 14 58 37 40 51 51 25 49 49 50 58 40 51 49 44 21 51 58 36 32 50 50 32 18 44 32 49 47 40 52 58 44 50 42 53 37 50 30 51 41 58 58 42 17 29 32 46 25 41 51 58 41 49 31 40 49 31 51 58 32 49 52 29 46 25 49 39 41 53 53 42 32 33 18 42 41 28 25 31 38 41 39 49 40 54 54 49 37 52 53 41 52 44 31 50 39 44 49 50 52 50 44 49 45 41 32 47 15 46 23 28 47 25 38 35 35 21 42 39 31 18 54 25 21 16 9 6 27 22 40 8 13 11 11 5 9 21 18 10 7 11 12 24 15 9 21 21 11 33 26 24 24 9 18 16 10 10 6 9 9 24 29 40 40 34 47 52 52 40 40 32 32 23 38 10 9 8 8 23 32 29 32 33 31 31 13 22 45 51 31 25 32 28 18 29 31 25 16 30 14 13 51 51 51 51 51 46 21 25 45 40 45 40 40 40 40 14 7 6 10 15 17 31 27 8 7 9 18 32 18 10 16 21 38 31 46 42 46 9 6 40 20 13 20 11 12 11 46 48 48 26 18 12 8 32 29 17 30 30 23 15 31 14 37 18 31 16 23 7 5 6 22 32 31 21 13 22 30 14 11 15 14 11 9 7 6 29 7 9 6 29 32 8 24 11 43 22 31 8 18 31 31 33 18 15 31 26 31 11 23 36 34 15 29 21 21 21 34 15 9 13 18 20 21 19 17 17 37 48 44 32 10 26 14 23 20 44 10 19 20 15 26 8 5 7 8 28 9 12 30 12 5 8 5 14 15 15 24 24 28 12 14 14 27 21 20 10 15 5 9 7 9 18 27 23 6 7 27 15 10 39 13 15 11 15 11 27 12 10 19 36 10 32 10 11 8 21 6 3 7 17 5 3 5 10 9 6 12 9 34 22 13 10 7 5 8 9 19 6 10 4 5 10 21 7 7 10 11 7 6 21 30 15 6 5 6 22 13 7 13 5 23 11 7 7 21 29 13 15 21 38 22 5 18 7 14 6 4 3 11 5 22 31 23 5 6 11 24 6 8 10 30 12 3 1 2 4 9 5 11 2 2 5 5 6 19 23 17 9 6 5 18 6 10 9 17 27 13 6 5 6 6 7 11 5 6 12 5 11 23 6 5 5 2 4 7 7 6 13 4 6 21 8 11 5 5 4 6 11 12 11 4 3 1 4 19 6 16 6 10 9 7 15 20 7 7 14 11 7 7 15 4 5 2 3 4 2 2 2 1 2 3 3	Open. Hide. 62 47 56 41 62 62 62 62 62 62 51 28 17 21 26 18 43 44 51 62 62 62 62 47 39 62 47 39 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 35 62 59 62 62 43 56 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 49 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 47 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 47 47 62 62 62 47 62 62 62 62 62 62 62 62 62 49 49 62 49 47 62 62 62 62 62 62 62 62 52 62 54 62 62 47 62 62 62 62 62 62 62 62 62 54 62 62 62 62 42 42 62 62 62 62 62 62 62 52 62 62 62 62 62 49 42 62 62 54 54 52 54 58 53 58 58 58 52 52 54 46 52 54 58 54 52 58 54 54 58 50 58 52 52 52 52 54 58 58 54 39 45 41 54 58 48 52 54 58 54 52 53 54 54 54 58 58 54 52 46 49 58 54 58 58 54 54 54 52 54 54 54 42 54 50 54 54 32 54 54 52 58 54 58 54 54 52 39 58 47 49 54 54 54 58 58 58 58 42 53 58 47 41 45 51 53 40 49 49 51 58 53 58 58 58 50 58 50 49 58 51 50 49 22 58 58 23 24 51 49 47 50 58 51 53 31 58 49 50 51 51 46 49 47 44 48 50 49 51 26 51 32 31 50 50 41 21 53 53 39 46 49 53 53 53 53 53 52 46 51 42 33 39 50 49 41 40 53 51 48 58 29 50 25 41 48 32 46 44 43 44 50 40 28 36 32 26 58 49 37 41 28 14 58 34 51 25 51 50 47 31 50 46 39 51 32 18 50 51 21 40 49 49 49 52 44 42 40 49 26 22 30 32 45 26 31 39 38 53 34 35 32 49 51 42 49 18 36 52 31 39 39 40 50 25 51 19 54 51 28 47 54 35 26 33 41 31 40 42 32 42 39 45 53 42 27 45 37 37 52 47 52 37 52 31 52 40 47 22 13 36 51 31 34 46 33 37 51 38 53 25 33 30 29 34 52 35 35 53 30 40 32 39 35 43 39 31 49 18 24 29 25 32 31 32 45 42 31 27 29 33 33 25 33 40 21 41 23 23 31 42 39 32 26 13 28 30 34 45 31 31 37 36 31 22 51 33 36 31 27 30 30 28 46 46 46 33 30 31 46 46 46 46 46 35 31 33 27 46 27 13 30 37 24 28 31 46 48 48 26 18 31 17 32 46 26 19 29 11 27 31 32 26 31 31 12 46 18 31 33 31 41 29 26 28 12 21 15 42 23 37 46 46 31 34 48 48 17 21 31 26 12 29 8 20 21 25 8 11 25 41 22 26 26 37 32 37 25 31 27 38 48 21 20 18 7 25 22 8 8 26 23 32 18 10 6 13 16 10 6 24 8 17 19 31 30 36 19 12 17 25 9 11 15 20 8 25 23 12 32 17 31 6 14 21 11 16 8 7 19 13 25 27 22 9 15 10 20 5 5 3 9 14 16 15 12 16 19 17 9 5 13 7 6 6 10 5 5 21 6 18 17 12 11 3 3 5 3 11 20 26 16 11 8 8 8 18 13 21 7 5 16 31 34 21 11 28 27 13 5 15 19 9 9 25 12 4 10 8 10 7 5 7 26 26 13 10 12 7 15 17 10 22 8 3 3 5 5 14 4 15 6 4 5 4 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr19_47640651_47641799
seq2: B6Ng01-301G10.b_47_1209 (reverse)

seq1  GTTGACATGTATCGTTGAACGCCTTGGCCTCTGTGAATCTATCGCCACC-  49
      ||||||  ||||||| |||||||||||||||   | ||||||||||||| 
seq2  GTTGAC--GTATCGTGGAACGCCTTGGCCTC--CGGATCTATCGCCACCA  46

seq1  ATCAGGGAACCT-GCTTGTCACCC-AAGGTCCCCATGCGCCTCTGGAAA-  96
      ||||  || ||| ||||||||||| ||| |||||||  |||||| |||| 
seq2  ATCA--GACCCTGGCTTGTCACCCAAAGTTCCCCATTGGCCTCTCGAAAG  94

seq1  GCCT-CCCTTTGCT-TTCCCA-CCCTCT--CTAGTCAAA--TCCAG-TCT  138
      |||| ||| ||||| | |||| ||||||   ||||||||   |||| |||
seq2  GCCTCCCCATTGCTATACCCACCCCTCTTCTTAGTCAAAATCCCAGTTCT  144

seq1  CT-GCTC-TTTCTCA-CTGTGCTTTGTATTT-CAATCTCC--ATCTG-CT  181
      || |||| ||||||| |||||| |||||||| ||||||||   |||| ||
seq2  CTGGCTCTTTTCTCACCTGTGC-TTGTATTTCCAATCTCCCATTCTGCCT  193

seq1  GTATGAAGAGGCTGGACTCTT-AGGGAGAAGGGGCTGCCTTTTTCACGCA  230
      ||||||||||||||||||||| ||| |||||| |||||| ||||||||||
seq2  GTATGAAGAGGCTGGACTCTTAAGGAAGAAGGAGCTGCC-TTTTCACGCA  242

seq1  CAGTCATTCTTTTGAGGTTCATCTGTACTCTTGTGTGT-ATCTATCACTC  279
      ||||||||| |||||||||||||||||||| ||||||| |||||||||||
seq2  CAGTCATTC-TTTGAGGTTCATCTGTACTC-TGTGTGTAATCTATCACTC  290

seq1  ATTC-TTTTGTATTGCC-AAGT-AAAAGTGCTCCTTTTTATGAGC-ATAC  325
      |||| |||||||||||| |||| |||||||||||||||||||||| ||||
seq2  ATTCTTTTTGTATTGCCAAAGTAAAAAGTGCTCCTTTTTATGAGCAATAC  340

seq1  CATC-ATTTTTTTTTAAAAAAATTCTTTCTTTCTTTTCTTTCTTTCTTGG  374
      |||| ||||||||||||||||| |  ||||||||||||||||||||||||
seq2  CATCAATTTTTTTTTAAAAAAAATTCTTCTTTCTTTTCTTTCTTTCTTGG  390

seq1  TTTTTTTTTTTTTGTTTGTTTTTTTTTTTTGTTTTGTTTTGTTTTTTTGT  424
       |||||||||||||||||||||||||||||  ||||||||||||||||| 
seq2  -TTTTTTTTTTTTGTTTGTTTTTTTTTTTTTGTTTGTTTTGTTTTTTTG-  438

seq1  TTTGTTTTTTTTTGTTGTTTTTTTTTTTTTCTTTTAGCTTTTCAAGACAG  474
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTTTTTTTGTTGTTTTTTTTTTTTTCTTTTAGCTTTTCAAGACAG  488

seq1  GGTCTCACTATGTAGCTCTGGCTGCCTTGGATCTCTATGTAGACCAGAAT  524
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTCACTATGTAGCTCTGGCTGCCTTGGATCTCTATGTAGACCAGAAT  538

seq1  GGCCTTAAACTCAGAGACCTCATCCTCCTGAATTCGGGGGGGTTTAAGGG  574
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTTAAACTCAGAGACCTCATCCTCCTGAATTCGGGGGGGTTTAAGGG  588

seq1  CGTGCACCACTACTATCTGGCTATTTCTTTATCCATTTCTTCGTTGGTGA  624
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGCACCACTACTATCTGGCTATTTCTTTATCCATTTCTTCGTTGGTGA  638

seq1  CTACTTTCCAGCTAATATGAACATTCATAGGCAAACCTTCGCATGGCCGT  674
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTTTCCAGCTAATATGAACATTCATAGGCAAACCTTCGCATGGCCGT  688

seq1  ACATCTCCTCTCCTCTTCAGTACGTGCAGGAGTAACAGGGTCATATGGTG  724
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTCCTCTCCTCTTCAGTACGTGCAGGAGTAACAGGGTCATATGGTG  738

seq1  GATAGAGAGTTCCTTTTCTATGAAACTGCCAAGCTGCTTTCAGAGCAGCC  774
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAGAGAGTTCCTTTTCTATGAAACTGCCAAGCTGCTTTCAGAGCAGCC  788

seq1  ACCTCGAGTTATCTCTCCCCCAGCAGTGCAGGAGAGCTGCCCCACTGGTT  824
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCGAGTTATCTCTCCCCCAGCAGTGCAGGAGAGCTGCCCCACTGGTT  838

seq1  CTGCTTCCTCGCTAACACCTACTGGGGAGAGCATTTTAAAACTCTGTCAC  874
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTTCCTCGCTAACACCTACTGGGGAGAGCATTTTAAAACTCTGTCAC  888

seq1  TCTGGTAGGTGGAACAGAACAATACCTAGTGAGCAGATAAATAAGGCCTC  924
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGTAGGTGGAACAGAACAATACCTAGTGAGCAGATAAATAAGGCCTC  938

seq1  CTGGAAGTTCTGTGATGCCCAGGGCAAGACTTTGACCCTGTTAAAGCCAG  974
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAAGTTCTGTGATGCCCAGGGCAAGACTTTGACCCTGTTAAAGCCAG  988

seq1  TAAAAAGGGGACTGCCTGGGTAGACGTGGGACTCTGGGCATTCAGCCTGA  1024
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAAGGGGACTGCCTGGGTAGACGTGGGACTCTGGGCATTCAGCCTGA  1038

seq1  CAGACAAAATGAATTTCAGTCCCACTTGGATCCTCTTCATGGTGTGGTTT  1074
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACAAAATGAATTTCAGTCCCACTTGGATCCTCTTCATGGTGTGGTTT  1088

seq1  TTTTTTTTCAAGGCACACAGAAGCCAAACAAATGCTTATTTCACAAGCTG  1124
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTCAAGGCACACAGAAGCCAAACAAATGCTTATTTCACAAGCTG  1138

seq1  AAGAGAAATCTAGAAACCAGAATTC  1149
      |||||||||||||||||||||||||
seq2  AAGAGAAATCTAGAAACCAGAATTC  1163

seq1: chr19_47485365_47486411
seq2: B6Ng01-301G10.g_69_1118

seq1  GAATTCTCCTGGAAATGTTCTGGACCCACAGCAATCAGGCAGCACAGAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCCTGGAAATGTTCTGGACCCACAGCAATCAGGCAGCACAGAGC  50

seq1  CTGTACTGAACCTCCTTCAGCACAAGGCCAGCCATCCTTCCCCTAGCCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTACTGAACCTCCTTCAGCACAAGGCCAGCCATCCTTCCCCTAGCCCC  100

seq1  TGCCTGCCCTGCCTCCAGATGTGAATACGCCACAGCTGGAGAACCTGGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTGCCCTGCCTCCAGATGTGAATACGCCACAGCTGGAGAACCTGGTC  150

seq1  TGACAAGCCTGTCACTGAGACACAAAGCTGAACTGGAGGGAGGGGCTGGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAAGCCTGTCACTGAGACACAAAGCTGAACTGGAGGGAGGGGCTGGC  200

seq1  CACCTCCTTCCTCCTCAGCCAGGCACCACACTCCTGATGTGTGACCCACC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTCCTTCCTCCTCAGCCAGGCACCACACTCCTGATGTGTGACCCACC  250

seq1  ACTTCTGCAAGGCAGTCCACATCTTCCCTGGGGAGCCTCTAGATCCCCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTCTGCAAGGCAGTCCACATCTTCCCTGGGGAGCCTCTAGATCCCCCA  300

seq1  GGTCCCCCAGGTCCAATTCCCTCCTTATCACCACAATCAACCAATCAGCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCCCCCAGGTCCAATTCCCTCCTTATCACCACAATCAACCAATCAGCT  350

seq1  TGCCCAAAGAGCACACTTGAACAGAAAAAAGAAATAACAAAAAGGATGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCAAAGAGCACACTTGAACAGAAAAAAGAAATAACAAAAAGGATGGA  400

seq1  GAAAGGGGCTTGGATTGGTCCTTCAGGGACCCCAGTCACTGTTCAAGGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGGGCTTGGATTGGTCCTTCAGGGACCCCAGTCACTGTTCAAGGTG  450

seq1  CAGTCCTGAGAACAGCAGTGCGGACATCAGCTAAGAGCCTGGAAGATGCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCCTGAGAACAGCAGTGCGGACATCAGCTAAGAGCCTGGAAGATGCA  500

seq1  GCATCACCCTGCACACTGCTACACCTAAACCAGTATCTGCAGAACGGCCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATCACCCTGCACACTGCTACACCTAAACCAGTATCTGCAGAACGGCCT  550

seq1  GAGTGGTTCCACACTCTGCGAACTTGAGGAACCCTAATGTTCTTCACCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGGTTCCACACTCTGCGAACTTGAGGAACCCTAATGTTCTTCACCCC  600

seq1  TAAGGATTCCATCAGCTCTCTAACAAGTGACTTGGGAGCCGCCCGTAGAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGATTCCATCAGCTCTCTAACAAGTGACTTGGGAGCCGCCCGTAGAC  650

seq1  AAAGTCAAGAGCTGCCCGGAGGAGTGGAAACTGAACACACCTGCCTTTGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTCAAGAGCTGCCCGGAGGAGTGGAAACTGAACACACCTGCCTTTGA  700

seq1  AGGTGGAAGAGGGTGAAGCCCCTCTCTGCACACCCCATACCCCACCACCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGGAAGAGGGTGAAGCCCCTCTCTGCACACCCCATACCCCACCACCA  750

seq1  CCACACACAAACTCTCTCTAGAAGTCACTGACAAGGATTTCCCAGCTGAC  800
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  CCACACACAAACTCTCTCTAGAAGTCACTGACAAGGA-TTCCCAGCTGAC  799

seq1  ACTGTTCTAGAGAATGGAAAAATAAAAAAATTAAAGCTAT-GGGGCTATT  849
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  ACTGTTCTAGAGAATGGAAAAATAAAAAAATTAAAGCTATGGGGGCTATT  849

seq1  TCTTCTCCTGAAGTTCCCACGTTGTGGGGAAAATCAGAGTAAGCAAATGG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCTCCTGAAGTTCCCACGTTGTGGGGAAAATCAGAGTAAGCAAATGG  899

seq1  CTGATGGGATAACAGGCTGAG-ACAAGTGATTTGAAGGCAAGGTA-GGCA  947
      ||||||||||||||||||||| ||||||||||||||||||||||| ||||
seq2  CTGATGGGATAACAGGCTGAGAACAAGTGATTTGAAGGCAAGGTAGGGCA  949

seq1  GATGTGGTCAAAGGAGGTCTCACTGACAGGACATA-GGACCCAAGGCCTC  996
      |||||||||||||   |||||||||||| |||||| ||||||| | ||||
seq2  GATGTGGTCAAAG--AGTCTCACTGACA-GACATAGGGACCCATGTCCTC  996

seq1  AGTGCTTAGGGGGTCCACTGT-AAGATG-TGGGGAAGGGGGTTA-GAGGA  1043
      | |||||| |||||||||||| |||||| |||||||||||| || |||||
seq2  ATTGCTTAAGGGGTCCACTGTAAAGATGTTGGGGAAGGGGGGTATGAGGA  1046

seq1  GAGA  1047
      ||||
seq2  GAGA  1050

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information