MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-085D12
Chromosome	19 (Build37)
Map Location	56,303,384 - 56,303,648
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gucy2g, Acsl5, Zdhhc6, Vti1a, LOC100043479, Tcf7l2, Ppnr, LOC100043484
Downstream gene	Habp2, Nrap, Casp7, 9930023K05Rik, Dclre1a, Nhlrc2, Adrb1, EG629643, A630007B06Rik, 1700010L13Rik, Tdrd1, Vwa2, Afap1l2, Ablim1, EG668259
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gucy2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73707 MGI:106025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acsl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433256 MGI:1919129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66980 MGI:1914230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Vti1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53611 MGI:1855699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043479 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tcf7l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21416 MGI:1202879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppnr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26930 MGI:1349458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Habp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226243 MGI:1196378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18175 MGI:1098765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Casp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12369 MGI:109383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930023K05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226245 MGI:2443041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dclre1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55947 MGI:1930042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nhlrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66866 MGI:1914116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11554 MGI:87937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629643 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629643 MGI:3648860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	A630007B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213993 MGI:2445022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700010L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75628 MGI:1922878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Tdrd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83561 MGI:1933218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Vwa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240675 MGI:2684334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afap1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226250 MGI:2147658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ablim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226251 MGI:1194500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668259 MGI:3644656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gucy2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487300 GeneID:73707 MGI:106025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase 2g transcript_id : NM_001081076.1

name	Acsl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75992928 GeneID:433256 MGI:1919129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase long-chain family member 5 transcript_id : NM_027976.2

name	Zdhhc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75992949 GeneID:66980 MGI:1914230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 6 transcript_id : NM_025883.3

name	Zdhhc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75992951 GeneID:66980 MGI:1914230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 6 transcript_id : NM_001033573.1

name	Vti1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803384 GeneID:53611 MGI:1855699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle transport through interaction with t-SNAREs homolog 1A (yeast) transcript_id : NM_016862.3

name	LOC100043479 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270576 GeneID:100043479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043479 transcript_id : XM_001480629.1

name	Tcf7l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543848 GeneID:21416 MGI:1202879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 7-like 2, T-cell specific, HMG-box transcript_id : NM_009333.2

name	LOC100043484 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270578 GeneID:100043484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043484 transcript_id : XM_001480640.1

name	Habp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122612 GeneID:226243 MGI:1196378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronic acid binding protein 2 transcript_id : NM_146101.1

name	Nrap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606371 GeneID:18175 MGI:1098765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nebulin-related anchoring protein transcript_id : NM_198059.2

name	Nrap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606367 GeneID:18175 MGI:1098765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nebulin-related anchoring protein transcript_id : NM_008733.3

name	Casp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891757 GeneID:12369 MGI:109383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase 7 transcript_id : NM_007611.2

name	9930023K05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803052 GeneID:226245 MGI:2443041
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930023K05 gene transcript_id : NM_172641.2

name	Dclre1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145468 GeneID:55947 MGI:1930042
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA cross-link repair 1A, PSO2 homolog (S. cerevisiae) transcript_id : NM_018831.3

name	Nhlrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384823 GeneID:66866 MGI:1914116
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NHL repeat containing 2 transcript_id : NM_025811.2

name	Adrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680665 GeneID:11554 MGI:87937
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, beta 1 transcript_id : NM_007419.1

name	EG629643 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270580 GeneID:629643 MGI:3648860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : predicted gene, EG629643 transcript_id : XM_894554.2

name	A630007B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25072200 GeneID:213993 MGI:2445022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630007B06 gene transcript_id : NM_170757.1

name	1700010L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270523 GeneID:75628 MGI:1922878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700010L13 gene transcript_id : XM_001479353.1

name	Tdrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355695 GeneID:83561 MGI:1933218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 1 transcript_id : NM_001002238.1

name	Tdrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355699 GeneID:83561 MGI:1933218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 1 transcript_id : NM_001002240.1

name	Tdrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355697 GeneID:83561 MGI:1933218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 1 transcript_id : NM_001002241.1

name	Tdrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475714 GeneID:83561 MGI:1933218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 1 transcript_id : NM_031387.2

name	Vwa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42741660 GeneID:240675 MGI:2684334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : von Willebrand factor A domain containing 2 transcript_id : NM_172840.2

name	Afap1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122606 GeneID:226250 MGI:2147658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin filament associated protein 1-like 2 transcript_id : NM_146102.1

name	Ablim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016177 GeneID:226251 MGI:1194500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin-binding LIM protein 1 transcript_id : NM_178688.2

name	EG668259 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405995 GeneID:668259 MGI:3644656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668259 transcript_id : XM_001004102.1

name	Gucy2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487301 GeneID:73707 MGI:106025
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0004383 - guanylate cyclase activity [Evidence ISS] [Evidence IDA]; GO:0008528 - peptide receptor activity, G-protein coupled [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA] GO_process : GO:0006182 - cGMP biosynthesis [Evidence ISS] [Evidence IDA]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : guanylate cyclase 2g protein_id : NP_001074545.1

name	Acsl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58218988 CCDS:CCDS29908.1 GeneID:433256 MGI:1919129
definition	EC_number : 6.2.1.3 GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : fatty acid Coenzyme A ligase, long chain 5 product : acyl-CoA synthetase long-chain family member 5 protein_id : NP_082252.1

name	Zdhhc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75992952 CCDS:CCDS29909.1 GeneID:66980 MGI:1914230
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC domain containing 6 protein_id : NP_001028745.1

name	Zdhhc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75992950 CCDS:CCDS29909.1 GeneID:66980 MGI:1914230
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC domain containing 6 protein_id : NP_080159.3

name	Vti1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13928668 CCDS:CCDS29910.1 GeneID:53611 MGI:1855699
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vesicle transport through interaction with t-SNAREs 1 homolog product : vesicle transport through interaction with t-SNAREs homolog 1A protein_id : NP_058558.1

name	LOC100043479 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270577 GeneID:100043479
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480679.1

name	Tcf7l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543849 CCDS:CCDS29911.1 GeneID:21416 MGI:1202879
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : transcription factor 7-like 2 product : transcription factor 7-like 2, T-cell specific, HMG-box protein_id : NP_033359.2

name	LOC100043484 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270579 GeneID:100043484
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480690.1

name	Habp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122613 GeneID:226243 MGI:1196378
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence ISS] [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : hyaduronic acid-binding protein 2 product : hyaluronic acid binding protein 2 protein_id : NP_666213.1

name	Nrap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606372 CCDS:CCDS29914.1 GeneID:18175 MGI:1098765
definition	GO_component : GO:0005916 - fascia adherens [Evidence IDA]; GO:0005927 - muscle tendon junction [Evidence IDA]; GO:0030016 - myofibril [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IPI] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051371 - muscle alpha-actinin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0017166 - vinculin binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS] codon_start : 1 note : isoform C is encoded by transcript variant 1 product : nebulin-related anchoring protein isoform C protein_id : NP_932307.2

name	Nrap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606368 CCDS:CCDS29913.1 GeneID:18175 MGI:1098765
definition	GO_component : GO:0005916 - fascia adherens [Evidence IDA]; GO:0005927 - muscle tendon junction [Evidence IDA]; GO:0030016 - myofibril [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IPI] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051371 - muscle alpha-actinin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0017166 - vinculin binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS] codon_start : 1 note : isoform S is encoded by transcript variant 2 product : nebulin-related anchoring protein isoform S protein_id : NP_032759.3

name	Casp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680850 CCDS:CCDS29915.1 GeneID:12369 MGI:109383
definition	GO_function : GO:0030693 - caspase activity [Evidence IDA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007507 - heart development [Evidence IGI]; GO:0006917 - induction of apoptosis [Evidence IEA] [Evidence IGI]; GO:0001836 - release of cytochrome c from mitochondria [Evidence IGI]; GO:0009411 - response to UV [Evidence IGI] codon_start : 1 product : caspase 7 protein_id : NP_031637.1

name	9930023K05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369924 CCDS:CCDS29916.1 GeneID:226245 MGI:2443041
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC226245 protein_id : NP_766229.1

name	Dclre1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145469 CCDS:CCDS29917.1 GeneID:55947 MGI:1930042
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006289 - nucleotide-excision repair [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : DNA cross-link repair 1A, PSO2 homolog protein_id : NP_061301.2

name	Nhlrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789158 CCDS:CCDS29918.1 GeneID:66866 MGI:1914116
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA] codon_start : 1 product : NHL repeat containing 2 protein_id : NP_080087.1

name	Adrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680666 CCDS:CCDS29919.1 GeneID:11554 MGI:87937
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0004940 - beta1-adrenergic receptor activity [Evidence IMP] [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0050873 - brown fat cell differentiation [Evidence IGI]; GO:0002024 - diet induced thermogenesis [Evidence IGI]; GO:0042596 - fear response [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP]; GO:0031649 - heat generation [Evidence IGI]; GO:0001997 - increased strength of heart contraction by epinephrine-norepinephrine [Evidence IMP] [Evidence IDA]; GO:0040015 - negative regulation of body size [Evidence IGI]; GO:0002025 - norepinephrine-epinephrine vasodilation during regulation of blood pressure [Evidence IGI] [Evidence IMP]; GO:0001996 - positive regulation of heart contraction rate by epinephrine-norepinephrine [Evidence IMP]; GO:0009409 - response to cold [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : beta 1-AR; cardiac beta adrenergic receptor product : adrenergic receptor, beta 1 protein_id : NP_031445.1

name	EG629643 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82998772 GeneID:629643 MGI:3648860
definition	codon_start : 1 product : similar to macrophage migration inhibitory factor protein_id : XP_899647.1

name	A630007B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25072201 CCDS:CCDS29921.1 GeneID:213993 MGI:2445022
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : oocyte-testis gene 1 protein_id : NP_739563.1

name	1700010L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270524 GeneID:75628 MGI:1922878
definition	codon_start : 1 product : hypothetical protein LOC75628 protein_id : XP_001479403.1

name	Tdrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355696 CCDS:CCDS29922.1 GeneID:83561 MGI:1933218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0018994 - polar granule [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : tudor domain containing 1 isoform 1 protein_id : NP_001002238.1

name	Tdrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355700 CCDS:CCDS29922.1 GeneID:83561 MGI:1933218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0018994 - polar granule [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tudor domain containing 1 isoform 2 protein_id : NP_001002240.1

name	Tdrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355698 CCDS:CCDS29922.1 GeneID:83561 MGI:1933218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0018994 - polar granule [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : tudor domain containing 1 isoform 3 protein_id : NP_001002241.1

name	Tdrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878217 GeneID:83561 MGI:1933218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0018994 - polar granule [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 4 is encoded by transcript variant 4 product : tudor domain containing 1 isoform 4 protein_id : NP_113564.1

name	Vwa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42741661 CCDS:CCDS29923.1 GeneID:240675 MGI:2684334
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : VWA-like domains, matrilins and collagens product : von Willebrand factor A domain containing 2 protein_id : NP_766428.2

name	Afap1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122607 CCDS:CCDS29924.1 GeneID:226250 MGI:2147658
definition	codon_start : 1 product : actin filament associated protein 1-like 2 protein_id : NP_666214.1

name	Ablim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016178 GeneID:226251 MGI:1194500
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IDA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : actin-binding double zinc finger protein product : actin-binding LIM protein 1 protein_id : NP_848803.2

name	EG668259 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405996 GeneID:668259 MGI:3644656
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004102.1

name	Ppnr (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270329 GeneID:26930 MGI:1349458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : per-pentamer repeat gene transcript_id : XR_035714.1

clone name	MSMg01-455J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034L24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-085D12.T7 (MSMg01no085_d12.b1)	MSMg01-085D12.TJ (MSMg01no085_d12.g1)
ACC	AG304867	AG304868
length	3,872	1,310
length of high quality (start - end)	---	265 (123 - 387)
definition	CHROMAT_FILE: MSMg01no085_d12.b1 PHD_FILE: MSMg01no085_d12.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:35:41 2005	CHROMAT_FILE: MSMg01no085_d12.g1 PHD_FILE: MSMg01no085_d12.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:35:41 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TCAGTGAGATTATGAGAGGAGTAATGTANAATAGTGTGTNAGTTAATCTT GTATATACATATAATAGTGTATGGTGGTGTGGTGAGTATGATATATGTGA GTATANTACTATATATNTAATATAGTAGGAGGTGTAGGTAGTAGAAGTAG TAATATATTTNGTTATGATAGTCTATAGANTATATAATGAATAGAGATAN AGANGGNTTGATAGTAGAGATATAGTAAAGAGTAAGGCCCCGCTGTATAT TATAGATAGAGAGAGGAGTGTGGNCAGGTGNANANAGTGATTAANAAATG AAGATATATAGAGTAGGATATTAGGATGATAGTGTAGTGTGAGNAGATGG TAGAAGAGAGTATCGCTCTTGTGTAATAGTAGGGAGAATAGGTATGTTGT CCCGCCCCAACGCTATGTGTTTATGAGAATATAGAGTAATGTAGAGGTAT GTGTATATATGTAGATAGTATATGGTTAGATGTGTTATATNGTAAGGTAG TAGTAGATNAATATGGTATGATATAGTATTGAGGTGTAGATAANTATAGA GAGTAGTGTAGTAGAAGTGTGATTGATGTTGAGAGTGTATATAGTAGATG TATGAGTATAGTAGTAAGTGGTATATAGTGATAGTTGATGAGTATAAGGA TATGTAGAGTAGATAGTANTGTAAGAATAGAACTAGAGATGATTGGTGTG ATGAGTATGCTTAGTGANTAGTATAGTATATATAGTGATATGTATANTAA CATAGGATACTGANTATGTAGATATATAGATATGGATATAGGTATAGATG ATAGATGCTTATTANNTATAGGTGNTATTATAATATGTAATGTATGAATG TGTGAATAGAGTAGTAGTGTATATATAATAGTGAGGTAACGGTATATTAT AAGATAGATATTANAATATGTATATTANTGTAGTAGTGAGTAGTGGTATA AGTAGTATGAGAGTAGAGTGGTTAGAGTGGCTAATATTTTATGTAATGTG AGTATATTATGNTTATGTTAGTAGTATGAGTGTAGATGNATGTAAGATAT GCTATATATTAGGCATGATAGAATATAATAGTGTNATGTGGTGTAATAAT AGTGATATGTTGATATTATATAGAGAGTCTTATAGATATANTATGATATA ATAGTGCATTTGTATNATAAGATATGATATAGAGTTGATAGTTAGTTGTG AATAGATATGTGGTATAGTAATAGGAATATAGAGATAGATGANGAGAGTG TATGTATTAGTGTTGTATGTGTATAGCGAAGTGAGATGAGAATATATGAA TAGATAGATCTAGTAGGAGANATAGAGCATGTGTATGTGTCTAATACTAT GTATTATGTTGATTGTAGGTAGTATAGTGTATNTAAGTGACGATAATATA TGATTATGCAATAGTAATATATATAGATTCATAATAGTGATATGAATATA ATANGTATAGGTAGATATAGATATAGAGATAGTTGTAGATATGTGTATGT GTTATTGTATATATATGATGATGNTAGTATGTGGTAGAGTATATATATAG TATATTAATATTACTATACACTGTTATGTAATANTAGGAGTTGTAATCTA TGTGANGTAATTATGCATGGCAGATATAGAGTATTATAGAGTGANTAAGA GTATACAAGATGGTATGTGTGAGTGATGTAGNTGTGATCGTGATGTAGAA GNTAGAGTGATGATATAGTAGTATGATGTTATGNATTTGCTGGTAGATGT GATATGCGGATGATGTGTAGATGAGTAAGATNAATAGAGAGNATGCATGG TGTAGAGTGATAGTGTAGTGTATGAGGTAGTATAGTGTATAGGTAGATAA GGTAGTAGTATAGTGTGTATGTGTAGATGTAGAGTAATTTGANGATANTG TATGCAATGATGTGTAGAGTATAGAAGATAGTAGTTATGAGNTAGATGTG TAGTATATATGTAGGTAGTGTATATGAGNTATAGTGGTGTNTGTANTATA ATAGTTGTATATAATATAGATATGTAGTNGTATGTTATACTAAGTTATGC TTAGTGATAGAGGATGTATAGTGATGAGAGTTACTAATACTNTAGGTAGT GGGATGANTGTATANGTNGATAGATACTAAGCATATGNTGTAGANAGTAG GAGTATAGTATAATANTATACANTATATGGATGTAGAGANGTAGCATTGT AAGTTATATAGANTATTTAGATATATAGAGTATAANNTACTGGGTGACTG ATATACTGTGGAGATATGANTGGAGAACGTATTATAGATGNAGTAGTGAG TAGTGANATGATGAGAGAGATAGGNTATATGTTGCGATGAGCAGTAGTAG TGTGATGCATNTGGGATGAGATAGAGTGATAATGTGAAGNTGTACGTAGT GTAGTACATGAGTGATGAGAGTGTAATGATATACATGATAGTGAGTAGTA GTGATGAGAGNATGNTANATATATTATGACGTAGTAGTATATAAGTAATG ATTGNCTGTAGATATATANTGATNGATAGATGTGTAGTATNATCTGTAGA TTAGAGTGNATGATTATGAGTGTGTAGNTNAGTNGTATGAGAGATGAGTG AGCATTGTGTTAGTGCGAGTAGTATGTACATAGTTTAACNATGTGATATA TAATGATAGTAGATATGTATACTAGATACATTAGTGCTTAGTATAGTAGT AGTATAGTCATAGTGTGTAGAGTCGTGTCTTGCTGAATATAGTGTTAGTT NGAGTACAGCGAGACTGATTATGATATTATAGTGTGTGATGTGAGAGAGT TAGTATTAGATAGTTATATATTATTAGCATAGTATATATATGNTANANAT AGTAATATAGTATGNTNTGTGAGTAGAGTGAGCTAATGATAGTATATTAT ATACGTGAGTGATTAGTATACTGTGTGTGNTATGTGATGGTAGTATTATA CTAGTATAGACGGATAAGTATGTGAGTATGNGTATAGTAGTGTATAGGAT GAGTAGTNNNATAACTATACNTGTAGTGNNGACTGATGATANATAGAGTN TATATATGTTAGTGAGATAAGTAGTATAGTAGAAGTCTATACTGAGTGAT ATAAGAGTGATGGATGAGAATANAGTATAGATGTAATGAGTATTATATGT GAGATATGAATAATAGAGTGTAGTAGNAGTAGGATGTAGATGNCATAGTA TNTATAGTGTGTGTATAGTCTAGAAGTGTAGNTAGTAATACGATTGTATT GGTGGTGTATATATGAGTGAGATATGNATGTGNGATAGATATATGATCNT GANTAGTGTAGTATGTGTTATATGTTANAGAGNTTTAGATTGTGTATGNT AGTAGTGAGTTATATGAGTATGATGNTAATATNTGNTANTATCATGAATA TGAGTAGATTACATGANTATCTGGTATAGTATTTAGTANTGTATATGNAG TATGCTNATATATTAATGCATAGAANGGTCATGTTGATATNTATATGTAA GTGTAGATAGTTAAGNNTATAGTGTATAGTGAAGAGTGTAGTCAGTATAT TATGATATNGATATGTGGATGATGTGAGATAGTAATGTGTAGTATGAGGT GTAGTAGTGTAGTATGAATANTAGTGTAGATGATGAGATGTGTAGATGTT ACTAGTAGTATGTTGTGCTAGATACCCATATGTGGATGATTANTATGTAG AGTATGAGTGATANTGAGATAGTGTATAGATGATGTAGTGAGTTTGAATA GTNGTGATAGTTATGTCANNAGATGATGAGATANGAGACTGATGTATATT AGTAGNATGTGTAGTGATANNCGTACGATNAGTACACAGTAGTAGTGTAG TATGTGTGTAGTNTANTGTGTG	NTTTATGTATGGAGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXCCTTTGAAATCCCTACATGTGATCTTTGCAGGGTG GGTGCTCTATTATATAATAGCCGGAAAGTTGGGGTTCAAATTTCAGCGAC GTGGCTTCTTTGTGATCCGTTTTTCATTGCTTTGTAAGGATGTAGCTGCA TTTGAATTGCCATGTTCCTGGGAGTTAACTGTGATAAAAATCCCTGTTTC ACCACACGGGGCTGGGAAAAGAGTAACTTTTTCAGTTGGTCTGTGCCCTC TCAGAGGTGAATAGCTGCTTCCCACACCTCCCCAAGGCAAGCAATAAGTG TTACAGTTTTTACCTGCTACGCCTGTGAGCAGATAGACTCGGGCCATTTT TTTTAAAGCTTTCAGCATCAGGTTGCCAGGCCATCTCTCTAAACAAGAGG ACTATCTCACAGGGAGTAAGGCAGGAACGTGGAACAGGATCTGAGGCACC ATTTCAGAGAGCAATCACTGTTGTCTGATCATTCCTTCCTGCGTTGTGGT CTGTTTATGTTTTGCTATCATATGACTTATGTGAGGATTCCAAGACCTTT ATGATGGACTGTGTTTTTCTAATACATGGTTGCCTTCTCTCACCTCTCCT TTTTTTATATTTCTCCTATAGACCCCTTTTTTCTATTTTTTATGTTCTTT TTAATTATTGTTTTTTTAAAATTCATTTCCTCTGACTTTTTTATTGTTAC TTCTTTTTTCTTTTTAATTCTTATATATATTTAATTTGTCCTACTTTTAT ATTATTCTTTCATATTTTTTTCTTTTCTTTATCTTTCTTATTTTCCTTTT TTCTTATTATCAATTTTCTTTTTCTTATTTTTTATTTTTTTTTTTTTATT TTTATTTTTATTTCATTTATTCTTTTTCTTATTTCTTATTTCTACATTAT TCTTTTTTTTCTCTTCTTCTCTTTTTTTATTTTATTTTTTTTATTTATCT TTATTTTTTCTATCTTACATTTTTCCTTATTTATTTCTTATTCTTATTTT ATTTCTATTTATAATTATCTATTTATTTTCCAATTTCTTCTTATCCTTAT CATATTTATATTGTCNCCCCCTATTTGATATATTTTTTTTTTTCATATTT TATTATTTTTTAGATTTTATAATCTCTTTGTCTCTATTTATTCTTATTCT TCTTTATTCATATTTCTATTATTATTATCTATATTCTATATACTATTTCA TTATTCTTATTTTTTATATTTCATTTAGCTCTGTACTTTACTTTTCATTA CTCTCTTTTA
quality values	Open. Hide. 9 9 9 14 15 22 13 9 9 9 7 9 6 7 6 8 8 8 8 8 10 8 8 8 8 6 8 3 0 3 10 10 8 10 9 9 9 9 3 0 3 8 8 6 6 7 6 6 6 8 8 8 8 12 13 8 7 7 7 8 8 8 8 8 8 8 7 7 6 8 8 8 8 6 9 8 7 7 7 7 7 9 9 8 8 8 7 6 6 6 8 13 6 8 8 8 8 8 8 8 6 9 12 15 3 0 3 6 6 6 6 9 6 6 6 3 0 3 8 8 9 9 7 8 8 6 6 7 7 7 7 7 6 6 6 15 7 6 6 8 6 6 7 6 10 10 6 7 6 6 8 8 7 9 9 9 13 7 10 3 0 3 6 6 6 6 6 9 8 6 7 6 6 7 8 10 8 10 3 0 3 17 7 7 6 6 6 7 6 6 8 7 9 16 16 19 18 19 3 0 3 7 3 0 3 3 0 3 6 6 6 6 6 6 6 6 7 10 15 11 14 11 8 8 8 8 8 9 8 8 7 8 6 6 6 7 9 9 8 8 8 8 10 10 8 8 8 6 6 6 6 8 8 8 9 9 9 9 12 12 14 10 8 10 10 6 6 7 8 8 8 8 3 0 3 6 8 6 6 3 0 3 0 3 0 3 8 6 6 6 6 6 6 3 0 3 7 7 13 8 6 6 8 8 8 8 8 8 10 15 10 6 6 8 6 6 8 6 6 6 6 6 6 6 6 8 8 8 8 6 6 6 8 8 9 15 7 7 7 7 7 7 3 0 3 6 8 10 9 9 8 8 6 6 6 6 6 9 9 11 11 9 9 9 9 9 9 8 6 6 6 6 6 6 6 6 8 8 8 8 8 6 6 6 6 8 8 6 6 6 6 6 9 9 9 9 7 10 8 8 6 6 6 6 6 7 7 6 6 6 6 6 6 8 8 8 8 9 9 8 7 6 6 6 6 8 8 8 8 8 8 8 10 8 8 6 6 8 6 8 8 7 8 8 7 7 6 6 8 8 8 6 6 6 6 10 8 10 10 7 8 9 11 11 11 11 11 11 9 9 8 7 8 8 8 8 8 8 8 8 6 6 8 6 6 6 6 6 6 3 0 3 7 8 8 8 8 8 8 6 6 8 8 8 6 8 10 3 0 3 9 11 9 8 8 6 6 6 6 8 8 10 10 10 10 9 10 10 9 6 6 6 6 6 8 6 6 6 6 8 8 8 3 0 3 7 10 9 10 10 11 10 10 8 8 8 6 6 8 8 8 8 9 8 6 8 8 8 8 8 8 6 6 8 8 6 6 8 8 9 9 9 8 8 6 6 8 6 6 10 19 10 10 9 10 13 10 8 8 8 8 11 9 9 9 11 16 12 11 11 10 10 13 14 9 6 6 6 6 6 6 6 11 15 13 8 8 8 8 9 10 6 6 6 6 11 13 8 8 8 8 8 10 9 9 9 9 13 10 9 9 11 10 12 9 12 9 9 9 9 13 22 10 8 8 8 8 3 0 3 7 7 8 6 10 9 7 7 10 10 8 6 6 6 6 8 8 9 6 8 6 6 8 8 10 9 10 11 11 16 15 12 11 11 12 6 6 6 6 6 6 8 9 10 12 15 3 0 3 8 8 10 10 10 10 8 8 8 10 12 9 7 7 7 7 9 9 13 7 8 6 6 6 7 7 3 0 3 10 7 7 6 7 7 7 6 6 6 6 7 6 8 3 0 3 6 6 6 6 6 6 6 8 8 10 13 10 9 9 9 10 10 8 8 6 7 6 6 6 6 8 6 6 8 6 6 6 8 8 10 12 12 8 11 11 14 10 8 8 8 6 6 8 3 0 0 3 8 8 8 8 6 6 3 0 3 10 9 11 9 9 9 9 10 15 13 13 10 15 8 10 6 6 6 10 7 7 7 6 6 6 6 6 6 9 10 10 11 11 11 19 17 8 8 8 8 12 8 8 9 6 7 7 12 10 14 18 12 12 9 7 8 10 15 8 6 6 6 6 6 6 7 7 7 10 10 10 8 8 8 8 8 8 10 9 7 7 7 8 8 8 10 3 0 3 10 10 8 8 8 8 10 10 8 8 8 3 0 3 11 8 8 8 8 9 8 8 6 6 6 6 6 6 6 8 8 10 6 6 6 7 6 7 8 8 9 10 10 9 6 6 6 6 10 6 6 8 8 8 6 6 6 6 6 8 6 6 6 6 8 6 6 7 13 12 11 10 8 8 8 8 7 6 6 8 8 8 6 6 6 6 8 8 9 10 8 6 10 6 6 3 0 3 10 8 7 7 6 11 13 10 14 18 17 12 9 9 9 9 9 9 10 8 6 6 6 6 3 0 3 6 8 8 8 8 8 8 10 10 10 8 6 6 6 6 8 7 6 6 6 6 8 6 6 6 8 9 9 11 10 10 10 10 10 13 10 6 6 6 6 8 8 10 3 0 3 10 9 8 6 6 6 8 7 8 8 8 8 8 8 10 10 8 10 10 11 10 8 7 7 7 8 8 9 9 9 9 8 8 10 8 8 8 9 7 7 8 7 7 7 8 8 6 6 6 7 8 8 10 3 0 3 10 10 13 12 15 12 12 10 10 6 6 6 6 8 8 8 8 8 6 8 6 6 3 0 3 9 7 6 6 6 7 7 10 8 10 9 10 10 8 8 8 8 8 7 6 6 6 6 8 8 8 10 10 8 8 8 6 6 8 9 8 8 8 8 11 10 10 8 8 8 8 8 10 8 8 8 8 8 8 10 11 6 6 6 10 6 8 8 8 10 8 8 8 8 8 6 6 6 6 3 0 3 7 7 7 9 9 10 10 10 8 6 6 6 6 6 6 8 8 8 8 6 6 6 7 6 6 6 6 7 8 8 8 6 6 6 6 6 6 6 8 6 9 9 9 9 7 7 7 8 8 10 12 8 8 6 6 6 6 8 6 6 12 7 9 11 10 8 8 8 8 8 10 10 8 9 10 3 0 3 6 8 6 9 9 9 9 9 9 6 6 6 6 6 6 6 6 8 10 7 9 12 15 14 9 9 9 9 8 8 7 7 6 6 8 6 7 8 8 8 8 8 8 8 8 8 8 10 13 15 10 10 8 8 8 8 8 8 12 3 0 3 6 6 6 8 8 6 6 6 8 15 13 13 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 7 8 8 9 10 12 13 10 10 10 14 9 6 6 6 6 8 8 6 6 8 7 8 8 8 8 8 8 8 8 8 6 6 6 6 8 8 3 0 3 8 7 8 6 6 6 6 6 8 10 6 6 6 6 6 6 6 7 9 9 9 10 9 10 12 8 9 9 9 9 10 8 9 10 10 10 24 12 8 8 6 6 8 8 10 14 15 8 8 10 10 10 8 9 6 6 6 6 6 8 11 12 8 6 6 6 8 3 0 3 8 8 8 10 10 9 8 8 8 10 8 8 8 10 9 9 10 10 9 9 13 10 8 8 8 8 8 15 8 8 9 9 10 19 14 16 12 8 8 8 10 10 9 8 8 8 8 8 8 8 8 6 6 6 6 8 8 3 0 3 6 6 6 6 8 8 9 9 8 6 6 6 6 6 7 6 6 9 12 3 0 3 9 10 8 8 8 8 8 6 6 6 6 6 6 10 9 12 15 18 9 9 8 8 8 6 6 6 6 8 8 8 8 8 8 8 6 8 3 0 3 7 8 13 10 6 8 6 6 6 6 6 6 6 8 6 6 10 6 8 8 8 8 8 8 8 9 9 10 10 10 8 8 6 6 3 0 3 10 7 7 6 6 6 6 8 11 6 6 8 8 9 10 7 8 3 0 3 8 9 9 17 14 9 9 6 6 8 8 8 8 9 8 12 7 6 8 8 8 9 8 8 6 6 6 6 8 3 0 3 6 8 8 8 8 10 6 6 6 6 6 6 6 7 6 6 6 8 8 8 7 6 6 8 8 13 9 9 9 8 10 9 7 8 10 10 11 6 6 6 8 8 11 17 11 3 0 3 6 6 8 6 9 9 13 3 0 3 9 9 9 7 6 6 6 8 8 8 6 8 6 6 6 6 6 8 8 11 9 19 8 6 6 8 8 10 9 9 10 10 8 8 8 8 6 6 6 7 7 7 10 8 6 6 6 6 8 8 8 8 8 8 8 7 6 6 6 6 15 8 11 6 6 6 7 8 8 6 6 6 6 6 8 8 8 12 13 13 15 8 8 8 8 6 8 6 6 8 8 8 8 6 8 8 8 8 3 0 3 8 8 3 0 3 9 6 6 8 6 6 6 8 7 8 10 8 8 10 9 9 9 9 8 8 9 10 10 7 7 8 8 8 8 8 8 8 8 8 10 10 10 8 11 9 9 3 0 3 8 8 8 9 9 10 8 6 6 10 8 13 12 13 11 8 8 6 6 6 6 8 6 8 7 8 8 8 7 7 8 8 8 7 3 0 3 8 8 10 8 6 6 6 6 6 3 0 3 9 9 3 0 3 8 8 8 8 8 10 11 9 8 8 8 11 8 6 6 6 6 10 8 9 14 18 21 17 11 8 8 8 8 8 3 0 3 7 7 7 6 6 8 8 8 7 7 8 6 8 6 6 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 10 10 8 8 6 6 8 8 8 6 6 8 8 6 7 9 12 8 8 10 6 6 3 0 3 6 7 6 8 6 6 7 7 8 8 8 9 9 3 0 3 11 11 10 9 3 0 3 3 0 3 8 6 6 6 6 6 6 6 6 6 10 8 7 9 9 9 9 3 0 3 8 6 6 6 3 0 3 8 7 6 8 8 8 6 6 10 10 8 8 8 8 6 6 6 6 3 0 3 8 7 7 7 3 0 3 8 6 10 9 6 7 6 9 10 8 10 8 8 8 3 0 3 8 8 8 9 11 12 11 8 8 6 8 6 6 6 6 8 6 14 7 7 3 0 3 6 6 6 8 8 8 8 8 8 11 9 8 8 6 6 6 6 8 8 9 3 0 0 3 6 6 6 6 6 6 8 8 8 6 6 6 6 7 7 12 11 19 15 11 8 8 8 8 8 8 10 10 8 6 3 0 3 7 6 6 6 7 6 6 6 6 6 6 6 6 6 6 6 9 10 3 0 3 9 9 9 8 8 8 8 10 8 8 8 10 16 3 0 3 6 6 6 9 9 10 11 10 9 9 9 6 8 6 6 3 0 3 7 7 8 8 8 9 9 7 6 6 6 7 6 6 6 6 7 8 8 8 9 8 8 8 6 6 6 6 6 8 9 7 10 3 0 3 6 6 6 6 8 8 10 10 13 13 8 8 10 10 8 7 7 9 9 9 9 7 7 7 8 8 3 0 3 10 8 6 6 6 6 8 8 8 8 6 6 6 8 6 6 6 8 8 10 15 12 9 8 6 8 6 7 7 6 8 8 8 8 11 8 9 13 9 8 8 6 6 6 7 8 8 10 10 10 10 10 11 6 6 6 8 6 6 6 6 6 6 11 8 7 8 8 3 0 3 6 3 0 3 3 0 3 6 9 6 8 10 10 10 10 11 6 6 6 6 8 6 6 6 11 7 9 8 8 7 9 9 13 7 7 7 6 6 6 6 6 3 0 3 8 8 8 8 8 8 8 8 8 10 8 3 0 3 12 9 3 0 3 6 8 6 6 7 7 10 10 9 6 6 6 6 8 3 0 3 6 6 6 8 8 8 8 8 6 6 8 15 19 13 13 3 0 3 6 8 6 6 6 6 6 6 8 8 8 8 10 10 10 10 3 0 3 0 3 8 3 0 3 6 6 8 6 6 8 10 10 6 6 6 8 6 9 9 9 6 6 6 6 6 6 8 10 8 8 8 13 9 9 9 6 8 6 7 8 6 8 8 8 8 6 7 8 8 8 6 6 6 7 7 7 6 3 0 3 10 10 8 8 8 8 8 8 9 7 7 8 6 8 6 6 6 6 8 6 8 10 10 12 10 8 6 6 6 6 7 7 8 10 10 8 12 9 8 6 6 6 6 6 10 8 8 6 6 6 8 11 8 8 6 6 6 6 6 8 8 8 10 8 6 6 6 6 6 10 6 6 6 6 7 12 12 15 12 8 8 6 6 6 6 8 6 6 6 8 6 6 6 6 6 6 8 8 8 6 6 8 8 7 6 6 8 8 3 0 3 8 8 9 9 9 9 9 7 6 8 8 6 6 6 8 6 6 6 6 7 6 6 6 6 8 12 12 10 8 6 6 6 8 12 10 8 6 6 8 6 8 8 6 9 9 13 8 8 8 8 8 19 10 8 8 8 8 8 13 8 9 9 9 8 8 9 10 9 9 9 8 6 6 6 6 8 8 8 12 13 8 8 7 6 9 10 10 13 9 3 0 3 3 0 3 0 3 8 6 6 6 6 8 8 8 9 7 7 7 8 8 3 0 3 0 3 8 6 6 6 6 8 8 8 8 10 8 9 9 9 9 9 10 10 11 11 11 13 13 10 9 9 8 8 8 7 8 9 13 13 9 9 6 6 6 6 8 8 9 6 6 6 6 8 8 8 8 8 8 8 8 8 8 9 8 8 3 0 3 10 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 8 6 6 6 6 8 10 14 10 15 15 8 6 6 6 6 7 6 8 8 8 11 11 8 8 8 8 8 8 8 8 3 0 3 8 6 6 6 7 8 8 10 9 6 6 6 6 6 6 6 6 6 6 7 7 6 6 8 3 0 0 0 3 7 6 6 6 6 6 8 6 3 0 3 13 19 8 8 8 3 0 0 3 6 6 6 6 6 8 6 7 7 3 0 3 8 8 6 6 6 3 0 3 8 6 8 6 6 6 6 6 6 6 8 6 7 7 8 8 8 8 8 15 8 8 8 8 12 14 13 8 8 8 6 6 6 6 6 6 6 6 8 6 7 6 7 8 6 6 6 6 6 10 8 10 9 10 10 8 8 6 6 6 6 6 6 6 6 8 10 10 10 9 3 0 3 8 7 6 6 6 8 8 10 7 6 10 6 6 6 6 10 8 13 10 12 10 11 8 9 9 9 9 10 10 12 10 12 8 8 8 8 6 6 7 6 6 8 8 13 8 8 8 9 8 6 6 3 0 3 8 10 8 8 8 8 13 10 8 8 8 8 8 3 0 3 7 7 6 6 6 6 3 0 3 13 10 12 13 13 9 10 9 9 9 8 8 8 8 7 6 6 6 6 6 6 8 6 6 7 6 6 3 0 3 8 8 6 6 8 6 6 6 6 6 8 6 6 6 6 8 10 6 6 8 11 9 9 10 12 15 13 12 13 10 8 8 8 8 8 8 8 8 8 10 15 17 3 0 3 7 8 8 3 0 3 6 6 6 8 8 10 10 10 14 21 18 19 10 3 0 3 9 3 0 3 10 8 10 9 9 9 11 12 15 15 8 8 6 6 6 6 6 6 10 8 10 10 3 0 3 8 8 3 0 3 6 6 6 8 6 8 8 8 10 10 10 10 9 3 0 3 9 13 13 8 8 8 8 9 9 9 9 9 10 8 8 8 8 8 8 8 9 9 9 9 3 0 3 8 8 8 8 3 0 3 3 0 3 3 0 3 6 6 6 6 6 10 10 12 14 10 14 11 10 8 8 6 11 7 7 6 6 7 6 8 6 3 0 3 8 7 9 9 8 8 10 8 6 6 7 7 8 8 8 8 8 9 13 3 0 3 13 10 11 8 8 7 3 0 3 6 6 6 6 6 10 3 0 3 6 8 8 6 8 6 6 6 6 8 7 9 12 10 10 10 3 0 3 6 6 6 6 8 6 6 6 6 6 6 6 3 0 3 10 13 10 6 6 6 6 6 6 8 8 9 8 8 8 6 7 8 8 6 6 8 3 0 0 3 8 8 8 15 8 8 8 8 8 8 8 8 8 8 8 8 10 10 8 15 8 6 6 6 6 6 8 6 7 7 6 10 11 8 10 8 8 8 8 3 0 3 8 8 10 6 6 6 6 7 10 8 8 8 8 8 8 8 8 8 10 10 10 10 6 6 6 6 6 6 6 8 6 6 12 12 20 12 10 12 9 9 9 8 8 6 6 6 6 8 10 17 8 8 8 8 8 10 10 10 11 3 0 3 10 7 7 8 8 8 8 17 13 12 10 6 6 8 8 6 6 8 8 9 9 10 10 10 6 7 6 7 6 6 6 6 6 8 6 7 8 15 15 15 12 9 9 8 8 8 6 7 8 6 6 6 6 7 7 6 8 6 6 8 6 6 6 6 6 6 6 6 8 3 0 3 9 8 8 8 10 8 8 6 7 7 6 6 6 6 6 6 6 8 3 0 3 8 8 8 8 10 11 10 10 10 10 8 8 8 8 8 11 8 8 6 6 6 7 7 10 6 6 6 6 6 6 6 8 8 8 8 8 3 0 3 8 8 8 8 12 8 8 8 8 8 8 7 7 3 0 0 3 8 8 6 6 6 6 13 8 9 7 8 3 0 3 6 6 6 6 6 6 6 6 6 6 10 8 6 6 6 6 8 8 6 3 0 3 7 7 8 10 6 6 8 6 6 6 6 3 0 0 3 6 6 6 6 6 6 3 0 3 8 6 6 6 6 7 7 8 10 10 10 9 8 15 8 8 8 6 6 6 10 8 10 10 15 11 14 15 10 9 3 0 3 3 0 3 9 9 9 9 9	Open. Hide. 0 3 6 6 6 8 6 6 6 8 8 8 11 8 8 8 8 8 13 9 9 9 8 8 8 8 8 8 11 21 17 22 10 10 10 22 21 29 20 20 20 33 36 36 34 34 42 47 39 39 39 39 40 43 44 48 48 41 41 41 41 25 27 10 9 11 10 10 6 6 6 6 8 8 12 11 9 9 19 17 25 24 30 35 36 36 38 53 50 53 50 53 57 57 48 47 28 28 28 28 26 30 18 21 10 11 11 9 10 10 15 13 15 19 23 18 12 12 11 11 9 9 9 15 23 32 48 48 43 44 43 43 43 40 43 43 43 48 54 54 54 48 48 54 54 54 54 44 44 41 37 37 37 31 35 39 42 46 54 48 44 54 54 57 57 59 57 57 48 48 48 57 57 57 57 57 57 57 57 57 57 57 50 50 50 50 47 57 57 57 57 44 44 50 50 50 50 50 48 48 57 57 57 57 52 52 52 57 52 57 57 57 50 50 35 35 32 38 32 41 33 43 43 41 41 41 50 52 43 43 43 43 23 27 27 43 43 52 52 43 57 43 52 43 43 43 57 57 57 57 57 57 57 43 39 39 43 43 33 33 23 23 24 26 12 12 12 26 32 38 35 35 38 43 35 35 35 42 50 57 59 59 35 32 24 17 15 12 24 13 17 38 32 37 57 52 52 57 50 52 38 38 20 38 32 47 43 42 33 44 38 50 39 39 39 43 50 47 59 44 42 42 28 28 14 14 14 18 32 37 43 43 41 41 41 44 36 42 21 27 24 24 25 36 31 32 22 27 17 18 19 31 36 29 25 25 26 29 31 43 57 48 54 46 46 43 23 23 10 10 10 10 12 22 25 14 14 14 24 21 28 28 32 30 25 16 14 18 19 22 21 19 18 19 19 15 13 16 19 19 14 12 11 11 18 17 34 34 43 43 37 31 31 25 22 16 11 12 12 9 15 15 32 23 24 14 14 15 16 9 11 11 15 26 34 57 57 54 42 42 32 30 28 23 15 14 14 14 18 18 13 13 8 8 8 10 8 11 18 30 15 15 11 11 11 13 13 14 14 19 13 14 14 21 12 12 11 11 12 18 11 11 11 21 23 15 13 10 9 9 9 12 17 13 13 15 13 11 11 11 11 15 12 12 15 12 12 11 11 12 12 11 11 11 12 12 10 9 10 8 8 10 8 8 9 9 15 12 12 11 11 12 18 18 9 9 9 23 12 13 11 23 17 23 19 13 15 12 12 11 17 17 15 10 8 7 6 10 8 8 8 10 12 21 16 12 11 10 9 9 10 17 11 11 11 11 11 11 11 12 16 17 13 10 10 10 10 9 12 14 12 10 9 10 10 10 10 17 19 15 15 8 8 8 9 9 9 9 10 10 14 10 10 9 9 8 10 8 8 8 8 8 8 9 9 9 10 9 10 12 9 9 10 10 10 15 17 17 18 11 11 11 12 11 11 11 11 11 11 11 11 11 11 11 11 15 12 12 12 18 19 13 13 11 13 13 8 8 6 6 8 8 8 8 8 10 11 11 15 13 13 8 8 8 8 8 8 8 14 13 16 16 11 11 10 10 8 8 8 12 13 10 10 10 13 13 11 12 12 22 15 16 13 10 10 10 8 8 8 6 6 8 8 8 8 8 8 8 13 7 6 8 8 8 8 8 8 9 10 10 16 15 10 10 8 8 8 8 8 8 8 8 8 13 10 8 8 8 10 10 10 11 11 12 15 21 8 8 6 6 8 8 8 8 9 9 8 8 8 9 10 8 9 9 8 10 8 8 6 8 6 6 8 6 6 8 8 9 8 8 8 8 8 8 8 13 12 12 10 8 8 8 8 12 10 14 14 18 16 15 10 10 10 10 12 10 10 10 10 10 8 10 8 8 8 10 10 10 10 11 9 9 9 8 8 8 10 10 10 13 13 13 14 12 8 8 8 8 8 8 8 8 8 8 8 10 11 10 9 9 6 6 7 7 10 10 6 9 12 12 13 9 9 10 11 11 11 10 10 10 12 15 16 14 8 8 8 8 8 8 8 8 8 8 8 12 12 11 11 11 11 15 10 10 10 10 10 9 8 6 6 6 6 10 10 10 8 8 8 6 6 8 11 8 8 8 8 8 8 8 12 12 10 10 9 9 10 8 7 6 8 6 6 8 8 8 10 11 13 8 8 8 8 8 8 8 8 6 6 8 8 10 10 13 19 13 12 8 8 8 11 11 9 9 10 10 14 15 15 8 8 8 8 8 10 8 8 6 6 8 8 10 10 8 12 8 8 6 8 6 6 6 6 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 6 7 8 8 10 8 9 10 10 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 10 10 9 9 9 7 10 15 11 9 9 8 8 8 6 6 8 12 8 8 10 6 6 8 10 11 8 10 9 8 8 8 8 8 8 8 8 8 6 6 6 6 6 3 0 3 7 7 7 6 6 7 8 8 9 6 6 8 8 8 8 8 12 15 19 19 24 13 9 9 6 8 6 6 8 6 9 7 10 8 8 8 15 10 14 16 22 15 11 7 6 6 6 8 11 13 6 6 6 6 8 8 8 8 7 7 7 6 6 6 6 7 8 8 9 9 13 11 10 9 9 12 8 8 8 8 8 6 8 6 6 8 8 6 6 8 8 8 8 10 6 6 8 8 8 8 10 10 10 10 10 9 9 9 9 9 14 14 12 10 8 6 6 8 8 8 6 6 8 8 9 9 10 9 11 15 10 9 9 6 8 6 6 8 8 8 6 6 6 10 10 10 12 8 8 6 7 10 10 8 8 8 8 9 8 8 7 7 8 10 9 9 9 9 8 7 7 6 7 8 8 8 8 6 6 8 8 8 8 8 8 8 6 7 8 10 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no085_d12.g1 MSMg01no085_d12.g1 CHROMAT_FILE:
MSMg01no085_d12.g1 PHD_FILE: MSMg01no085_d12.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:35:41 2005
         (265 letters)



>mm_chr19_56303184_56303848
          Length = 665

 Score =  466 bits (241), Expect = e-136
 Identities = 259/265 (97%)
 Strand = Plus / Minus

                                                                       
Query: 1   ggaaagttggggttcaaatttcagcgacgtggcttctttgtgatccgtttttcattgctt 60
           ||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 465 ggaaagttggggttcaaatttcagcgatgtggcttctttgtgatacgtttttcattgctt 406

                                                                       
Query: 61  tgtaaggatgtagctgcatttgaattgccatgttcctgggagttaactgtgataaaaatc 120
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 405 tgtaaggatgtagctacatttgaattgccatgttcctgggagttaactgtgataaaaatc 346

                                                                       
Query: 121 cctgtttcaccacacggggctgggaaaagagtaactttttcagttggtctgtgccctctc 180
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 345 cctgtttcaccacatggggctgggaaaagagtaactttttcagttggtctgtgccctctc 286

                                                                       
Query: 181 agaggtgaatagctgcttcccacacctccccaaggcaagcaataagtgttacagttttta 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 285 agaggtgaatagctgcttcccacacctccccaaggcaagcaataagtgttacagttttta 226

                                    
Query: 241 cctgctacgcctgtgagcagataga 265
           ||||||| | |||||||||||||||
Sbjct: 225 cctgctatggctgtgagcagataga 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 12
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 265
Length of database: 665
Length adjustment: 9
Effective length of query: 256
Effective length of database: 656
Effective search space:   167936
Effective search space used:   167936
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information