MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-357J14
Chromosome	19 (Build37)
Map Location	39,865,587 - 39,865,993
singlet/doublet	singlet
Overlap gene	Cyp2c40
Upstream gene	Noc3l, Tbc1d12, Hells, LOC209753, Cyp2c55, LOC100042507, Cyp2c65, LOC668278, Cyp2c66, Cyp2c29, Cyp2c38, Cyp2c39, C730004C24Rik, 9030012A22Rik
Downstream gene	LOC100043108, LOC100042523, Cyp2c37, Cyp2c54, Cyp2c50, Cyp2c70, LOC545289, LOC676923, Pdlim1, LOC435599, Sorbs1, A930028N01Rik, Aldh18a1, LOC100043135, 4930521E07Rik, EG667723, Entpd1, EG667720, EG668310
Link	Open Mouse BAC browser

Click to get alignment info.

name	Noc3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57753 MGI:1932610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209478 MGI:2384803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hells (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15201 MGI:106209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC209753 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:209753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Cyp2c55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72082 MGI:1919332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Cyp2c65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72303 MGI:1919553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cyp2c66 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69888 MGI:1917138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13095 MGI:103238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13097 MGI:1306819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13098 MGI:1306818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C730004C24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545288 MGI:3612288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030012A22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433247 MGI:3612287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13099 MGI:1306815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043108 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 114 ESTs, 61 Proteins

name	LOC100042523 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Cyp2c37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13096 MGI:1306806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404195 MGI:3642960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107141 MGI:2147497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2c70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:226105 MGI:2385878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 82 ESTs, 28 Proteins pseudo : _no_value

name	LOC676923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 451 ESTs, 25 Proteins

name	Pdlim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54132 MGI:1860611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435599 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Sorbs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	A930028N01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78438 MGI:1925688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Aldh18a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56454 MGI:1888908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 402 ESTs, 9 Proteins

name	4930521E07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67590 MGI:1914840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667723 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667723 MGI:3646027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 390 ESTs, 12 Proteins

name	Entpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12495 MGI:102805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667720 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667720 MGI:3646024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG668310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668310 MGI:3645359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	Noc3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956107 GeneID:57753 MGI:1932610
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar complex associated 3 homolog (S. cerevisiae) transcript_id : NM_021315.1

name	Tbc1d12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119943132 GeneID:209478 MGI:2384803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1D12: TBC1 domain family, member 12 transcript_id : NM_145952.3

name	Hells (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299599 GeneID:15201 MGI:106209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : helicase, lymphoid specific transcript_id : NM_008234.3

name	Cyp2c55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803086 GeneID:72082 MGI:1919332
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 55 transcript_id : NM_028089.2

name	LOC100042507 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270461 GeneID:100042507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 transcript_id : XM_001478337.1

name	Cyp2c65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58696419 GeneID:72303 MGI:1919553
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 65 transcript_id : NM_028191.1

name	Cyp2c66 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58743309 GeneID:69888 MGI:1917138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 66 transcript_id : NM_001011707.1

name	Cyp2c29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116268124 GeneID:13095 MGI:103238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 29 transcript_id : NM_007815.3

name	Cyp2c38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368995 GeneID:13097 MGI:1306819
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 38 transcript_id : NM_010002.2

name	Cyp2c39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857776 GeneID:13098 MGI:1306818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 39 transcript_id : NM_010003.1

name	C730004C24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131197 GeneID:545288 MGI:3612288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730004C24 gene transcript_id : NM_001024719.2

name	9030012A22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88319957 GeneID:433247 MGI:3612287
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030012A22 gene transcript_id : NM_001039555.1

name	Cyp2c40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857778 GeneID:13099 MGI:1306815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 40 transcript_id : NM_010004.1

name	LOC100043108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270538 GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 9 Proteins product : similar to RIKEN cDNA C730004C24 gene, transcript variant 3 transcript_id : XM_001479736.1

name	LOC100043108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270534 GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 114 ESTs, 56 Proteins product : similar to RIKEN cDNA C730004C24 gene, transcript variant 1 transcript_id : XM_001479730.1

name	LOC100043108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270536 GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 106 ESTs, 8 Proteins product : similar to RIKEN cDNA C730004C24 gene, transcript variant 2 transcript_id : XM_001479732.1

name	LOC100043108 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270540 GeneID:100043108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 72 ESTs, 3 Proteins product : similar to RIKEN cDNA C730004C24 gene, transcript variant 4 transcript_id : XM_001479745.1

name	LOC100042523 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270464 GeneID:100042523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001478375.1

name	Cyp2c37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753579 GeneID:13096 MGI:1306806
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2. subfamily c, polypeptide 37 transcript_id : NM_010001.1

name	Cyp2c54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45504401 GeneID:404195 MGI:3642960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 54 transcript_id : NM_206537.1

name	Cyp2c50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527381 GeneID:107141 MGI:2147497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 50 transcript_id : NM_134144.1

name	Cyp2c70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703981 GeneID:226105 MGI:2385878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily c, polypeptide 70 transcript_id : NM_145499.1

name	LOC676923 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270468 GeneID:676923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 451 ESTs, 25 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript_id : XM_001478412.1

name	Pdlim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802544 GeneID:54132 MGI:1860611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ and LIM domain 1 (elfin) transcript_id : NM_016861.2

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130498 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_009166.3

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000172 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_178362.1

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000176 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_001034963.1

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000178 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_001034962.1

name	Sorbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000153 GeneID:20411 MGI:700014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbin and SH3 domain containing 1 transcript_id : NM_001034964.1

name	A930028N01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270546 GeneID:78438 MGI:1925688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA A930028N01 gene transcript_id : XM_001479809.1

name	Aldh18a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24025658 GeneID:56454 MGI:1888908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 18 family, member A1 transcript_id : NM_153554.1

name	Aldh18a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790060 GeneID:56454 MGI:1888908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 18 family, member A1 transcript_id : NM_019698.1

name	LOC100043135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270548 GeneID:100043135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 402 ESTs, 9 Proteins product : similar to tyrosine phosphatase transcript_id : XM_001479813.1

name	4930521E07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541974 GeneID:67590 MGI:1914840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930521E07 gene transcript_id : NM_026260.2

name	EG667723 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405920 GeneID:667723 MGI:3646027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 390 ESTs, 10 Proteins product : predicted gene, EG667723 transcript_id : XM_001001948.1

name	Entpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665730 GeneID:12495 MGI:102805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 1 transcript_id : NM_009848.3

name	EG667720 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94405916 GeneID:667720 MGI:3646024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG667720 transcript_id : XM_001001937.1

name	EG668310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406003 GeneID:668310 MGI:3645359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG668310 transcript_id : XM_001000795.1

name	Noc3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956108 GeneID:57753 MGI:1932610
definition	GO_component : GO:0016607 - nuclear speck [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0045444 - fat cell differentiation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : nucleolar complex associated 3 homolog protein_id : NP_067290.1

name	Tbc1d12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119943133 GeneID:209478 MGI:2384803
definition	codon_start : 1 product : TBC1D12: TBC1 domain family, member 12 protein_id : NP_666064.3

name	Hells (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12232371 CCDS:CCDS29789.1 GeneID:15201 MGI:106209
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0004386 - helicase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0006342 - chromatin silencing [Evidence IMP]; GO:0006306 - DNA methylation [Evidence IMP]; GO:0030098 - lymphocyte differentiation [Evidence TAS]; GO:0001655 - urogenital system development [Evidence IMP] codon_start : 1 note : proliferation-associated SNF2-like product : helicase, lymphoid specific protein_id : NP_032260.2

name	Cyp2c55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386282 CCDS:CCDS29790.1 GeneID:72082 MGI:1919332
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] codon_start : 1 note : cytochrome P450, 2c55 product : cytochrome P450, family 2, subfamily c, polypeptide 55 protein_id : NP_082365.1

name	LOC100042507 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270462 GeneID:100042507
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478387.1

name	Cyp2c65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58696420 CCDS:CCDS29791.1 GeneID:72303 MGI:1919553
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2c65 product : cytochrome P450, family 2, subfamily c, polypeptide 65 protein_id : NP_082467.1

name	Cyp2c66 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58743310 CCDS:CCDS29792.1 GeneID:69888 MGI:1917138
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2c66 product : cytochrome P450, family 2, subfamily c, polypeptide 66 protein_id : NP_001011707.1

name	Cyp2c29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116268125 CCDS:CCDS29793.1 GeneID:13095 MGI:103238
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2c29 product : cytochrome P450, family 2, subfamily c, polypeptide 29 protein_id : NP_031841.3

name	Cyp2c38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789012 CCDS:CCDS29794.1 GeneID:13097 MGI:1306819
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2c38 product : cytochrome P450, family 2, subfamily c, polypeptide 38 protein_id : NP_034132.1

name	Cyp2c39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857777 CCDS:CCDS29795.1 GeneID:13098 MGI:1306818
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : drug metabolizing enzyme; metabolizes arachidonic acid note : cytochrome P450, 2c39 product : cytochrome P450, family 2, subfamily c, polypeptide 39 protein_id : NP_034133.1

name	C730004C24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67010061 CCDS:CCDS29796.1 GeneID:545288 MGI:3612288
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC545288 protein_id : NP_001019890.1

name	9030012A22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88319958 CCDS:CCDS29797.1 GeneID:433247 MGI:3612287
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cytochrome P450 2C40 family protein_id : NP_001034644.1

name	Cyp2c40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857779 CCDS:CCDS29798.1 GeneID:13099 MGI:1306815
definition	EC_number : 1.14.14.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : drug metabolizing enzyme; metabolizes arachidonic acid note : cytochrome P450, 2c40 product : cytochrome P450, family 2, subfamily c, polypeptide 40 protein_id : NP_034134.1

name	LOC100043108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270541 GeneID:100043108
definition	codon_start : 1 product : similar to RIKEN cDNA C730004C24 gene isoform 4 protein_id : XP_001479795.1

name	LOC100043108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270539 GeneID:100043108
definition	codon_start : 1 product : similar to RIKEN cDNA C730004C24 gene isoform 3 protein_id : XP_001479786.1

name	LOC100043108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270535 GeneID:100043108
definition	codon_start : 1 product : similar to RIKEN cDNA C730004C24 gene isoform 1 protein_id : XP_001479780.1

name	LOC100043108 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270537 GeneID:100043108
definition	codon_start : 1 product : similar to RIKEN cDNA C730004C24 gene isoform 2 protein_id : XP_001479782.1

name	LOC100042523 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270465 GeneID:100042523
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001478425.1

name	Cyp2c37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753580 CCDS:CCDS29799.1 GeneID:13096 MGI:1306806
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : metabolizes arachidonic acid note : cytochrome P450, 2c37 product : cytochrome P450, family 2. subfamily c, polypeptide 37 protein_id : NP_034131.1

name	Cyp2c54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45504402 CCDS:CCDS29800.1 GeneID:404195 MGI:3642960
definition	codon_start : 1 function : metabolizes arachidonic acid note : ytochrome P450, family 2, subfamily c, polypeptide 54 product : cytochrome P450 protein_id : NP_996260.1

name	Cyp2c50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527382 CCDS:CCDS29801.1 GeneID:107141 MGI:2147497
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2c50 product : cytochrome P450, family 2, subfamily c, polypeptide 50 protein_id : NP_598905.1

name	Cyp2c70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703982 GeneID:226105 MGI:2385878
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence ISS] [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450 2C70 product : cytochrome P450, family 2, subfamily c, polypeptide 70 protein_id : NP_663474.1

name	LOC676923 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270469 GeneID:676923
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_001478462.1

name	Pdlim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393150 GeneID:54132 MGI:1860611
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy product : carboxyl terminal LIM domain protein 1 protein_id : NP_058557.1

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000177 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 4 protein_id : NP_001030135.1

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000175 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 1 protein_id : NP_033192.2

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000154 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 5 protein_id : NP_001030136.1

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000173 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 2 protein_id : NP_848139.1

name	Sorbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78000179 GeneID:20411 MGI:700014
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005924 - cell-substrate adherens junction [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005158 - insulin receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] GO_process : GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0043149 - stress fiber formation [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; ponsin; SH3 domain protein 5; c-Cbl-associated protein product : sorbin and SH3 domain containing 1 isoform 3 protein_id : NP_001030134.1

name	A930028N01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270547 GeneID:78438 MGI:1925688
definition	codon_start : 1 product : hypothetical protein LOC78438 protein_id : XP_001479859.1

name	Aldh18a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24025659 GeneID:56454 MGI:1888908
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004349 - glutamate 5-kinase activity [Evidence IGI] [Evidence IDA]; GO:0004350 - glutamate-5-semialdehyde dehydrogenase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence TAS]; GO:0006561 - proline biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : catalyzes NADPH-, ATP-dependent conversion of L-glutamate to P5C note : isoform 2 is encoded by transcript variant 2; glutamate gamma-semialdehyde synthetase; pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) product : pyrroline-5-carboxylate synthetase isoform 2 protein_id : NP_705782.1

name	Aldh18a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790061 CCDS:CCDS29803.1 GeneID:56454 MGI:1888908
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004349 - glutamate 5-kinase activity [Evidence IGI] [Evidence IDA]; GO:0004350 - glutamate-5-semialdehyde dehydrogenase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence TAS]; GO:0006561 - proline biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : catalyzes NADPH-, ATP-dependent conversion of L-glutamate to P5C note : isoform 1 is encoded by transcript variant 1; glutamate gamma-semialdehyde synthetase; pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) product : pyrroline-5-carboxylate synthetase isoform 1 protein_id : NP_062672.1

name	LOC100043135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270549 GeneID:100043135
definition	codon_start : 1 product : similar to tyrosine phosphatase protein_id : XP_001479863.1

name	4930521E07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541975 CCDS:CCDS29804.1 GeneID:67590 MGI:1914840
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : tectonic 3 protein_id : NP_080536.2

name	EG667723 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405921 GeneID:667723 MGI:3646027
definition	codon_start : 1 product : similar to protein tyrosine phosphatase type IVA, member 1 protein_id : XP_001001948.1

name	Entpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753346 GeneID:12495 MGI:102805
definition	GO_component : GO:0005605 - basal lamina [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA] GO_process : GO:0006200 - ATP catabolism [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0030168 - platelet activation [Evidence IDA]; GO:0009181 - purine ribonucleoside diphosphate catabolism [Evidence IDA] codon_start : 1 note : CD39 antigen; ectoapyrase product : ectonucleoside triphosphate diphosphohydrolase 1 protein_id : NP_033978.1

name	EG667720 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94405917 GeneID:667720 MGI:3646024
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001937.1

name	EG668310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406004 GeneID:668310 MGI:3645359
definition	codon_start : 1 product : similar to RIKEN cDNA 5730509K17 gene protein_id : XP_001000795.1

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 1 pseudo : _no_value

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 2 pseudo : _no_value

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 3 pseudo : _no_value

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 4 pseudo : _no_value

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 5 pseudo : _no_value

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 6 pseudo : _no_value

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 7 pseudo : _no_value

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 8 pseudo : _no_value

name	LOC209753 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:209753
definition	number : 9 pseudo : _no_value

name	LOC668278 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668278
definition	number : 1 pseudo : _no_value

name	LOC435599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435599
definition	number : 1 pseudo : _no_value

name	LOC545289 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270467 GeneID:545289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 82 ESTs, 28 Proteins product : similar to Rev-Erb-beta pseudo : _no_value transcript_id : XR_033677.1

clone name	MSMg01-501L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-357L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-455M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-324P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-379H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-379H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459P14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-428C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-210L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-503F20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386E09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-363E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-357J14.T7 (MSMg01no357_j14.b1)	MSMg01-357J14.TJ (MSMg01no357_j14.g1)
ACC	AG467459	AG467460
length	756	766
length of high quality (start - end)	508 (42 - 549)	471 (71 - 541)
definition	CHROMAT_FILE: MSMg01no357_j14.b1 PHD_FILE: MSMg01no357_j14.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:51:38 2005	CHROMAT_FILE: MSMg01no357_j14.g1 PHD_FILE: MSMg01no357_j14.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:51:38 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATT CTTTGTTTAGCTCTGTAGCCCCATTTTTAATGGGGTTATTTGATTTTCTG GAGTCCAGGTTCTTGAGTTCTTTGTATATATTGATTATTAGTCCCTTATA AGATTTAGGATTGGTAAAGATCCTTTCCCAATCTCTTGGTGACCTTTTTG TTTTATTGACAGTGTCTTTTGCCTTAAAGAAGCTTTGCAATTTTATGAGA TCCCATTTGTCGATTCTAGATCTTAACGCATAAGCCATTGCTGTTCTGTT CAGGAATTTTTCCCCTGTGGCCATGTCTTCAAGGCTTTCCCCCACTTTCT CCTCTATAAGTTTCAGAGTCTCTGGTTTTATGTGGAGTTCCTTAATCCAC TTAGACTTGAGCTTTGTACAAGGAGATAAGAATGGATCAATACACATTCT TCTACATGATAACTGCCAGTTGTGCCAGCACCATTTGTTGAAAATGCTGT GTTTTTCCACTTGATGGTTTTAGCTCCCTTGTCAAAGATCAAGTGACCAT AGGTGTGTGGGTTCATTTCTGGGTCTTCAGTTATATTCCATTGATCTTAC TCTCTGTCATTGTACCATTACCATGCCTATTTTAATCCCCATTGTTCTGC AACACTGTTTGATGTCCCCCTTGGGCGATTCCACTAAAATTCTTTCATTG GGTATATAAGTCTTTCGCCACCTTACCTTCCTTTTTTTCTTTCCATATAT TTCCAN	TGATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXCTGGGAAGTCTTGAGCCTCTGATTTCTTCA GAGGAGCAGGCAAGCTGAGAGTCTGCTCCTGCAGAAGGTTCAGGCAAGAA GGGGAGTGGAATTCGGAGGACCAGGGGTATGAGGAGTGATGAGTCCCAAG TCCACTATACCTCATCAAGATTACCATCTGCTGCAGTTGTTTGGGACCGT CCCTTATTGGCTGCCCTGTGTGCAGTAGAACTCCTGGGACGTCTTCAGAA ATGGCATTTTCAGAAAAACAGACAAGCTGGTAATCTTTAGAGATTACCCT TAATCTGCCAACTTCCTTCTGTACTATCTTTTTCTGATACAACAAACTTC ATTTTACAAGCATGGAAACTACAATGCACTTATATATGATTCATATATCT TTGAATTTTTTCTACCTTAGAGCTCTCCTAGCTTTTTACCTATGAATATC TGTGCAGACATTACTTGATGGTATGTTTTTCTTTTCTGTGTACCCCTCTC TAATAATGAGCTTTCTCCTTTCCCTGTAATTTCTATTTGCTATTGTGAAA AAATTAAAGGGTTCCCAAAATAGGGTTTTTTTAATAACAATAAAATCCTT TACTTTTTTTTTTCAAATTCTATACCACTGGGAAGGGGCGTTTTTTTTAC CTTTAACCTTGCTCAGATTGGTAATCAACCCATATTATTTTTTTCTCAAA CTCGTTATTTCCCTTC
quality values	Open. Hide. 37 37 37 37 44 39 23 23 11 11 8 10 16 31 32 36 33 34 25 25 25 26 19 17 17 16 19 25 11 10 10 10 11 25 34 59 33 29 28 28 28 35 41 57 57 36 36 37 37 50 50 59 59 59 57 44 34 32 22 22 31 37 59 59 48 59 59 68 68 54 54 68 68 68 68 68 68 54 50 47 47 47 48 57 68 68 68 57 57 68 68 68 68 68 68 68 57 57 57 57 57 57 59 50 50 50 50 50 50 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 50 50 50 51 57 68 68 68 68 68 68 68 68 68 68 68 68 57 57 50 50 50 50 57 57 59 57 57 57 57 57 57 57 57 57 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 59 57 68 68 68 68 68 68 59 57 57 52 52 59 57 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 59 59 59 59 57 57 57 59 59 57 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 57 57 57 59 57 57 57 57 52 57 59 68 68 59 59 59 59 59 59 59 57 57 57 57 57 68 57 57 57 59 57 57 57 57 57 57 57 57 57 57 57 57 59 59 57 57 59 59 59 59 57 48 48 48 48 57 57 57 50 50 50 57 57 57 57 42 43 42 47 47 47 59 59 68 68 68 68 57 57 57 57 59 59 59 59 57 57 57 46 43 48 43 57 47 59 59 57 48 48 48 57 43 43 43 43 43 44 44 48 43 43 40 40 40 59 59 59 48 47 47 47 41 41 39 39 34 36 41 41 41 41 28 28 13 13 13 26 26 47 43 39 31 28 32 36 37 39 40 40 32 29 28 28 28 31 37 37 37 36 43 41 37 31 24 21 11 11 11 16 16 27 27 22 28 23 34 34 48 30 30 22 22 22 23 23 18 16 12 19 13 22 22 24 20 22 31 39 39 30 28 25 25 18 28 19 23 22 21 18 13 10 11 9 11 9 11 16 26 22 33 37 20 20 17 15 15 10 10 10 16 12 9 9 9 10 10 11 11 11 15 10 10 11 13 13 13 18 17 19 17 12 10 8 8 8 8 8 8 9 9 9 9 9 9 10 13 16 12 10 10 10 12 8 8 8 8 8 17 15 16 14 17 8 8 6 6 6 6 6 6 8 9 8 12 10 8 8 6 6 6 6 6 8 8 10 9 8 8 8 8 8 8 8 8 8 10 6 6 6 8 9 11 11 12 11 9 9 8 8 6 6 6 6 8 6 10 11 11 10 10 8 8 8 8 8 8 8 10 11 9 8 6 6 8 10 10 12 8 9 9 10 10 8 8 8 8 12 14 12 9 9 10 10 10 13 15 11 9 9 8 8 8 8 10 8 8 10 10 11 3 0	Open. Hide. 8 8 8 8 8 7 7 9 8 14 15 20 20 37 31 37 37 37 37 37 39 39 39 39 59 25 27 11 13 13 16 13 19 21 11 11 11 18 21 37 39 39 17 21 10 10 10 21 21 50 42 41 37 25 23 9 9 10 10 19 22 43 50 50 31 31 35 35 36 36 57 57 48 57 57 53 53 53 47 47 48 48 48 48 48 68 57 59 59 50 50 53 53 68 68 68 51 51 48 48 48 50 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 47 57 57 57 57 57 57 57 46 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 52 52 54 50 50 50 51 51 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 62 62 62 62 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 57 57 59 68 68 59 59 59 48 48 57 59 59 57 57 57 57 57 57 54 54 54 57 59 68 57 57 57 57 57 46 46 42 42 43 43 43 47 59 59 68 68 68 68 59 59 59 57 57 57 48 48 48 59 59 59 59 59 59 57 57 57 54 54 57 57 57 59 59 57 57 57 48 42 42 34 32 22 22 23 32 32 40 47 47 48 47 47 43 46 46 59 59 30 30 25 25 23 24 39 43 43 41 37 32 41 41 39 32 32 20 15 15 18 18 30 17 19 20 27 29 30 37 39 37 37 36 23 15 10 10 10 18 9 11 11 20 25 33 32 28 31 34 39 22 19 11 11 11 17 17 17 11 10 10 12 15 19 16 14 14 14 13 13 19 24 15 15 10 15 16 19 11 17 15 10 10 10 10 10 12 12 12 14 10 10 8 8 8 9 11 13 13 14 11 11 8 8 8 8 10 9 13 9 10 10 13 15 30 30 17 16 12 12 11 11 11 11 12 12 10 10 8 8 8 10 12 10 6 6 8 8 8 8 8 10 9 9 17 8 8 8 8 8 6 6 8 8 6 6 8 8 9 14 9 8 8 9 10 13 23 18 15 15 20 21 18 18 19 18 10 8 8 8 8 8 8 8 8 8 8 8 9 9 9 9 8 8 8 8 6 6 6 6 8 10 9 9 8 8 16 22 22 28 22 22 10 8 8 8 8 8 8 8 8 8 11 10 8 8 8 8 6 6 7 6 8 8 10 8 10 10 10 10 12 12 12 12 8 8 8 6 6 6 6 6 6 11 15 15 8 8 8 8 8 8 10 10 10 8 6 6 6 8 8 8 10 8 8 8 10 10 10 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no357_j14.g1 MSMg01no357_j14.g1 CHROMAT_FILE:
MSMg01no357_j14.g1 PHD_FILE: MSMg01no357_j14.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:51:38 2005
         (471 letters)



>mm_chr19_39865121_39865993
          Length = 873

 Score =  456 bits (236), Expect = e-132
 Identities = 368/420 (87%), Gaps = 19/420 (4%)
 Strand = Plus / Minus

                                                                       
Query: 58  cctgcagaaggttcaggcaagaaggggagtggaattcggaggaccaggggtatgaggagt 117
           |||| |||||||||||||  ||||||||||||||          ||||||| ||||||||
Sbjct: 873 cctgtagaaggttcaggcttgaaggggagtggaa----------caggggtgtgaggagt 824

                                                                       
Query: 118 gatgagtcccaagtccactatacctcatcaagattaccatctgctgcagttgtttgggac 177
           ||||||||||||||||||| ||||||||||||||| ||||||||||||| | ||||||||
Sbjct: 823 gatgagtcccaagtccactgtacctcatcaagatttccatctgctgcagctatttgggac 764

                                                                       
Query: 178 cgtcccttattggctgccctgtgtgcagtagaactcctgggacgtcttcaga--aatg-g 234
           | |||| ||||||||||||||||||||||||||||||||||| | || || |  || | |
Sbjct: 763 catcccctattggctgccctgtgtgcagtagaactcctgggaggcctgcaaactaaggtg 704

                                                                       
Query: 235 cattttcagaaaaacagacaagctggtaatctttagagattacccttaatctgccaactt 294
           ||  ||||||  | ||||||||||||||||||||||||||||||||| | ||||||||||
Sbjct: 703 ca--ttcagaggagcagacaagctggtaatctttagagattacccttcacctgccaactt 646

                                                                       
Query: 295 ccttctgtactatc--tttttctgatacaacaaacttcattttacaagcatggaaactac 352
           | ||||||||||||  ||||| ||||||||||||||||| |||||||||||||||| |||
Sbjct: 645 ctttctgtactatctttttttttgatacaacaaacttcagtttacaagcatggaaagtac 586

                                                                       
Query: 353 aatgcacttatatatgattcatatatctttgaattttttctaccttagagctctcctagc 412
           |||||||||  |||| ||||||||||| ||| ||| ||||||||||||||||||| ||| 
Sbjct: 585 aatgcacttgcatatcattcatatatccttgcattatttctaccttagagctctcttag- 527

                                                                       
Query: 413 tt-tttacctatgaatatctgtgcagacattacttgatggtatgtttttcttttctgtgt 471
           || |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 526 ttatttacctatttatatctgtgcagacattacttgatggtatgtttttcttttctgtgt 467


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 13
Number of extensions: 4
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 471
Length of database: 873
Length adjustment: 10
Effective length of query: 461
Effective length of database: 863
Effective search space:   397843
Effective search space used:   397843
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information