MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-093A23
Chromosome	2 (Build37)
Map Location	89,633,113 - 89,634,185
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Olfr1201, Olfr1202, Olfr1203, Olfr1204, Olfr1206, Olfr1208, Olfr1209, Olfr1211, Olfr1212, Olfr1213, Olfr1214, Olfr1215, Olfr1216, Olfr1217, Olfr1218, Olfr1219, Olfr1220, Olfr1221, Olfr1222, Olfr1223, Olfr1224-ps1, Olfr1225, LOC435676, Olfr1226, LOC100042983, GA_x5J8B7TTH1T-1160-261, Olfr1227-ps1, Olfr1228, Olfr1229, Olfr1230, Olfr1231, Olfr1232, Olfr1233, Olfr1234, Olfr1235-ps1, GA_x5J8B7W62NC-668773-668438, Olfr1237-ps1, Olfr1238, Olfr1239, Olfr1240, Olfr1241, Olfr1242, Olfr1243, Olfr1244-ps1, Olfr1245, Olfr1246, Olfr1247, Olfr1248, Olfr1249, Olfr1541-ps1, Olfr1250, Olfr1251, GA_x5J8B7TT7VM-20-924, Olfr1252, GA_x5J8B7W62NC-992588-991951, Olfr1253-ps1, Olfr1254
Downstream gene	Olfr1255, Olfr1256, Olfr48, Olfr1257, Olfr1258, Olfr1259, Olfr1260, Olfr1261, Olfr1262, Olfr1263, Olfr1264, Olfr1265, Olfr140, Olfr1266-ps1, Olfr1267-ps1, Olfr1268-ps1, Olfr1269, Olfr32, LOC100043090, Olfr1270, LOC627525, LOC100043096, Olfr1506, Olfr142, Olfr1271, Olfr1272, Olfr1273, LOC100042690, LOC100043113, LOC668629, GA_x5J8B7W2BV0-3116-4045, Ptprj, 4933423P22Rik, Nup160, Fnbp4, Rpl30-ps3, Agbl2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr1201 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258897 MGI:3031035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1202 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258454 MGI:3031036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258898 MGI:3031037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1204 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258455 MGI:3031038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1206 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258896 MGI:3031040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1208 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258774 MGI:3031042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1209 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258453 MGI:3031043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1211 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258025 MGI:3031045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1212 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258241 MGI:3031046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258900 MGI:3031047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258899 MGI:3031048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1215 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258451 MGI:3031049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258895 MGI:3031050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1217 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258903 MGI:3031051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1218 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258815 MGI:3031052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258901 MGI:3031053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1220 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258902 MGI:3031054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1221 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258904 MGI:3031055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1222 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258177 MGI:3031056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258894 MGI:3031057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1224-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258026 MGI:3031058
definition	gene_synonym : MOR233-15 note : olfactory receptor 1224, pseudogene 1 pseudo : _no_value

name	Olfr1225 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258893 MGI:3031059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	Olfr1226 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258969 MGI:3031060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	GA_x5J8B7TTH1T-1160-261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257863
definition	note : olfactory receptor GA_x5J8B7TTH1T-1160-261 pseudo : _no_value

name	Olfr1227-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404489 MGI:3031061
definition	note : olfactory receptor 1227, pseudogene 1 pseudo : _no_value

name	Olfr1228 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258973 MGI:3031062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1229 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257921 MGI:3031063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1230 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258785 MGI:3031064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1231 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258446 MGI:3031065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1232 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258320 MGI:3031066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1233 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258974 MGI:3031067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1234 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258975 MGI:3031068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1235-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404490 MGI:3031069
definition	note : olfactory receptor 1235, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W62NC-668773-668438 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257785
definition	note : olfactory receptor GA_x5J8B7W62NC-668773-668438 pseudo : _no_value

name	Olfr1237-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404492 MGI:3031071
definition	note : olfactory receptor 1237, pseudogene 1 pseudo : _no_value

name	Olfr1238 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258786 MGI:3031072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1239 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258972 MGI:3031073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1240 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258804 MGI:3031074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1241 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258447 MGI:3031075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1242 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258970 MGI:3031076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1243 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258971 MGI:3031077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1244-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404493 MGI:3031078
definition	note : olfactory receptor 1244, pseudogene 1 pseudo : _no_value

name	Olfr1245 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258784 MGI:3031079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1246 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258788 MGI:3031080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1247 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258968 MGI:3031081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258787 MGI:3031082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1249 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257984 MGI:3031083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1541-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258024 MGI:3031375
definition	gene_synonym : MOR231-16P note : olfactory receptor 1541, pseudogene 1 pseudo : _no_value

name	Olfr1250 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258967 MGI:3031084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1251 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259145 MGI:3031085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TT7VM-20-924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257743
definition	note : olfactory receptor GA_x5J8B7TT7VM-20-924 pseudo : _no_value

name	Olfr1252 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404331 MGI:3031086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W62NC-992588-991951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257782
definition	note : olfactory receptor GA_x5J8B7W62NC-992588-991951 pseudo : _no_value

name	Olfr1253-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258370 MGI:3031087
definition	gene_synonym : MOR231-18 note : olfactory receptor 1253, pseudogene 1 pseudo : _no_value

name	Olfr1254 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258468 MGI:3031088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1255 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258979 MGI:3031089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1256 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258985 MGI:3031090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18347 MGI:1333765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1257 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258984 MGI:3031091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1258 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258980 MGI:3031092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258338 MGI:3031093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258983 MGI:3031094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1261 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258466 MGI:3031095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1262 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258976 MGI:3031096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258790 MGI:3031097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1264 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258206 MGI:3031098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258340 MGI:3031099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57272 MGI:2177523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1266-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404494 MGI:3031100
definition	note : olfactory receptor 1266, pseudogene 1 pseudo : _no_value

name	Olfr1267-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258204 MGI:3031101
definition	gene_synonym : MOR228-1 note : olfactory receptor 1267, pseudogene 1 pseudo : _no_value

name	Olfr1268-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258981 MGI:3031102
definition	gene_synonym : MOR229-1 note : olfactory receptor 1268, pseudogene 1 pseudo : _no_value

name	Olfr1269 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258339 MGI:3031103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18331 MGI:109303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043090 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins

name	Olfr1270 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258987 MGI:3031104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 3 Proteins

name	LOC100043096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Olfr1506 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257665 MGI:3031340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr142 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406186 MGI:2177525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1271 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258789 MGI:3031105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1272 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258982 MGI:3031106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1273 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258977 MGI:3031107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042690 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2357 Proteins

name	LOC100043113 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC668629 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 3 Proteins

name	GA_x5J8B7W2BV0-3116-4045 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ptprj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19271 MGI:104574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933423P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71158 MGI:1918408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Nup160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59015 MGI:1926227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fnbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55935 MGI:1860513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl30-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19949 MGI:1321401
definition	gene_synonym : RpL30-4 note : ribosomal protein L30, pseudogene 3 pseudo : _no_value

name	Agbl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271813 MGI:2443254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1201 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129092 GeneID:258897 MGI:3031035
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1201 transcript_id : NM_146895.1

name	Olfr1202 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239029 GeneID:258454 MGI:3031036
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1202 transcript_id : NM_146462.1

name	Olfr1203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129094 GeneID:258898 MGI:3031037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1203 transcript_id : NM_146896.1

name	Olfr1204 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671323 GeneID:258455 MGI:3031038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1204 transcript_id : NM_146463.2

name	Olfr1206 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174761 GeneID:258896 MGI:3031040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1206 transcript_id : NM_001001810.2

name	Olfr1208 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129290 GeneID:258774 MGI:3031042
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1208 transcript_id : NM_146778.1

name	Olfr1209 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239035 GeneID:258453 MGI:3031043
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1209 transcript_id : NM_146461.1

name	Olfr1211 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801373 GeneID:258025 MGI:3031045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1211 transcript_id : NM_001011804.1

name	Olfr1212 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369488 GeneID:258241 MGI:3031046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1212 transcript_id : NM_207140.1

name	Olfr1213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129090 GeneID:258900 MGI:3031047
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1213 transcript_id : NM_146898.1

name	Olfr1214 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583724 GeneID:258899 MGI:3031048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1214 transcript_id : NM_146897.2

name	Olfr1215 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239023 GeneID:258451 MGI:3031049
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1215 transcript_id : NM_146459.1

name	Olfr1216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583726 GeneID:258895 MGI:3031050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1216 transcript_id : NM_146893.2

name	Olfr1217 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129080 GeneID:258903 MGI:3031051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1217 transcript_id : NM_146901.1

name	Olfr1218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983593 GeneID:258815 MGI:3031052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1218 transcript_id : NM_146818.2

name	Olfr1219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129084 GeneID:258901 MGI:3031053
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1219 transcript_id : NM_146899.1

name	Olfr1220 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129086 GeneID:258902 MGI:3031054
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1220 transcript_id : NM_146900.1

name	Olfr1221 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129082 GeneID:258904 MGI:3031055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1221 transcript_id : NM_146902.1

name	Olfr1222 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801477 GeneID:258177 MGI:3031056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1222 transcript_id : NM_001011860.1

name	Olfr1223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983591 GeneID:258894 MGI:3031057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1223 transcript_id : NM_146892.2

name	Olfr1225 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129100 GeneID:258893 MGI:3031059
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1225 transcript_id : NM_146891.1

name	Olfr1226 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128992 GeneID:258969 MGI:3031060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1226 transcript_id : NM_146967.1

name	LOC100042983 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249909 GeneID:100042983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042983 transcript_id : XM_001478414.1

name	Olfr1228 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128984 GeneID:258973 MGI:3031062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1228 transcript_id : NM_146971.1

name	Olfr1229 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801309 GeneID:257921 MGI:3031063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1229 transcript_id : NM_001011761.1

name	Olfr1230 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129270 GeneID:258785 MGI:3031064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1230 transcript_id : NM_146789.1

name	Olfr1231 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239025 GeneID:258446 MGI:3031065
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1231 transcript_id : NM_146454.1

name	Olfr1232 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129650 GeneID:258320 MGI:3031066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1232 transcript_id : NM_146323.1

name	Olfr1233 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128986 GeneID:258974 MGI:3031067
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1233 transcript_id : NM_146972.1

name	Olfr1234 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128980 GeneID:258975 MGI:3031068
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1234 transcript_id : NM_146973.1

name	Olfr1238 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129272 GeneID:258786 MGI:3031072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1238 transcript_id : NM_146790.1

name	Olfr1239 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128990 GeneID:258972 MGI:3031073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1239 transcript_id : NM_146970.1

name	Olfr1240 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129238 GeneID:258804 MGI:3031074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1240 transcript_id : NM_146808.1

name	Olfr1241 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239033 GeneID:258447 MGI:3031075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1241 transcript_id : NM_146455.1

name	Olfr1242 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128994 GeneID:258970 MGI:3031076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1242 transcript_id : NM_146968.1

name	Olfr1243 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128988 GeneID:258971 MGI:3031077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1243 transcript_id : NM_146969.1

name	Olfr1245 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129276 GeneID:258784 MGI:3031079
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1245 transcript_id : NM_146788.1

name	Olfr1246 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129268 GeneID:258788 MGI:3031080
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1246 transcript_id : NM_146792.1

name	Olfr1247 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128998 GeneID:258968 MGI:3031081
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1247 transcript_id : NM_146966.1

name	Olfr1248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129266 GeneID:258787 MGI:3031082
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1248 transcript_id : NM_146791.1

name	Olfr1249 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801357 GeneID:257984 MGI:3031083
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1249 transcript_id : NM_001011796.1

name	Olfr1250 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128996 GeneID:258967 MGI:3031084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1250 transcript_id : NM_146965.1

name	Olfr1251 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372137 GeneID:259145 MGI:3031085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1251 transcript_id : NM_001011529.1

name	Olfr1252 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430587 GeneID:404331 MGI:3031086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1252 transcript_id : NM_207568.1

name	Olfr1254 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239031 GeneID:258468 MGI:3031088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1254 transcript_id : NM_146476.1

name	Olfr1255 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128978 GeneID:258979 MGI:3031089
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1255 transcript_id : NM_146977.1

name	Olfr1256 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128964 GeneID:258985 MGI:3031090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1256 transcript_id : NM_146983.1

name	Olfr48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778831 GeneID:18347 MGI:1333765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 48 transcript_id : NM_010990.1

name	Olfr1257 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227473 GeneID:258984 MGI:3031091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1257 transcript_id : NM_146982.1

name	Olfr1258 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128972 GeneID:258980 MGI:3031092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1258 transcript_id : NM_146978.1

name	Olfr1259 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129615 GeneID:258338 MGI:3031093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1259 transcript_id : NM_146341.1

name	Olfr1260 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128970 GeneID:258983 MGI:3031094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1260 transcript_id : NM_146981.1

name	Olfr1261 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27883863 GeneID:258466 MGI:3031095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1261 transcript_id : NM_146474.1

name	Olfr1262 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128982 GeneID:258976 MGI:3031096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1262 transcript_id : NM_146974.1

name	Olfr1263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129264 GeneID:258790 MGI:3031097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1263 transcript_id : NM_146794.1

name	Olfr1264 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11496248 GeneID:258206 MGI:3031098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1264 transcript_id : NM_021368.1

name	Olfr1265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129611 GeneID:258340 MGI:3031099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1265 transcript_id : NM_146343.1

name	Olfr140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11464994 GeneID:57272 MGI:2177523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 140 transcript_id : NM_020515.1

name	Olfr1269 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129617 GeneID:258339 MGI:3031103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1269 transcript_id : NM_146342.1

name	Olfr32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468916 GeneID:18331 MGI:109303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 32 transcript_id : NM_010980.1

name	LOC100043090 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249925 GeneID:100043090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins product : similar to Crx opposite strand transcript 1 transcript_id : XM_001478712.1

name	Olfr1270 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128966 GeneID:258987 MGI:3031104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1270 transcript_id : NM_146985.1

name	LOC627525 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367098 GeneID:627525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 3 Proteins product : similar to PTPRJ transcript_id : XM_892197.2

name	LOC100043096 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249927 GeneID:100043096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : similar to protein tyrosine phosphatase receptor type J transcript_id : XM_001478719.1

name	Olfr1506 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128630 GeneID:257665 MGI:3031340
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1506 transcript_id : NM_146265.1

name	Olfr142 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208851 GeneID:406186 MGI:2177525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 142 transcript_id : NM_146984.1

name	Olfr1271 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129262 GeneID:258789 MGI:3031105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1271 transcript_id : NM_146793.1

name	Olfr1272 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128968 GeneID:258982 MGI:3031106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1272 transcript_id : NM_146980.1

name	Olfr1273 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128976 GeneID:258977 MGI:3031107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1273 transcript_id : NM_146975.1

name	LOC100042690 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249892 GeneID:100042690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2357 Proteins product : similar to olfactory receptor 1506 transcript_id : XM_001478640.1

name	LOC100043113 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249930 GeneID:100043113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : similar to protein tyrosine phosphatase receptor type J transcript_id : XM_001478727.1

name	LOC668629 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249894 GeneID:668629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 3 Proteins product : similar to PTPRJ transcript_id : XM_001002717.2

name	GA_x5J8B7W2BV0-3116-4045 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:22128628 GeneID:257663
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor GA_x5J8B7W2BV0-3116-4045 transcript_id : NM_146263.1

name	Ptprj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115648014 GeneID:19271 MGI:104574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, J transcript_id : NM_008982.4

name	4933423P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249935 GeneID:71158 MGI:1918408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 4933423P22 gene transcript_id : XM_001478748.1

name	Nup160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130462 GeneID:59015 MGI:1926227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 160 transcript_id : NM_021512.2

name	Fnbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130721 GeneID:55935 MGI:1860513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin binding protein 4 transcript_id : NM_018828.2

name	Agbl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370920 GeneID:271813 MGI:2443254
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP/GTP binding protein-like 2 transcript_id : NM_178755.2

name	Olfr1201 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129093 CCDS:CCDS16349.1 GeneID:258897 MGI:3031035
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50268830-50269753; olfactory receptor MOR230-2 product : olfactory receptor 1201 protein_id : NP_667106.1

name	Olfr1202 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239030 CCDS:CCDS16350.1 GeneID:258454 MGI:3031036
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50290367-50291296; olfactory receptor MOR232-7 product : olfactory receptor 1202 protein_id : NP_666673.1

name	Olfr1203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129095 CCDS:CCDS16351.1 GeneID:258898 MGI:3031037
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50304328-50305251; olfactory receptor MOR230-1 product : olfactory receptor 1203 protein_id : NP_667107.1

name	Olfr1204 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671324 CCDS:CCDS16352.1 GeneID:258455 MGI:3031038
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50322618-50323547; olfactory receptor MOR232-6 product : olfactory receptor 1204 protein_id : NP_666674.2

name	Olfr1206 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174762 CCDS:CCDS16353.1 GeneID:258896 MGI:3031040
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50338497-50339264; olfactory receptor MOR230-3; olfactory receptor 1206, pseudogene 1 product : olfactory receptor 1206 protein_id : NP_001001810.2

name	Olfr1208 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129291 CCDS:CCDS16354.1 GeneID:258774 MGI:3031042
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50372411-50371485; olfactory receptor MOR225-4 product : olfactory receptor 1208 protein_id : NP_666989.1

name	Olfr1209 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239036 CCDS:CCDS16355.1 GeneID:258453 MGI:3031043
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50386882-50385950; olfactory receptor MOR230-7 product : olfactory receptor 1209 protein_id : NP_666672.1

name	Olfr1211 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801374 CCDS:CCDS16356.1 GeneID:258025 MGI:3031045
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50409367-50408432; olfactory receptor MOR233-16P product : olfactory receptor 1211 protein_id : NP_001011804.1

name	Olfr1212 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369489 CCDS:CCDS16357.1 GeneID:258241 MGI:3031046
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50437014-50437949; olfactory receptor MOR233-17 product : olfactory receptor 1212 protein_id : NP_997023.1

name	Olfr1213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129091 CCDS:CCDS16358.1 GeneID:258900 MGI:3031047
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50452032-50451097; olfactory receptor MOR233-7 product : olfactory receptor 1213 protein_id : NP_667109.1

name	Olfr1214 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583725 CCDS:CCDS16359.1 GeneID:258899 MGI:3031048
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50468705-50467770; olfactory receptor MOR233-8 product : olfactory receptor 1214 protein_id : NP_667108.2

name	Olfr1215 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239024 CCDS:CCDS16360.1 GeneID:258451 MGI:3031049
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50482823-50481885; olfactory receptor MOR233-13 product : olfactory receptor 1215 protein_id : NP_666670.1

name	Olfr1216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583727 CCDS:CCDS16361.1 GeneID:258895 MGI:3031050
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50494588-50493653; olfactory receptor MOR233-9 product : olfactory receptor 1216 protein_id : NP_667104.2

name	Olfr1217 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129081 CCDS:CCDS16362.1 GeneID:258903 MGI:3031051
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50504545-50503631; olfactory receptor MOR233-4 product : olfactory receptor 1217 protein_id : NP_667112.1

name	Olfr1218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983594 CCDS:CCDS16363.1 GeneID:258815 MGI:3031052
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50536041-50535106; olfactory receptor MOR233-12 product : olfactory receptor 1218 protein_id : NP_667029.2

name	Olfr1219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129085 CCDS:CCDS16364.1 GeneID:258901 MGI:3031053
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50555603-50554668; olfactory receptor MOR233-6 product : olfactory receptor 1219 protein_id : NP_667110.1

name	Olfr1220 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129087 CCDS:CCDS16365.1 GeneID:258902 MGI:3031054
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50579531-50578596; olfactory receptor MOR233-5 product : olfactory receptor 1220 protein_id : NP_667111.1

name	Olfr1221 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129083 CCDS:CCDS16366.1 GeneID:258904 MGI:3031055
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50591144-50590209; olfactory receptor MOR233-3 product : olfactory receptor 1221 protein_id : NP_667113.1

name	Olfr1222 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801478 CCDS:CCDS16367.1 GeneID:258177 MGI:3031056
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50604368-50603433; olfactory receptor MOR233-14 product : olfactory receptor 1222 protein_id : NP_001011860.1

name	Olfr1223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983592 CCDS:CCDS16368.1 GeneID:258894 MGI:3031057
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50623664-50622729; olfactory receptor MOR233-10 product : olfactory receptor 1223 protein_id : NP_667103.2

name	Olfr1225 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129101 CCDS:CCDS16369.1 GeneID:258893 MGI:3031059
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50650037-50649102; olfactory receptor MOR233-11 product : olfactory receptor 1225 protein_id : NP_667102.1

name	Olfr1226 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128993 CCDS:CCDS16370.1 GeneID:258969 MGI:3031060
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50672630-50671698; olfactory receptor MOR233-2 product : olfactory receptor 1226 protein_id : NP_667178.1

name	LOC100042983 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249910 GeneID:100042983
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478464.1

name	Olfr1228 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128985 CCDS:CCDS16371.1 GeneID:258973 MGI:3031062
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50696209-50695274; olfactory receptor MOR233-1 product : olfactory receptor 1228 protein_id : NP_667182.1

name	Olfr1229 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801310 CCDS:CCDS16372.1 GeneID:257921 MGI:3031063
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50727797-50726862; olfactory receptor MOR233-19 product : olfactory receptor 1229 protein_id : NP_001011761.1

name	Olfr1230 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129271 CCDS:CCDS16373.1 GeneID:258785 MGI:3031064
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50741934-50741017; olfactory receptor MOR237-1 product : olfactory receptor 1230 protein_id : NP_667000.1

name	Olfr1231 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239026 CCDS:CCDS16374.1 GeneID:258446 MGI:3031065
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50748233-50747292; olfactory receptor MOR235-2 product : olfactory receptor 1231 protein_id : NP_666665.1

name	Olfr1232 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129651 CCDS:CCDS16375.1 GeneID:258320 MGI:3031066
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50770831-50769896; olfactory receptor MOR233-18 product : olfactory receptor 1232 protein_id : NP_666435.1

name	Olfr1233 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128987 CCDS:CCDS16376.1 GeneID:258974 MGI:3031067
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50784973-50784056; olfactory receptor MOR238-1 product : olfactory receptor 1233 protein_id : NP_667183.1

name	Olfr1234 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128981 CCDS:CCDS16377.1 GeneID:258975 MGI:3031068
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50805620-50804676; olfactory receptor MOR231-2 product : olfactory receptor 1234 protein_id : NP_667184.1

name	Olfr1238 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129273 CCDS:CCDS16378.1 GeneID:258786 MGI:3031072
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50849945-50848998; olfactory receptor MOR231-11 product : olfactory receptor 1238 protein_id : NP_667001.1

name	Olfr1239 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128991 CCDS:CCDS16379.1 GeneID:258972 MGI:3031073
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50861284-50860367; olfactory receptor MOR231-3 product : olfactory receptor 1239 protein_id : NP_667181.1

name	Olfr1240 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129239 CCDS:CCDS16380.1 GeneID:258804 MGI:3031074
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50883183-50882239; olfactory receptor MOR231-8 product : olfactory receptor 1240 protein_id : NP_667019.1

name	Olfr1241 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239034 CCDS:CCDS16381.1 GeneID:258447 MGI:3031075
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50926215-50925271; olfactory receptor MOR231-14 product : olfactory receptor 1241 protein_id : NP_666666.1

name	Olfr1242 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128995 CCDS:CCDS16382.1 GeneID:258970 MGI:3031076
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50937307-50936387; olfactory receptor MOR231-5 product : olfactory receptor 1242 protein_id : NP_667179.1

name	Olfr1243 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128989 CCDS:CCDS16383.1 GeneID:258971 MGI:3031077
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50972538-50971621; olfactory receptor MOR231-4 product : olfactory receptor 1243 protein_id : NP_667180.1

name	Olfr1245 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129277 CCDS:CCDS16384.1 GeneID:258784 MGI:3031079
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51020951-51020028; olfactory receptor MOR231-12 product : olfactory receptor 1245 protein_id : NP_666999.1

name	Olfr1246 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129269 CCDS:CCDS16385.1 GeneID:258788 MGI:3031080
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51034790-51033846; olfactory receptor MOR231-9 product : olfactory receptor 1246 protein_id : NP_667003.1

name	Olfr1247 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128999 CCDS:CCDS16386.1 GeneID:258968 MGI:3031081
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51051555-51050611; olfactory receptor MOR231-6 product : olfactory receptor 1247 protein_id : NP_667177.1

name	Olfr1248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129267 CCDS:CCDS16387.1 GeneID:258787 MGI:3031082
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51059648-51058725; olfactory receptor MOR231-10 product : olfactory receptor 1248 protein_id : NP_667002.1

name	Olfr1249 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801358 CCDS:CCDS16388.1 GeneID:257984 MGI:3031083
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51072323-51071367; MOR231-25_p; olfactory receptor MOR231-17P product : olfactory receptor 1249 protein_id : NP_001011796.1

name	Olfr1250 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128997 CCDS:CCDS16389.1 GeneID:258967 MGI:3031084
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51098877-51097933; olfactory receptor MOR231-7 product : olfactory receptor 1250 protein_id : NP_667176.1

name	Olfr1251 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372138 CCDS:CCDS16390.1 GeneID:259145 MGI:3031085
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51109312-51108356; MOR231-24_p; olfactory receptor MOR231-15P product : olfactory receptor 1251 protein_id : NP_001011529.1

name	Olfr1252 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430588 CCDS:CCDS16391.1 GeneID:404331 MGI:3031086
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MOR231-22_p; GA_x6K02T2Q125-51162884-51161940 product : olfactory receptor 1252 protein_id : NP_997451.1

name	Olfr1254 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239032 CCDS:CCDS16392.1 GeneID:258468 MGI:3031088
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51230155-51229211; olfactory receptor MOR231-13 product : olfactory receptor 1254 protein_id : NP_666687.1

name	Olfr1255 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128979 CCDS:CCDS16393.1 GeneID:258979 MGI:3031089
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51257221-51258135; olfactory receptor MOR232-4 product : olfactory receptor 1255 protein_id : NP_667188.1

name	Olfr1256 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128965 CCDS:CCDS16394.1 GeneID:258985 MGI:3031090
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51276848-51275928; olfactory receptor MOR231-1 product : olfactory receptor 1256 protein_id : NP_667194.1

name	Olfr48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778832 CCDS:CCDS16395.1 GeneID:18347 MGI:1333765
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR232-5; GA_x6K02T2Q125-51285881-51284976 product : olfactory receptor 48 protein_id : NP_035120.1

name	Olfr1257 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227474 CCDS:CCDS16396.1 GeneID:258984 MGI:3031091
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51319458-51320387; olfactory receptor MOR232-1 product : olfactory receptor 1257 protein_id : NP_667193.1

name	Olfr1258 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128973 CCDS:CCDS16397.1 GeneID:258980 MGI:3031092
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51361752-51362687; olfactory receptor MOR232-3 product : olfactory receptor 1258 protein_id : NP_667189.1

name	Olfr1259 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129616 CCDS:CCDS16398.1 GeneID:258338 MGI:3031093
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51376062-51375133; olfactory receptor MOR232-9 product : olfactory receptor 1259 protein_id : NP_666453.1

name	Olfr1260 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128971 CCDS:CCDS16399.1 GeneID:258983 MGI:3031094
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51409740-51410672; olfactory receptor MOR232-2 product : olfactory receptor 1260 protein_id : NP_667192.1

name	Olfr1261 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883864 CCDS:CCDS16400.1 GeneID:258466 MGI:3031095
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51425355-51426275; olfactory receptor MOR234-3 product : olfactory receptor 1261 protein_id : NP_666685.1

name	Olfr1262 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128983 CCDS:CCDS16401.1 GeneID:258976 MGI:3031096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51434523-51435437; olfactory receptor MOR234-1 product : olfactory receptor 1262 protein_id : NP_667185.1

name	Olfr1263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129265 CCDS:CCDS16402.1 GeneID:258790 MGI:3031097
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51447049-51447969; olfactory receptor MOR234-2 product : olfactory receptor 1263 protein_id : NP_667005.1

name	Olfr1264 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11496249 CCDS:CCDS16403.1 GeneID:258206 MGI:3031098
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51454183-51453257; odorant receptor 16; olfactory receptor MOR236-1 product : olfactory receptor 1264 protein_id : NP_067343.1

name	Olfr1265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129612 CCDS:CCDS16404.1 GeneID:258340 MGI:3031099
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51469027-51469956; olfactory receptor MOR228-2 product : olfactory receptor 1265 protein_id : NP_666455.1

name	Olfr140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11464995 CCDS:CCDS16405.1 GeneID:57272 MGI:2177523
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : odorant receptor A16; GA_x6K02T2Q125-51484508-51483600 product : olfactory receptor 140 protein_id : NP_065261.1

name	Olfr1269 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129618 CCDS:CCDS16406.1 GeneID:258339 MGI:3031103
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51551618-51550689; olfactory receptor MOR228-3 product : olfactory receptor 1269 protein_id : NP_666454.1

name	Olfr32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468917 CCDS:CCDS16407.1 GeneID:18331 MGI:109303
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR227-7P; GA_x6K02T2Q125-51573576-51572650 product : olfactory receptor 32 protein_id : NP_035110.1

name	LOC100043090 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249926 GeneID:100043090
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478762.1

name	Olfr1270 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128967 CCDS:CCDS16408.1 GeneID:258987 MGI:3031104
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51584440-51583526; olfactory receptor MOR227-1 product : olfactory receptor 1270 protein_id : NP_667196.1

name	LOC627525 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886469 GeneID:627525
definition	codon_start : 1 product : similar to PTPRJ protein_id : XP_897290.1

name	LOC100043096 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249928 GeneID:100043096
definition	codon_start : 1 product : similar to protein tyrosine phosphatase receptor type J protein_id : XP_001478769.1

name	Olfr1506 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128631 CCDS:CCDS16409.1 GeneID:257665 MGI:3031340
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x5J8B7W1PMD-3116-4045; GA_x6K02T2RJGU-1819-2748 product : olfactory receptor 1506 protein_id : NP_666377.1

name	Olfr142 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208852 CCDS:CCDS16410.1 GeneID:406186 MGI:2177525
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51607674-51606757 product : olfactory receptor 142 protein_id : NP_667195.1

name	Olfr1271 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129263 CCDS:CCDS16411.1 GeneID:258789 MGI:3031105
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51620802-51619885; olfactory receptor MOR227-5 product : olfactory receptor 1271 protein_id : NP_667004.1

name	Olfr1272 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128969 CCDS:CCDS16412.1 GeneID:258982 MGI:3031106
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51636504-51635578; olfactory receptor MOR227-3 product : olfactory receptor 1272 protein_id : NP_667191.1

name	Olfr1273 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128977 GeneID:258977 MGI:3031107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-51650793-51649870; olfactory receptor MOR227-4 product : olfactory receptor 1273 protein_id : NP_667186.1

name	LOC100042690 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249893 GeneID:100042690
definition	codon_start : 1 product : similar to olfactory receptor 1506 protein_id : XP_001478690.1

name	LOC100043113 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249931 GeneID:100043113
definition	codon_start : 1 product : similar to protein tyrosine phosphatase receptor type J protein_id : XP_001478777.1

name	LOC668629 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249895 GeneID:668629
definition	codon_start : 1 product : similar to PTPRJ protein_id : XP_001002717.2

name	GA_x5J8B7W2BV0-3116-4045 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:22128629 GeneID:257663
definition	codon_start : 1 exception : mismatches in translation product : olfactory receptor GA_x5J8B7W2BV0-3116-4045 protein_id : NP_666375.1

name	Ptprj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490379 GeneID:19271 MGI:104574
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : colon tumor susceptibility 1 product : protein tyrosine phosphatase, receptor type, J protein_id : NP_033008.2

name	4933423P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249936 GeneID:71158 MGI:1918408
definition	codon_start : 1 product : hypothetical protein LOC71158 protein_id : XP_001478798.1

name	Nup160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946932 CCDS:CCDS16413.1 GeneID:59015 MGI:1926227
definition	GO_component : GO:0005643 - nuclear pore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence IDA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gene trap locus-13; gene trap locus 1-13; nucleoporin 160kDa product : nucleoporin 160 protein_id : NP_067487.1

name	Fnbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055220 CCDS:CCDS16414.1 GeneID:55935 MGI:1860513
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : formin binding protein 30 product : formin binding protein 4 protein_id : NP_061298.1

name	Agbl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520209 GeneID:271813 MGI:2443254
definition	GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : carboxypeptidase 2, cytosolic product : ATP/GTP binding protein-like 2 protein_id : NP_848870.1

name	LOC435676 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435676
definition	number : 1 pseudo : _no_value

clone name	MSMg01-112G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270B09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-080N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-498F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464D23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-422D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295H24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-141M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139O08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-358A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066G06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-093A23.b	B6Ng01-093A23.g
ACC	DH904650	DH904651
length	1,218	1,087
definition	DH904650\|Mus musculus domesticus DNA, BAC clone: B6Ng01-093A23, 5' end.	DH904651\|Mus musculus domesticus DNA, BAC clone: B6Ng01-093A23, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	tgtgggggaggaagggttcccggcgggaattcattgtttagatctgtacc tcattttttaatacggggtacagatttaatttgattttctggagtccatc tacttgagttatttatatatattggatattagtcccctatcagatttagg attggtaaagatcctttcccaatctgttggtggcctttttgtcgtattga tagtgtcttttgccttatggaagctttgcaattttatgaggtcccatttt tcaattctcgatcttacagcacaagccattgctgttctattcaggagttt tccccctgtgcccgtatcttcaaggttttcccccactttctcctctatga atttcagtatctctggttttatgtggagttacttgatccatgcagccttg acgttagtacaaggagataagaatggatcaatgatcattcttccaaatga taactaccagttgtgtcagtaccatttgttgcaaatgctgtattttttcc actggatgattttagctccctggtcaaagatcaagtgactataggtgtgt gggatcctttctgggtcttcaattctattccattgatctacctgtctgtc gctataccaagtaccatgcagttattatcacaattgctctgtagtacacc atgaggtcaggcatggtgattccaccagaggttctttgatcactgggaag agtttttgctatcctagttgttttgttattccagatgaatttgcaaattg ccctttctaactcagtgaagaattaagttggaattttgatggggattgca ttgaatctgtagattgcttttggtaggataaacatttttactatattaat cctgccaatccatgagtatgggagatctttccatcttctgagatcttctt tgatttctttcttcaaagacttgaagttcttatcatacagatctttcact tccttagagacacacaagttattttatattatttgtgactattgtgaagg tgtgtttccctaatttctttctcagctgttatctttgtgtagagaagcca tggttgttgagtatttatatcacacttcctaagctgtttatagattgagt ctctggtgcaatttaagtcacttataatacatatcacttgcaaaggaatt aggacctctccttaccatgatcctgaccctttgtgtcaacgttccgaggt acctcagatcctatttga	gaattccacttgtctcaatatttcaggaaaatataagaacatctaaatga ctacttaaaatataaaaagcacatcaagtatcactccaacatttaatata aaaggtaggtggaaagtctcacctgcagggaaaatgtcttcatacccaac aaatacattaagcttgcatttatatgtaaaacatttaatggaaattagtg tgccagggtcattattaatactggcacatactaataaaattttaaccatg cttttctcttttttctatcagtgaagtcctgcaaaaggactttgatttaa gggggagaccaagagcacctctgtgcctcaaatgtatgccaagtaagcaa gaagcaaaggctgtgatttcacttcttgagaagttataatgaaggttctc atgtgtagaagatgtcttcagtcttcaagaatccaaataaaatctttcta aagcctacctctttctaataaaatgtatccaagtatatggaaggatccag ctattgatatcttccatgaactctaataagcaaagatgaatgcattaaaa atatgtactttgagaactaaatgctgactgagagcataccatagatggag caaattttgtgtttccagagaacttctgggtctagttctttcatttatat tcatgatatagaatgacttatatgcaccattgctattttaataaataagc ttgttaaaatatttgggaacaaattcaaatgaagtaatctctcttggaac agatttcttctcttcaccaatctctagaggtaatatccttgaaacttgcc caagaatgaatagctactcacaaatggacttgggaaaacctataatttgg aaagaaaacttccaaagtgtaatttctgggaaactgtgagctgcacatca taagttattataagtaaaggaagtaatatttagaccacccagagaagaaa acagtcttggttcaggtgtccatccatacccacaaatcatagagccttcc aaataacctgtgagtgacaggcctgtcaaggaaaatttaaggtggctgaa gtccggaaaggctgagacgtggaggatctcactagag
quality values	Open. Hide. 4 4 2 3 5 8 8 7 5 4 6 6 5 5 4 4 4 5 4 6 11 6 5 6 7 5 7 8 22 12 15 7 23 18 14 12 15 61 27 14 8 24 27 20 26 13 19 52 61 43 13 9 7 5 8 10 50 17 8 21 19 18 29 27 33 55 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 59 61 59 61 61 61 61 59 61 49 43 38 30 35 32 22 25 27 27 52 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 59 52 61 61 59 61 59 61 61 61 61 55 55 35 55 61 61 61 61 61 61 59 55 59 59 59 52 43 44 52 59 61 59 55 59 59 55 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 52 61 61 61 61 61 61 61 47 39 61 61 61 61 53 57 57 57 57 57 57 57 57 57 57 57 57 57 47 57 57 57 57 53 57 53 50 57 57 57 53 47 53 43 57 57 57 53 57 57 53 53 57 57 53 52 53 53 53 47 57 57 57 57 57 57 53 53 57 52 57 45 45 53 52 53 37 41 38 47 46 37 36 52 37 53 53 41 52 45 53 53 57 57 52 57 43 32 52 48 48 42 41 52 45 50 43 24 57 37 57 50 52 57 57 53 39 38 43 42 47 50 52 46 52 52 57 33 57 39 37 57 57 57 53 52 53 53 50 39 50 57 39 53 42 53 57 53 37 57 57 53 52 29 37 36 33 53 37 52 38 38 52 30 37 57 45 36 57 57 41 39 29 57 53 39 57 47 38 18 20 52 53 41 43 37 31 41 40 52 37 33 33 47 53 48 48 36 57 40 31 41 33 37 27 30 47 53 38 47 47 34 57 57 53 36 48 27 47 57 57 44 32 19 43 44 29 32 48 47 32 45 31 31 39 38 46 34 31 27 31 23 32 47 35 35 51 51 38 45 38 20 43 18 48 39 22 29 46 29 30 34 41 51 46 46 24 28 33 32 48 29 43 35 38 41 32 36 34 41 29 43 22 27 19 33 25 23 22 26 29 36 46 34 35 29 29 29 51 29 43 29 28 22 28 39 51 38 22 29 28 29 41 39 38 29 29 29 33 29 28 25 28 29 34 29 36 51 31 27 35 28 51 34 29 29 51 29 29 22 31 29 23 36 30 23 35 25 26 24 29 22 29 28 26 23 28 17 21 12 19 28 28 28 28 28 28 31 34 33 28 32 51 28 27 28 19 30 28 18 28 15 20 18 14 30 23 26 17 15 15 10 16 16 25 11 13 22 32 24 44 44 29 25 13 12 16 22 30 26 44 19 30 19 19 28 20 9 9 8 14 29 15 22 19 7 4 6 13 16 9 6 10 42 16 8 34 18 22 16 20 17 34 14 24 18 42 16 3 3 7 10 4 4 5 6 9 19 4 4 4 3 18 12 21 8 24 17 8 9 22 9 25 14 4 3 12 9 24 5 14 6 6 21 16 20 7 7 4 7 4 15 32 22 8 8 8 10 12 5 7 19 12 7 7 9 7 9 12 13 9 21 9 15 6 24 4 3 3 4 4 1 4 12 16 3 3 3 3 3 3 4 18 9 6 9 14 16 8 17 20 13 4 5 17 4 5 7 5 9 8 9 5 6 5 5 11 7 5 5 13 4 6 5 6 12 5 17 13 7 30 7 4 3 7 4 12 14 6 5 7 18 8 9 19 6 19 4 10 3 5 6 10 6 3 3 1 3 2 4 4 3 4 13 17 24 5 1 13 4 5 5 4 5 5 9 9 5 13 3 4 4 3 4 1 1 9 4 8 8 4 19 8 15 6 3 4 10 3 3 14 4 5 12 5 7	Open. Hide. 61 61 19 35 53 53 32 18 47 50 50 50 50 50 52 40 43 39 50 55 61 61 61 47 43 50 61 61 55 61 41 50 55 61 55 55 50 61 55 61 55 61 61 61 50 61 52 55 61 61 55 55 55 61 55 55 52 50 36 55 61 55 55 55 55 55 55 61 61 61 61 61 61 61 61 55 55 61 61 55 61 55 52 55 61 61 47 37 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 53 61 61 47 61 39 61 61 61 61 61 61 53 61 61 61 61 61 61 50 61 61 61 61 46 57 47 43 57 57 53 53 57 57 57 57 57 53 57 57 57 53 53 57 57 47 53 57 57 53 37 47 57 57 57 57 57 57 53 43 53 53 57 57 57 57 53 53 53 53 53 47 42 26 57 57 53 53 57 53 57 57 47 57 53 38 57 38 47 53 46 37 47 57 53 50 53 53 53 52 53 50 52 53 53 47 57 52 37 57 52 57 53 53 53 57 57 47 53 53 45 57 53 57 50 47 47 47 52 33 53 57 52 38 52 45 50 53 53 47 57 57 57 53 50 53 53 53 50 50 52 57 57 52 46 40 42 53 53 50 50 45 57 50 53 57 50 57 57 53 50 46 57 52 43 57 36 45 39 52 32 31 37 38 57 53 52 52 50 57 57 47 37 53 50 53 39 53 57 33 43 57 53 46 34 32 38 34 47 31 38 51 29 29 26 30 43 53 53 39 53 57 43 28 53 38 37 37 37 53 52 33 57 40 38 20 34 57 20 22 45 33 37 44 52 30 52 53 53 42 40 37 31 24 53 33 29 52 35 42 53 53 42 37 38 53 35 44 24 27 30 23 11 16 44 28 37 40 41 43 45 28 40 31 22 14 57 35 34 35 44 22 33 30 29 44 18 29 16 57 57 37 37 31 23 45 37 22 45 21 23 31 31 16 45 20 10 43 33 27 45 44 38 31 35 34 31 43 31 29 39 44 47 47 30 30 24 46 18 16 51 29 29 27 35 30 30 51 36 30 29 29 30 30 36 43 27 29 22 30 29 29 29 37 43 31 29 29 29 34 48 21 43 27 48 29 29 18 29 29 32 23 43 28 31 51 29 29 17 32 29 15 46 22 29 24 29 46 36 29 28 20 39 19 30 28 35 29 22 35 28 29 15 12 8 46 31 29 31 25 14 25 30 43 21 46 5 25 51 51 29 22 11 11 21 29 34 27 30 46 30 14 11 39 51 46 23 46 51 46 14 15 32 20 23 26 6 51 43 20 26 30 21 30 30 28 51 24 19 20 29 42 26 31 51 28 26 26 22 20 14 25 14 25 31 29 25 20 29 14 25 28 16 7 15 16 26 38 18 12 13 5 8 25 23 27 31 19 23 51 18 14 13 23 21 22 24 29 16 21 26 35 51 19 20 22 31 27 28 13 20 38 35 11 5 30 19 28 30 8 35 51 15 19 16 18 20 17 13 7 14 15 29 7 16 28 12 24 19 11 25 26 10 13 11 20 11 26 15 24 23 20 39 31 15 24 18 39 23 16 12 13 10 5 4 9 8 24 14 7 17 14 18 8 33 13 13 8 29 13 17 17 7 5 7 4 3 3 12 10 7 5 7 4 9 21 8 10 5 4 3 8 8 10 18 16 15 23 10 28 25 5 7 22 7 7 8 12 10 5 6 4 5 4 5 17 6 11 3 7 36 27 7 14 24 23 20 12 4 8 12 4 3 2 3 5 8 5 4 1 3 4 4 10 9 5 11 5 5 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_89633113_89634185
seq2: B6Ng01-093A23.g_69_1155

seq1  GAATTCCACTTGTCTCAATATTTCAGGAAAATATAAGAACATCTAAATGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCACTTGTCTCAATATTTCAGGAAAATATAAGAACATCTAAATGA  50

seq1  CTACTTAAAATATAAAAAGCACATCAAGTATCACTCCAACATTTAATATA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTTAAAATATAAAAAGCACATCAAGTATCACTCCAACATTTAATATA  100

seq1  AAAGGTAGGTGGAAAGTCTCACCTGCAGGGAAAATGTCTTCATACCCAAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGTAGGTGGAAAGTCTCACCTGCAGGGAAAATGTCTTCATACCCAAC  150

seq1  AAATACATTAAGCTTGCATTTATATGTAAAACATTTAATGGAAATTAGTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACATTAAGCTTGCATTTATATGTAAAACATTTAATGGAAATTAGTG  200

seq1  TGCCAGGGTCATTATTAATACTGGCACATACTAATAAAATTTTAACCATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAGGGTCATTATTAATACTGGCACATACTAATAAAATTTTAACCATG  250

seq1  CTTTTCTCTTTTTTCTATCAGTGAAGTCCTGCAAAAGGACTTTGATTTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTCTCTTTTTTCTATCAGTGAAGTCCTGCAAAAGGACTTTGATTTAA  300

seq1  GGGGGAGACCAAGAGCACCTCTGTGCCTCAAATGTATGCCAAGTAAGCAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGAGACCAAGAGCACCTCTGTGCCTCAAATGTATGCCAAGTAAGCAA  350

seq1  GAAGCAAAGGCTGTGATTTCACTTCTTGAGAAGTTATAATGAAGGTTCTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCAAAGGCTGTGATTTCACTTCTTGAGAAGTTATAATGAAGGTTCTC  400

seq1  ATGTGTAGAAGATGTCTTCAGTCTTCAAGAATCCAAATAAAATCTTTCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGTAGAAGATGTCTTCAGTCTTCAAGAATCCAAATAAAATCTTTCTA  450

seq1  AAGCCTACCTCTTTCTAATAAAATGTATCCAAGTATATGGAAGGATCCAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCTACCTCTTTCTAATAAAATGTATCCAAGTATATGGAAGGATCCAG  500

seq1  CTATTGATATCTTCCATGAACTCTAATAAGCAAAGATGAATGCATTAAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTGATATCTTCCATGAACTCTAATAAGCAAAGATGAATGCATTAAAA  550

seq1  ATATGTACTTTGAGAACTAAATGCTGACTGAGAGCATACCATAGATGGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGTACTTTGAGAACTAAATGCTGACTGAGAGCATACCATAGATGGAG  600

seq1  CAAATTTTGTGTTTCCAGAGAACTTCTGGGTCTAGTTCTTTCATTTATAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATTTTGTGTTTCCAGAGAACTTCTGGGTCTAGTTCTTTCATTTATAT  650

seq1  TCATGATATAGAATGACTTATATGCACCATTGCTATTTTAATAAATAAGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGATATAGAATGACTTATATGCACCATTGCTATTTTAATAAATAAGC  700

seq1  TTGTTAAAATATTT-GGAACAAATTCAAATGAAGTAATCTCTCTT-GAAC  748
      |||||||||||||| |||||||||||||||||||||||||||||| ||||
seq2  TTGTTAAAATATTTGGGAACAAATTCAAATGAAGTAATCTCTCTTGGAAC  750

seq1  AGATTTCTTCTCTTCACCAATCTCTAGAGGTAATATCCTTGAAACTTG-C  797
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AGATTTCTTCTCTTCACCAATCTCTAGAGGTAATATCCTTGAAACTTGCC  800

seq1  CAAGAATGAATAGCTACTCACAAATGGACTT-GGAAAACCTATAATTTGA  846
      ||||||||||||||||||||||||||||||| ||||||||||||||||| 
seq2  CAAGAATGAATAGCTACTCACAAATGGACTTGGGAAAACCTATAATTTGG  850

seq1  AAAGAAAACTTCCAAAGTGTAATTTCTGGGAAACTGTGAGCTGCACATCA  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAAACTTCCAAAGTGTAATTTCTGGGAAACTGTGAGCTGCACATCA  900

seq1  TAAGTTA-TATAAGTAAAGGAAGTAATATTTAGACCACCCAGAGAAGAAA  945
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTTATTATAAGTAAAGGAAGTAATATTTAGACCACCCAGAGAAGAAA  950

seq1  ACAGTCTTGGTTCAGGTGTCCATCCATACCCACAAATCAT--AGCCTTCC  993
      ||||||||||||||||||||||||||||||||||||||||  ||||||||
seq2  ACAGTCTTGGTTCAGGTGTCCATCCATACCCACAAATCATAGAGCCTTCC  1000

seq1  -AATAA-CTGTGAGTGACA-GCCTGTCAAAGAAAATTT-AGGT-GCTG-A  1037
       ||||| |||||||||||| ||||||||| |||||||| |||| |||| |
seq2  AAATAACCTGTGAGTGACAGGCCTGTCAAGGAAAATTTAAGGTGGCTGAA  1050

seq1  GTCGTGAAAAGCTGAGACGT-GAGGAGTCT-ACTAGAG  1073
      |||  |||| |||||||||| ||||| ||| |||||||
seq2  GTCCGGAAAGGCTGAGACGTGGAGGA-TCTCACTAGAG  1087

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information