MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-116F19
Chromosome	2 (Build37)
Map Location	181,079,509 - 181,080,393
singlet/doublet	singlet
Overlap gene	Rtel1
Upstream gene	EG622283, Slco4a1, Ntsr1, 1600027N09Rik, Ogfr, Col9a3, Tcfl5, Dido1, 2310003C23Rik, 1700019H03Rik, Bhlhb4, OTTMUSG00000016394, Ythdf1, Birc7, C030019F02Rik, LOC100039607, Arfgap1, Col20a1, Chrna4, Kcnq2, Eef1a2, 2700038C09Rik, Ptk6, Srms, LOC622592, BC051628, BC006779, Gmeb2, EG665467, Stmn3
Downstream gene	Arfrp1, Zgpat, Lime1, Btbd4, BC050777, Tpd52l2, Dnajc5, Uckl1, Znf512b, Samd10, Prpf6, LOC100039697, Sox18, Tcea2, Rgs19, 4930526D03Rik, Oprl1, LOC665538, Myt1, Pcmtd2, Polr3k, EG432881, LOC672125
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lsm14b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241846 MGI:3040677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psma7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26444 MGI:1347070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ss18l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269397 MGI:2444061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtpbp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52856 MGI:106565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Hrh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99296 MGI:2139279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osbpl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228983 MGI:2442832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Adrm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56436 MGI:1929289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lama5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16776 MGI:105382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66481 MGI:1913731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cables2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252966 MGI:2182335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC066135 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271887 MGI:3606212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gata5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14464 MGI:109497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622283 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622283 MGI:3649026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Slco4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108115 MGI:1351866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntsr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18216 MGI:97386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600027N09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73247 MGI:1920497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogfr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72075 MGI:1919325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col9a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12841 MGI:894686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcfl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277353 MGI:2672878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dido1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23856 MGI:1344352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	2310003C23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76425 MGI:1923675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700019H03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228993 MGI:1919107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bhlhb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140489 MGI:2153710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000016394 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:676369 MGI:3650817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Ythdf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228994 MGI:1917431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Birc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329581 MGI:2676458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 Proteins

name	C030019F02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58237 MGI:1915372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039607 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs

name	Arfgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228998 MGI:2183559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col20a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73368 MGI:1920618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Chrna4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11438 MGI:87888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnq2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16536 MGI:1309503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 12 mRNAs

name	Eef1a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13628 MGI:1096317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700038C09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66496 MGI:1913746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptk6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20459 MGI:99683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srms (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20811 MGI:101865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622592 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 177 ESTs pseudo : _no_value

name	BC051628 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332713 MGI:3051572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC006779 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229003 MGI:2385169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmeb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229004 MGI:2652836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665467 MGI:3646877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Stmn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20262 MGI:1277137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269400 MGI:2139369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arfrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76688 MGI:1923938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zgpat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229007 MGI:2449939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Lime1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72699 MGI:1919949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72147 MGI:1919397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC050777 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241850 MGI:3607711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpd52l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66314 MGI:1913564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13002 MGI:892995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uckl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68556 MGI:1915806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znf512b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269401 MGI:2685478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 74 ESTs, 3 Proteins

name	Samd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:229011 MGI:2443872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68879 MGI:1922946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Sox18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20672 MGI:103559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcea2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21400 MGI:107368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56470 MGI:1915153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930526D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277496 MGI:2685538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oprl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18389 MGI:97440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665538 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665538
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Myt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17932 MGI:1100535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcmtd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245867 MGI:1923927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr3k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67005 MGI:1914255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432881 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432881 MGI:3647828
definition	note : predicted gene, EG432881 pseudo : _no_value

name	LOC672125 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 Proteins

name	Lsm14b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801916 GeneID:241846 MGI:3040677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM14 homolog B (SCD6, S. cerevisiae) transcript_id : NM_177727.3

name	Psma7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106388 GeneID:26444 MGI:1347070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, alpha type 7 transcript_id : NM_011969.1

name	Ss18l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328462 GeneID:269397 MGI:2444061
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma translocation gene on chromosome 18-like 1 transcript_id : NM_178750.4

name	Gtpbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032024 GeneID:52856 MGI:106565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 5 transcript_id : NM_181424.3

name	Gtpbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032034 GeneID:52856 MGI:106565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 5 transcript_id : NM_001083328.1

name	Gtpbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031985 GeneID:52856 MGI:106565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 5 transcript_id : NM_028422.1

name	Gtpbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031949 GeneID:52856 MGI:106565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 5 transcript_id : NM_001083329.1

name	Hrh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388890 GeneID:99296 MGI:2139279
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histamine receptor H 3 transcript_id : NM_133849.2

name	Osbpl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802025 GeneID:228983 MGI:2442832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 2 transcript_id : NM_144500.3

name	Adrm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130567 GeneID:56436 MGI:1929289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adhesion regulating molecule 1 transcript_id : NM_019822.3

name	Lama5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487154 GeneID:16776 MGI:105382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : laminin, alpha 5 transcript_id : NM_001081171.1

name	Rps21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114051544 GeneID:66481 MGI:1913731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S21 transcript_id : NM_025587.2

name	Cables2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124053454 GeneID:252966 MGI:2182335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdk5 and Abl enzyme substrate 2 transcript_id : NM_145851.2

name	BC066135 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347813 GeneID:271887 MGI:3606212
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC066135 transcript_id : NM_173031.2

name	Gata5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110596 GeneID:14464 MGI:109497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA binding protein 5 transcript_id : NM_008093.1

name	EG622283 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367768 GeneID:622283 MGI:3649026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG622283 transcript_id : XM_896994.2

name	Slco4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507334 GeneID:108115 MGI:1351866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 4a1 transcript_id : NM_148933.1

name	Ntsr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801633 GeneID:18216 MGI:97386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurotensin receptor 1 transcript_id : NM_018766.2

name	1600027N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625964 GeneID:73247 MGI:1920497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600027N09 gene transcript_id : NM_028479.1

name	Ogfr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982603 GeneID:72075 MGI:1919325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opioid growth factor receptor transcript_id : NM_031373.2

name	Col9a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363118 GeneID:12841 MGI:894686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type IX, alpha 3 transcript_id : NM_009936.2

name	Tcfl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342352 GeneID:277353 MGI:2672878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor-like 5 (basic helix-loop-helix) transcript_id : NM_178254.2

name	Dido1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76096374 GeneID:23856 MGI:1344352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death inducer-obliterator 1 transcript_id : NM_175551.3

name	Dido1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51571540 GeneID:23856 MGI:1344352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death inducer-obliterator 1 transcript_id : NM_177852.3

name	Dido1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51556455 GeneID:23856 MGI:1344352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death inducer-obliterator 1 transcript_id : NM_011805.2

name	2310003C23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037442 GeneID:76425 MGI:1923675
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310003C23 gene transcript_id : NM_029607.1

name	1700019H03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347350 GeneID:228993 MGI:1919107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700019H03 gene transcript_id : NM_183161.3

name	Bhlhb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380234 GeneID:140489 MGI:2153710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic helix-loop-helix domain containing, class B4 transcript_id : NM_080641.4

name	OTTMUSG00000016394 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250517 GeneID:676369 MGI:3650817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000016394 transcript_id : XM_001480261.1

name	Ythdf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789291 GeneID:228994 MGI:1917431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YTH domain family 1 transcript_id : NM_173761.3

name	Birc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250519 GeneID:329581 MGI:2676458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 Proteins product : baculoviral IAP repeat-containing 7 (livin) transcript_id : XM_283820.5

name	C030019F02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129277 GeneID:58237 MGI:1915372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030019F02 gene transcript_id : NM_021426.3

name	LOC100039607 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250503 GeneID:100039607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs product : hypothetical protein LOC100039607 transcript_id : XM_001473184.1

name	Arfgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542138 GeneID:228998 MGI:2183559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor GTPase activating protein 1 transcript_id : NM_145760.2

name	Col20a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250505 GeneID:73368 MGI:1920618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : collagen, type XX, alpha 1 transcript_id : XM_001473208.1

name	Chrna4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328445 GeneID:11438 MGI:87888
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 4 transcript_id : NM_015730.4

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873643 GeneID:16536 MGI:1309503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006668.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873647 GeneID:16536 MGI:1309503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006674.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873645 GeneID:16536 MGI:1309503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006669.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873640 GeneID:16536 MGI:1309503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001003824.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873642 GeneID:16536 MGI:1309503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001003825.2

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873638 GeneID:16536 MGI:1309503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_010611.2

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873649 GeneID:16536 MGI:1309503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006675.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873653 GeneID:16536 MGI:1309503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006677.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873651 GeneID:16536 MGI:1309503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006676.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873655 GeneID:16536 MGI:1309503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006678.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873657 GeneID:16536 MGI:1309503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006679.1

name	Kcnq2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873659 GeneID:16536 MGI:1309503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily Q, member 2 transcript_id : NM_001006680.1

name	Eef1a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982852 GeneID:13628 MGI:1096317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation elongation factor 1 alpha 2 transcript_id : NM_007906.2

name	2700038C09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801696 GeneID:66496 MGI:1913746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700038C09 gene transcript_id : NM_025598.2

name	Ptk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893003 GeneID:20459 MGI:99683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PTK6 protein tyrosine kinase 6 transcript_id : NM_009184.2

name	Srms (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54287681 GeneID:20811 MGI:101865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites transcript_id : NM_011481.3

name	BC051628 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385469 GeneID:332713 MGI:3051572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC051628 transcript_id : NM_199312.2

name	BC006779 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347766 GeneID:229003 MGI:2385169
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC006779 transcript_id : NM_183162.2

name	Gmeb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130813 GeneID:229004 MGI:2652836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucocorticoid modulatory element binding protein 2 transcript_id : NM_198169.2

name	EG665467 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367775 GeneID:665467 MGI:3646877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG665467 transcript_id : XM_977134.1

name	Stmn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349134 GeneID:20262 MGI:1277137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stathmin-like 3 transcript_id : NM_009133.3

name	Rtel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233925 GeneID:269400 MGI:2139369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of telomere elongation helicase 1 transcript_id : NM_001001882.2

name	Arfrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803072 GeneID:76688 MGI:1923938
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor related protein 1 transcript_id : NM_029702.3

name	Zgpat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326530 GeneID:229007 MGI:2449939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCCH-type with G patch domain transcript_id : NM_144894.3

name	Zgpat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326527 GeneID:229007 MGI:2449939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCCH-type with G patch domain transcript_id : NM_001048148.1

name	Lime1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326526 GeneID:72699 MGI:1919949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Lck interacting transmembrane adaptor 1 transcript_id : NM_023684.2

name	Btbd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349378 GeneID:72147 MGI:1919397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 4 transcript_id : NM_028125.2

name	BC050777 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147235 GeneID:241850 MGI:3607711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050777 transcript_id : NM_183181.1

name	Tpd52l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560246 GeneID:66314 MGI:1913564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor protein D52-like 2 transcript_id : NM_025482.2

name	Dnajc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519174 GeneID:13002 MGI:892995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 5 transcript_id : NM_016775.2

name	Uckl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129860 GeneID:68556 MGI:1915806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uridine-cytidine kinase 1-like 1 transcript_id : NM_026765.3

name	Znf512b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250507 GeneID:269401 MGI:2685478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 74 ESTs, 3 Proteins product : zinc finger protein 512B transcript_id : XM_977462.2

name	Samd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328388 GeneID:229011 MGI:2443872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterile alpha motif domain containing 10 transcript_id : NM_172676.2

name	Prpf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001547 GeneID:68879 MGI:1922946
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP6 pre-mRNA splicing factor 6 homolog (yeast) transcript_id : NM_133701.2

name	LOC100039697 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250509 GeneID:100039697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039697 transcript_id : XM_001473352.1

name	Sox18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244105 GeneID:20672 MGI:103559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 18 transcript_id : NM_009236.2

name	Tcea2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892334 GeneID:21400 MGI:107368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII), 2 transcript_id : NM_009326.2

name	Rgs19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365528 GeneID:56470 MGI:1915153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 19 transcript_id : NM_026446.3

name	4930526D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370942 GeneID:277496 MGI:2685538
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930526D03 gene transcript_id : NM_199023.2

name	Oprl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383762 GeneID:18389 MGI:97440
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opioid receptor-like 1 transcript_id : NM_011012.3

name	Myt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130724 GeneID:17932 MGI:1100535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin transcription factor 1 transcript_id : NM_008665.3

name	Pcmtd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31559900 GeneID:245867 MGI:1923927
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 transcript_id : NM_153594.2

name	Polr3k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053866 GeneID:67005 MGI:1914255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) III (DNA directed) polypeptide K transcript_id : NM_025901.3

name	LOC672125 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250511 GeneID:672125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 Proteins product : similar to novel vomeronasal 2 receptor transcript_id : XM_001473506.1

name	Lsm14b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244196 CCDS:CCDS17165.1 GeneID:241846 MGI:3040677
definition	codon_start : 1 product : LSM14 homolog B protein_id : NP_808395.1

name	Psma7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106389 CCDS:CCDS17166.1 GeneID:26444 MGI:1347070
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) subunit, alpha type 7 protein_id : NP_036099.1

name	Ss18l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328463 CCDS:CCDS17167.1 GeneID:269397 MGI:2444061
definition	GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0016358 - dendrite development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS] codon_start : 1 exception : mismatches in translation product : synovial sarcoma translocation gene on chromosome 18-like 1 protein_id : NP_848865.3

name	Gtpbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032035 GeneID:52856 MGI:106565
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : GTP binding protein 5 protein_id : NP_001076797.1

name	Gtpbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031950 GeneID:52856 MGI:106565
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : GTP binding protein 5 protein_id : NP_001076798.1

name	Gtpbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031986 GeneID:52856 MGI:106565
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : GTP binding protein 5 protein_id : NP_082698.1

name	Gtpbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032025 GeneID:52856 MGI:106565
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : GTP binding protein 5 protein_id : NP_852089.2

name	Hrh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527066 CCDS:CCDS17169.1 GeneID:99296 MGI:2139279
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : histamine receptor H 3 protein_id : NP_598610.1

name	Osbpl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625879 CCDS:CCDS17170.1 GeneID:228983 MGI:2442832
definition	GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : oxysterol-binding protein-related protein 2; OSBP-related protein 2; oxysterol-binding protein-like 2 product : oxysterol-binding protein-like protein 2 protein_id : NP_653083.2

name	Adrm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981027 CCDS:CCDS17171.1 GeneID:56436 MGI:1929289
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : glycoprotein 110 product : adhesion regulating molecule 1 protein_id : NP_062796.2

name	Lama5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487155 GeneID:16776 MGI:105382
definition	GO_component : GO:0005605 - basal lamina [Evidence IEA]; GO:0005604 - basement membrane [Evidence IDA]; GO:0031012 - extracellular matrix [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] [Evidence IDA]; GO:0005606 - laminin-1 [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005178 - integrin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence IEA] GO_process : GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0001738 - morphogenesis of a polarized epithelium [Evidence IMP]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP]; GO:0007517 - muscle development [Evidence IMP]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0030155 - regulation of cell adhesion [Evidence IEA]; GO:0030334 - regulation of cell migration [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0045995 - regulation of embryonic development [Evidence IEA]; GO:0007431 - salivary gland development [Evidence IMP]; GO:0001658 - ureteric bud branching [Evidence IMP] codon_start : 1 product : laminin, alpha 5 protein_id : NP_001074640.1

name	Rps21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536222 GeneID:66481 MGI:1913731
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence ISS] [Evidence IEA] GO_function : GO:0043022 - ribosome binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : ribosomal protein S21 protein_id : NP_079863.1

name	Cables2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124053455 GeneID:252966 MGI:2182335
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0051726 - regulation of cell cycle [Evidence IEA]; GO:0051302 - regulation of cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : Cdk5 and Abl enzyme substrate 2 protein_id : NP_665850.2

name	BC066135 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370552 CCDS:CCDS17174.1 GeneID:271887 MGI:3606212
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC271887 protein_id : NP_766619.1

name	Gata5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110597 CCDS:CCDS17175.1 GeneID:14464 MGI:109497
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GATA-binding protein 5 product : GATA binding protein 5 protein_id : NP_032119.1

name	EG622283 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82888759 GeneID:622283 MGI:3649026
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902087.1

name	Slco4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507335 CCDS:CCDS17176.1 GeneID:108115 MGI:1351866
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 21 (organic anion transporter), member 12 product : solute carrier organic anion transporter family, member 4a1 protein_id : NP_683735.1

name	Ntsr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055296 CCDS:CCDS17177.1 GeneID:18216 MGI:97386
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008188 - neuropeptide receptor activity [Evidence TAS]; GO:0016492 - neurotensin receptor activity, G-protein coupled [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : neurotensin receptor 1 protein_id : NP_061236.1

name	1600027N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625965 CCDS:CCDS17178.1 GeneID:73247 MGI:1920497
definition	GO_component : GO:0043189 - H4/H2A histone acetyltransferase complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : MRG-binding protein protein_id : NP_082755.1

name	Ogfr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982604 CCDS:CCDS17179.1 GeneID:72075 MGI:1919325
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 exception : mismatches in translation product : opioid growth factor receptor protein_id : NP_113550.2

name	Col9a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363119 CCDS:CCDS17180.1 GeneID:12841 MGI:894686
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type IX, alpha 3 protein_id : NP_034066.2

name	Tcfl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142703 CCDS:CCDS17181.1 GeneID:277353 MGI:2672878
definition	GO_component : GO:0001673 - male germ cell nucleus [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045595 - regulation of cell differentiation [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : factor in the germline beta; FIG beta product : transcription factor-like 5 protein protein_id : NP_839985.1

name	Dido1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76096375 CCDS:CCDS17182.1 GeneID:23856 MGI:1344352
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; death inducer-obliterator-2; death inducer-obliterator-3 product : death inducer-obliterator 1 isoform 3 protein_id : NP_780760.2

name	Dido1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51571541 CCDS:CCDS17183.1 GeneID:23856 MGI:1344352
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; death inducer-obliterator-2; death inducer-obliterator-3 product : death inducer-obliterator 1 isoform 2 protein_id : NP_808520.2

name	Dido1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556456 CCDS:CCDS17184.1 GeneID:23856 MGI:1344352
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; death inducer-obliterator-2; death inducer-obliterator-3 product : death inducer-obliterator 1 isoform 1 protein_id : NP_035935.2

name	2310003C23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037443 CCDS:CCDS17185.1 GeneID:76425 MGI:1923675
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : RIKEN cDNA 2310003C23 protein_id : NP_083883.1

name	1700019H03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347351 GeneID:228993 MGI:1919107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC228993 protein_id : NP_898984.3

name	Bhlhb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542226 CCDS:CCDS17187.1 GeneID:140489 MGI:2153710
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0046671 - negative regulation of retinal programmed cell death [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0048050 - post-embryonic eye morphogenesis [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : beta-cell E-box transactivating factor 4 product : basic helix-loop-helix domain containing, class B4 protein_id : NP_542372.2

name	OTTMUSG00000016394 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250518 GeneID:676369 MGI:3650817
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480311.1

name	Ythdf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424609 CCDS:CCDS17188.1 GeneID:228994 MGI:1917431
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : YTH domain family 1 protein_id : NP_776122.1

name	Birc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250520 GeneID:329581 MGI:2676458
definition	codon_start : 1 product : similar to baculoviral IAP repeat-containing 7 (livin) protein_id : XP_283820.5

name	C030019F02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981145 CCDS:CCDS17189.1 GeneID:58237 MGI:1915372
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC58237 protein_id : NP_067401.2

name	LOC100039607 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250504 GeneID:100039607
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473234.1

name	Arfgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542139 CCDS:CCDS17190.1 GeneID:228998 MGI:2183559
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ARF1 GAP; ADP-ribosylation factor 1 GTPase activating protein product : ADP-ribosylation factor GTPase activating protein 1 protein_id : NP_665703.2

name	Col20a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250506 GeneID:73368 MGI:1920618
definition	codon_start : 1 product : collagen, type XX, alpha 1 protein_id : XP_001473258.1

name	Chrna4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542393 CCDS:CCDS17192.1 GeneID:11438 MGI:87888
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IDA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004889 - nicotinic acetylcholine-activated cation-selective channel activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007610 - behavior [Evidence IMP]; GO:0007600 - sensory perception [Evidence IMP] [Evidence TAS]; GO:0007271 - synaptic transmission, cholinergic [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acetylcholine receptor, neuronal, nicotinic, alpha-4 subunit; acetylcholine receptor alpha 4 neural; alpha4 nAChR; a4 nicotinic receptor product : cholinergic receptor, nicotinic, alpha 4 subunit protein_id : NP_056545.3

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873644 CCDS:CCDS17195.1 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : potassium voltage-gated channel KQT-like protein 2 isoform 4 protein_id : NP_001006669.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873646 CCDS:CCDS17196.1 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5 product : potassium voltage-gated channel KQT-like protein 2 isoform 5 protein_id : NP_001006670.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873641 CCDS:CCDS17193.1 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : potassium voltage-gated channel KQT-like protein 2 isoform 2 protein_id : NP_001003824.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51474502 CCDS:CCDS17194.1 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : potassium voltage-gated channel KQT-like protein 2 isoform 3 protein_id : NP_001003825.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873648 CCDS:CCDS17197.1 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 6 is encoded by transcript variant 6 product : potassium voltage-gated channel KQT-like protein 2 isoform 6 protein_id : NP_001006675.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873639 CCDS:CCDS17198.1 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : potassium voltage-gated channel KQT-like protein 2 isoform 1 protein_id : NP_034741.2

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873650 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 7 is encoded by transcript variant 7 product : potassium voltage-gated channel KQT-like protein 2 isoform 7 protein_id : NP_001006676.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873654 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 9 is encoded by transcript variant 9 product : potassium voltage-gated channel KQT-like protein 2 isoform 9 protein_id : NP_001006678.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873652 CCDS:CCDS17199.1 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 8 is encoded by transcript variant 8 product : potassium voltage-gated channel KQT-like protein 2 isoform 8 protein_id : NP_001006677.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873656 CCDS:CCDS17200.1 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 10 is encoded by transcript variant 10 product : potassium voltage-gated channel KQT-like protein 2 isoform 10 protein_id : NP_001006679.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873658 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 11 is encoded by transcript variant 11 product : potassium voltage-gated channel KQT-like protein 2 isoform 11 protein_id : NP_001006680.1

name	Kcnq2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873660 GeneID:16536 MGI:1309503
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 12 is encoded by transcript variant 12 product : potassium voltage-gated channel KQT-like protein 2 isoform 12 protein_id : NP_001006681.1

name	Eef1a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681273 CCDS:CCDS17201.1 GeneID:13628 MGI:1096317
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005853 - eukaryotic translation elongation factor 1 complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IDA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0006414 - translational elongation [Evidence IDA] codon_start : 1 product : eukaryotic translation elongation factor 1 alpha 2 protein_id : NP_031932.1

name	2700038C09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313440 CCDS:CCDS17202.1 GeneID:66496 MGI:1913746
definition	codon_start : 1 product : hypothetical protein LOC66496 protein_id : NP_079874.1

name	Ptk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677971 CCDS:CCDS17203.1 GeneID:20459 MGI:99683
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : src-related intestinal kinase; tyrosine kinase identified from skin; protein tyrosine kinase 6 product : PTK6 protein tyrosine kinase 6 protein_id : NP_033210.1

name	Srms (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54287682 CCDS:CCDS17204.1 GeneID:20811 MGI:101865
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites protein_id : NP_035611.3

name	BC051628 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556294 CCDS:CCDS17205.1 GeneID:332713 MGI:3051572
definition	codon_start : 1 product : hypothetical protein LOC332713 protein_id : NP_955016.1

name	BC006779 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347767 GeneID:229003 MGI:2385169
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC229003 protein_id : NP_898985.2

name	Gmeb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718989 CCDS:CCDS17206.1 GeneID:229004 MGI:2652836
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : glucocorticoid modulatory element binding protein 2 protein_id : NP_937812.1

name	EG665467 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94367776 GeneID:665467 MGI:3646877
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982228.1

name	Stmn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677873 CCDS:CCDS17207.1 GeneID:20262 MGI:1277137
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : Scgn10 like-protein product : stathmin-like 3 protein_id : NP_033159.1

name	Rtel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50233926 CCDS:CCDS17208.1 GeneID:269400 MGI:2139369
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004003 - ATP-dependent DNA helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016818 - hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA]; GO:0000723 - telomere maintenance [Evidence IMP] codon_start : 1 exception : mismatches in translation note : regulator of telomere length; DEAH helicase product : regulator of telomere elongation helicase 1 protein_id : NP_001001882.2

name	Arfrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542141 CCDS:CCDS17209.1 GeneID:76688 MGI:1923938
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007369 - gastrulation [Evidence IMP]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ADP-ribosylation factor related protein 1 protein_id : NP_083978.2

name	Zgpat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326528 GeneID:229007 MGI:2449939
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, CCCH-type with G patch domain protein_id : NP_001041613.1

name	Zgpat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450275 CCDS:CCDS17210.1 GeneID:229007 MGI:2449939
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, CCCH-type with G patch domain protein_id : NP_659143.1

name	Lime1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963783 CCDS:CCDS17211.1 GeneID:72699 MGI:1919949
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : Lck interacting transmembrane adaptor 1 protein_id : NP_076173.1

name	Btbd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312398 CCDS:CCDS17212.1 GeneID:72147 MGI:1919397
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : BTB (POZ) domain containing 4 protein_id : NP_082401.1

name	BC050777 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147236 CCDS:CCDS17213.1 GeneID:241850 MGI:3607711
definition	codon_start : 1 product : hypothetical protein LOC241850 protein_id : NP_899004.1

name	Tpd52l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560247 CCDS:CCDS17214.1 GeneID:66314 MGI:1913564
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] codon_start : 1 product : tumor protein D52-like 2 protein_id : NP_079758.2

name	Dnajc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949027 CCDS:CCDS17215.1 GeneID:13002 MGI:892995
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : cysteine string protein product : DnaJ (Hsp40) homolog, subfamily C, member 5 protein_id : NP_058055.1

name	Uckl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541796 CCDS:CCDS17216.1 GeneID:68556 MGI:1915806
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004849 - uridine kinase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 note : uridine kinase-like 1 product : uridine-cytidine kinase 1-like 1 protein_id : NP_081041.2

name	Znf512b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250508 GeneID:269401 MGI:2685478
definition	codon_start : 1 product : similar to mKIAA1196 protein protein_id : XP_982556.2

name	Samd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328389 CCDS:CCDS17217.1 GeneID:229011 MGI:2443872
definition	codon_start : 1 product : sterile alpha motif domain containing 10 protein_id : NP_766264.2

name	Prpf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539655 GeneID:68879 MGI:1922946
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0050681 - androgen receptor binding [Evidence ISS]; GO:0005488 - binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : U5 snRNP-associated 102 kDa protein protein_id : NP_598462.1

name	LOC100039697 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250510 GeneID:100039697
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473402.1

name	Sox18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244106 CCDS:CCDS17218.1 GeneID:20672 MGI:103559
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : ragged; ragged-like; Sry-related HMG-box product : SRY-box containing gene 18 protein_id : NP_033262.2

name	Tcea2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678235 CCDS:CCDS17219.1 GeneID:21400 MGI:107368
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : transcription elongation factor A protein 2 protein_id : NP_033352.1

name	Rgs19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385944 CCDS:CCDS17220.1 GeneID:56470 MGI:1915153
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 note : G-alpha interacting protein product : regulator of G-protein signaling 19 protein_id : NP_080722.1

name	4930526D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841045 CCDS:CCDS17221.1 GeneID:277496 MGI:2685538
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC277496 protein_id : NP_950188.1

name	Oprl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754938 CCDS:CCDS17222.1 GeneID:18389 MGI:97440
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : nociceptin/ orphaninFQ receptor; opioid receptor-like; N/OFQ receptor product : opioid receptor-like 1 protein_id : NP_035142.1

name	Myt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346429 CCDS:CCDS17223.1 GeneID:17932 MGI:1100535
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : neural zinc finger protein NZF-2b; neural zinc finger transcription factor 2 product : myelin transcription factor 1 protein_id : NP_032691.2

name	Pcmtd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956398 CCDS:CCDS17224.1 GeneID:245867 MGI:1923927
definition	codon_start : 1 product : protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 protein_id : NP_705822.1

name	Polr3k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385394 CCDS:CCDS17225.1 GeneID:67005 MGI:1914255
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006354 - RNA elongation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : polymerase (RNA) III (DNA directed) polypeptide K protein_id : NP_080177.1

name	LOC672125 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250512 GeneID:672125
definition	codon_start : 1 product : similar to novel vomeronasal 2 receptor protein_id : XP_001473556.1

name	LOC100039470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039470
definition	number : 2 pseudo : _no_value

name	LOC100039470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039470
definition	number : 1 pseudo : _no_value

name	LOC665538 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665538
definition	number : 3 pseudo : _no_value

name	LOC665538 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665538
definition	number : 2 pseudo : _no_value

name	LOC665538 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665538
definition	number : 1 pseudo : _no_value

name	LOC622592 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250521 GeneID:622592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 177 ESTs product : hypothetical LOC622592 pseudo : _no_value transcript_id : XR_034640.1

clone name	MSMg01-471M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108G04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-105I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244J12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-116F19.b	B6Ng01-116F19.g
ACC	DH921379	DH921380
length	878	883
definition	DH921379\|Mus musculus domesticus DNA, BAC clone: B6Ng01-116F19, 5' end.	DH921380\|Mus musculus domesticus DNA, BAC clone: B6Ng01-116F19, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaagtctttgtgctagcatggcaagcacttcaccaactgaactat ttccccagccccaaatgggagcaccattaaggttgtgcccatgtagatag aggccagcatggaaggtggcaggctctctaattcaacagtgttcaggtaa atcttgtgtgtagcctaagggcagagagttcaccacacaacagcactcaa aaatatcagagcagtatccctgagtgcggtttgtacccatgagagtgttt tgggggtgggttgagtactgatcattctcaagtactaattcttaaaactg gaaataaggacctgggctgagatatactgtgagtggccactcagagctca aacctagaactgataggagctgttttgtttttgttaatggttggttttgc ttctcttccccctttcagaaaaaaaagtaaacttttattttgtagtaaca tttcagaaaagttgcatattgtacaccacagagaatttcttgtgtgacct ctcaaggttccaagtttctctaaggtcatctgccatttccacacgccttt gggagcaccaggaagcccgggttggcacagctctccactgacttgagact ttctttggatattcccacccagtctccaatatcctcctctaccctcagtc ccctccatggcaccagccaccagcatgcctagagatgtcacagctcacgt ttgtgaaggctgagacaacttctcaggcttcctttgtttcctgtgagctt caattttaaggcttgctggccaggcattgagcagacagtactgcacgtag gatctatggggtggactttctaatcattaaggtaaggagttttaggaaag aatctcaaggacctgaggtgccctcttg	gaattcttattgattcattttccttctgtctcccacagacctgtctgatg tttaagaccaggtgatgagtcacccaccctgagttttttttgttttgttt gagacagggtttctctgtgtagccctggctgtcttggaactcccttggta ggccagactgtcctcgaactcagaaatttgcctgcctctgcctcccaagt gctgggattaaaggtgtgcgccaccacttcccggccctgagatttctttt attctttaagtgtaaggttttttttttttttaagatttatttattttata tatgtgagcatgctgtcactctcttcagacacaccaggagaggccattgg atcctattacagatgtatatgagccaccatgtggttgctggagatgaact cagtacccctggaagagcatcagtgctcttaatcactgagccatcgctcc gggcaaattaaaaaaaattttttttgtgtgtattcttggagaaatacatg actctcatgaaatcagggagccctgctcatccctcacatggccagtttag gtcgtggtatgtgagggtgtttctaaacactcatgcaaggccaaggccca gggaagagtggttcagacaacttctctttcctctcccaggttgtgtcagg tggggatgagaacaaatgaaggcagctcaggatgttcagggcagcagcag atgatgatgtcctaaaagaccagaagtctaggcagacacagaaaagtcct gcgagaacacagtgcccatgctcacacaacccagctggacactgtgcctg gaggctttcacacacgctgtgagggacttctttcacagcagaccctgtaa tgagagtttgggttatcatttagttggagatga
quality values	Open. Hide. 61 41 38 38 61 27 32 47 47 61 61 61 61 61 47 47 47 61 61 49 61 55 61 49 61 13 11 9 8 11 11 13 12 13 13 16 23 52 59 59 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 52 36 49 32 30 28 25 35 52 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 52 61 59 61 59 59 61 61 61 59 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 59 52 55 37 59 45 59 61 61 59 61 52 59 61 59 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 44 59 59 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 61 59 61 59 59 59 59 59 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 59 59 59 59 52 28 28 28 35 49 49 61 61 59 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 61 59 59 59 59 43 61 61 61 61 61 61 59 59 59 59 59 59 61 61 59 59 59 59 52 59 59 52 52 52 38 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 59 59 59 55 52 52 52 55 55 61 43 49 43 41 37 43 61 61 61 55 55 55 52 55 52 61 61 61 52 61 55 61 61 61 61 55 55 55 61 61 55 55 52 49 55 52 52 37 52 61 55 55 61 61 61 55 61 55 55 55 47 55 41 38 55 61 61 50 55 55 55 55 61 55 55 61 55 61 55 61 50 50 43 50 55 55 61 50 61 55 61 61 61 47 61 61 61 61 55 43 61 55 61 55 61 50 55 61 61 52 61 61 43 52 47 47 50 50 50 50 50 47 36 39 43 50 47 37 43 43 43 61 50 50 31 31 25 19 29 27 45 50 42 45 50 50 45 45 40 53 28 39 45 39 33 38 50 50 47 39 43 61 53 42 50 47 47 43 35 31 33 32 33 33 30 20 31 35 45 50 31 33 33 38 34 47 45 45 50 40 53 45 50 53 53 50 34 47 42 45 43 45 53 53 47 42 53 45 53 53 27 47 30 50 53 53 29 39 38 32 38 42 53 18 23 8 8 12 10 53 47 57 53 50 31 17 57 53 35 8 46 36 32 23 18 28 19 28 35 28 38 47 50 24 30 32 39 53 45 34 42 53 53 53 17 38 23 47 40 28 24 12 10 18 20 13 37 37 22 29 57 28 28 24 27 28 12 37 24 30 33 38 38 38 37 45 29 27 33 16 16 16 27 14 36 30 21 38 32 34 20 53 50 57 20 19 33 18 10 23 32 30 17 9 13 23 18 8 5 9 12 10 11 29 25 12 26 17 9 13 11 9 10 24 47 30 31 17 10 37 24 33 13 9 7 17 27 32 22 8 11 19 20 17 9 20 14 20 25 19 38 20 20 9 33 21 28 15 11 13 16	Open. Hide. 55 47 59 59 43 18 13 12 12 12 22 12 12 11 13 30 28 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 59 49 28 28 28 28 24 55 59 59 59 59 61 61 61 59 59 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 59 61 61 61 61 61 61 43 61 59 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 59 61 61 61 61 61 59 59 61 61 61 61 61 52 49 52 44 59 52 59 59 52 61 61 61 61 61 61 61 59 59 59 59 59 52 59 59 52 59 59 59 49 37 52 59 52 52 59 52 59 41 59 59 49 49 49 35 49 59 52 45 59 59 52 59 52 61 59 59 52 52 59 44 35 43 59 59 59 59 61 61 61 59 59 59 59 59 59 59 61 59 59 59 52 49 59 59 59 59 52 61 61 59 59 61 49 59 59 49 59 59 49 52 59 23 31 29 19 27 35 32 37 45 49 36 30 59 37 49 61 59 61 61 61 59 52 59 59 61 61 61 61 61 59 59 44 43 31 59 41 49 41 52 45 43 43 59 59 59 59 61 61 61 59 59 49 49 45 49 45 59 59 31 41 52 36 52 45 49 36 59 52 59 41 59 59 49 52 52 59 59 59 59 59 59 59 61 61 61 59 59 61 61 61 59 59 59 52 59 52 59 52 59 59 43 59 59 59 59 59 59 59 61 52 61 59 59 59 59 59 52 55 52 52 39 49 49 49 39 41 52 55 55 49 49 52 49 39 31 55 43 52 43 43 52 49 49 52 41 52 52 36 49 37 43 39 41 49 52 55 49 55 61 55 55 28 17 22 14 22 19 50 34 49 37 30 13 22 55 41 26 41 30 50 26 31 29 15 49 19 14 15 5 11 14 49 43 38 47 37 37 29 35 37 35 27 37 49 38 27 38 43 55 27 38 24 43 18 36 19 26 29 31 24 35 43 30 36 21 50 14 50 47 36 32 43 31 31 21 47 33 22 29 35 50 31 36 37 36 47 33 43 27 28 27 22 35 28 27 30 31 23 37 24 35 32 9 20 27 50 39 33 35 14 32 27 24 33 27 24 43 43 14 34 31 27 8 19 16 33 38 43 45 16 47 24 28 18 24 29 28 18 8 23 16 6 11 6 8 7 10 8 35 20 20 11 8 19 13 16 26 28 9 12 33 24 24 13 12 17 14 24 28 19 22 16 8 19 24 12 6 29 24 20 16 8 47 23 17 23 24 34 26 19 34 21 30 18 43 16 30 38 29 25 36 31 18 28 22 17 18 16 16 28 12 17 52 15 22 13 10 14 14 28 22 15 34 6 23 18 23 24 39 36 27 32 27 34 20 32 12 21 28 12 16 17 9 14 13 10 17 28 17 16 23 16 15 16 12 12 17 14 24 11 12 6 19 14 10 14 18 19 14 20 17 23 7 26 8 27 20 30 32 31 20 16 36 23 13 9 24 21 14 11 12 8 16 12 21 10 12 21 21 7 15 10 24 10 17 12 6 16 20 24 17 21 19 35 7 16 19 10 19 18 21 5 13 13 17 15 20 12 17 20 9 7 19 31 31 23 38 6 14 16 10 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_181079509_181080393
seq2: B6Ng01-116F19.g_69_951

seq1  GAATTCTTATTGATTCATTTTCCTTCTGTCTCCCACAGACCTGTCTGATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTATTGATTCATTTTCCTTCTGTCTCCCACAGACCTGTCTGATG  50

seq1  TTTAAGACCAGGTGATGAGTCACCCACCCTGAGTTTTTTTTGTTTTGTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAGACCAGGTGATGAGTCACCCACCCTGAGTTTTTTTTGTTTTGTTT  100

seq1  GAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCTTGGAACTCCCTTGGTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCTTGGAACTCCCTTGGTA  150

seq1  GGCCAGACTGTCCTCGAACTCAGAAATTTGCCTGCCTCTGCCTCCCAAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAGACTGTCCTCGAACTCAGAAATTTGCCTGCCTCTGCCTCCCAAGT  200

seq1  GCTGGGATTAAAGGTGTGCGCCACCACTTCCCGGCCCTGAGATTTCTTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGGATTAAAGGTGTGCGCCACCACTTCCCGGCCCTGAGATTTCTTTT  250

seq1  ATTCTTTAAGTGTAAGGTTTTTTTTTTTTTTAAGATTTATTTATTTTATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTTTAAGTGTAAGGTTTTTTTTTTTTTTAAGATTTATTTATTTTATA  300

seq1  TATGTGAGCATGCTGTCACTCTCTTCAGACACACCAGGAGAGGCCATTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTGAGCATGCTGTCACTCTCTTCAGACACACCAGGAGAGGCCATTGG  350

seq1  ATCCTATTACAGATGTATATGAGCCACCATGTGGTTGCTGGAGATGAACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTATTACAGATGTATATGAGCCACCATGTGGTTGCTGGAGATGAACT  400

seq1  CAGTACCCCTGGAAGAGCATCAGTGCTCTTAATCACTGAGCCATCGCTCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTACCCCTGGAAGAGCATCAGTGCTCTTAATCACTGAGCCATCGCTCC  450

seq1  GGGCAAATTAAAAAAAATTTTTTTTGTGTGTATTCTTGGAGAAATACATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAAATTAAAAAAAATTTTTTTTGTGTGTATTCTTGGAGAAATACATG  500

seq1  ACTCTCATGAAATCAGGGAGCCCTGCTCATCCCTCACATGGCCAGTTTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTCATGAAATCAGGGAGCCCTGCTCATCCCTCACATGGCCAGTTTAG  550

seq1  GTCGTGGTATGTGAGGGTGTTTCTAAACACTCATGCAAGGCCAAGGCCCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCGTGGTATGTGAGGGTGTTTCTAAACACTCATGCAAGGCCAAGGCCCA  600

seq1  GGGAAGAGTGGTTCAGACAACTTCTCTTTCCTCTCCCAGGTTGTGTCAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAGAGTGGTTCAGACAACTTCTCTTTCCTCTCCCAGGTTGTGTCAGG  650

seq1  TGGGGATGAGAAC-AATGAAGGCAGCTCAGGAGGTTCAGGGCAGCAGCAG  699
      ||||||||||||| |||||||||||||||||| |||||||||||||||||
seq2  TGGGGATGAGAACAAATGAAGGCAGCTCAGGATGTTCAGGGCAGCAGCAG  700

seq1  ATGATGATGTCCTAAAAGACCAGAAGTCTAGGCAGACACAGAAAAGTCCT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATGATGTCCTAAAAGACCAGAAGTCTAGGCAGACACAGAAAAGTCCT  750

seq1  GCGAGAACACAGTG-CCATGCTCACACAACCCAGCTGGAACACAGTGCCT  798
      |||||||||||||| ||||||||||||||||||||||| |||| ||||||
seq2  GCGAGAACACAGTGCCCATGCTCACACAACCCAGCTGG-ACACTGTGCCT  799

seq1  GGAGGCTTTCACACACGCTGTGAGGGACTTCTATCACAGCAGAACCCTGG  848
      |||||||||||||||||||||||||||||||| ||||||||| |||||| 
seq2  GGAGGCTTTCACACACGCTGTGAGGGACTTCTTTCACAGCAG-ACCCTGT  848

seq1  AATGAGAGTTTGGGGTTATCAGTTTAGTTGGAGATGA  885
      ||||||||||| ||||||||| |||||||||||||||
seq2  AATGAGAGTTT-GGGTTATCA-TTTAGTTGGAGATGA  883

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information