MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-119C24
Chromosome	2 (Build37)
Map Location	36,696,516 - 36,697,717
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Ttll11, Ndufa8, 1700010A17Rik, Lhx6, Rbm18, LOC100042236, Mrrf, LOC100040493, Ptgs1, Olfr334-ps1, Olfr335, Olfr336-ps1, Olfr337-ps1, Olfr338, LOC675440, Olfr339, Olfr340, Olfr341, Olfr342, Olfr343-ps1, Olfr344, Olfr345, Olfr346, Olfr347, Olfr348, Olfr50, Rpl18p, Olfr3
Downstream gene	Olfr349-ps1, Olfr350, Olfr351, Olfr352, Olfr353, Olfr354, Olfr355, Olfr356, Olfr357, Olfr358, Olfr359-ps1, Olfr360, Olfr361, Olfr362, Olfr364-ps1, Olfr365, Olfr366, Olfr367, Olfr368, Pdcl, Rc3h2, Zbtb6, Zbtb26, Rabgap1, Gpr21, 6430510M02Rik, Strbp, LOC639491, Dennd1a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ttll11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74410 MGI:1921660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68375 MGI:1915625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700010A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75495 MGI:1922745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lhx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16874 MGI:1306803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Rbm18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67889 MGI:1915139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042236 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Mrrf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67871 MGI:1915121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ptgs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19224 MGI:97797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr334-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257991 MGI:3030168
definition	gene_synonym : MOR137-1P note : olfactory receptor 334, pseudogene 1 pseudo : _no_value

name	Olfr335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666118 MGI:3030169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr336-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258093 MGI:3030170
definition	gene_synonym : MOR136-15P note : olfactory receptor 336, pseudogene 1 pseudo : _no_value

name	Olfr337-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258092 MGI:3030171
definition	gene_synonym : MOR136-16P note : olfactory receptor 337, pseudogene 1 pseudo : _no_value

name	Olfr338 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258949 MGI:3030172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 656 ESTs, 7 Proteins

name	Olfr339 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258951 MGI:3030173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr340 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258953 MGI:3030174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258952 MGI:3030175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr342 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258950 MGI:3030176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr343-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404379 MGI:3030177
definition	note : olfactory receptor 343, pseudogene 1 pseudo : _no_value

name	Olfr344 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258621 MGI:3030178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr345 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258947 MGI:3030179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258940 MGI:3030180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258945 MGI:3030181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr348 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258946 MGI:3030182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18350 MGI:1333746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl18p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624088
definition	note : similar to 60S ribosomal protein L18 pseudo : _no_value

name	Olfr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18328 MGI:102697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr349-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257999 MGI:3030183
definition	gene_synonym : MOR136-17P note : olfactory receptor 349, pseudogene 1 pseudo : _no_value

name	Olfr350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258620 MGI:3030184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr351 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258944 MGI:3030185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258942 MGI:3030186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258943 MGI:3030187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr354 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258941 MGI:3030188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr355 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258618 MGI:3030189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr356 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258617 MGI:3030190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr357 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258616 MGI:3030191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr358 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227789 MGI:3030192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr359-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258091 MGI:3030193
definition	gene_synonym : MOR159-2P note : olfactory receptor 359, pseudogene 1 pseudo : _no_value

name	Olfr360 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258615 MGI:3030194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258365 MGI:3030195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr362 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259053 MGI:3030196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr364-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227794 MGI:3030198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2100 Proteins pseudo : _no_value

name	Olfr365 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258656 MGI:3030199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr366 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236509 MGI:3030200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr367 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545417 MGI:3030201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr368 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258371 MGI:3030202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67466 MGI:1914716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rc3h2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319817 MGI:2442789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 133 ESTs, 7 Proteins

name	Zbtb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241322 MGI:2442998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320633 MGI:2444402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gpr21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338346 MGI:2441890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430510M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319517 MGI:2442183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Strbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20744 MGI:104626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC639491 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639491
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Dennd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227801 MGI:2442794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625990 GeneID:74410 MGI:1921660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 11 transcript_id : NM_028921.1

name	Ndufa8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893199 GeneID:68375 MGI:1915625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 transcript_id : NM_026703.2

name	1700010A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130578 GeneID:75495 MGI:1922745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700010A17 gene transcript_id : NM_029309.2

name	Lhx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893072 GeneID:16874 MGI:1306803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 6 transcript_id : NM_001083125.1

name	Lhx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891793 GeneID:16874 MGI:1306803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 6 transcript_id : NM_008500.2

name	Lhx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892050 GeneID:16874 MGI:1306803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 6 transcript_id : NM_001083127.1

name	Lhx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892445 GeneID:16874 MGI:1306803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 6 transcript_id : NM_001083126.1

name	Rbm18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377962 GeneID:67889 MGI:1915139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 18 transcript_id : NM_026434.3

name	LOC100042236 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249296 GeneID:100042236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100042236 transcript_id : XM_001479253.1

name	Mrrf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312751 GeneID:67871 MGI:1915121
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosome recycling factor transcript_id : NM_026422.1

name	LOC100040493 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249255 GeneID:100040493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040493 transcript_id : XM_001474797.1

name	Ptgs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227245 GeneID:19224 MGI:97797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin-endoperoxide synthase 1 transcript_id : NM_008969.3

name	Olfr335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487172 GeneID:666118 MGI:3030169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 335 transcript_id : NM_001081410.1

name	Olfr338 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129020 GeneID:258949 MGI:3030172
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 338 transcript_id : NM_146947.1

name	LOC675440 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249298 GeneID:675440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 656 ESTs, 6 Proteins product : similar to SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae), transcript variant 1 transcript_id : XM_001479274.1

name	LOC675440 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249300 GeneID:675440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 350 ESTs, 2 Proteins product : similar to SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae), transcript variant 2 transcript_id : XM_001479282.1

name	Olfr339 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129016 GeneID:258951 MGI:3030173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 339 transcript_id : NM_146949.1

name	Olfr340 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129018 GeneID:258953 MGI:3030174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 340 transcript_id : NM_146951.1

name	Olfr341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203812 GeneID:258952 MGI:3030175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 341 transcript_id : NM_146950.1

name	Olfr342 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129022 GeneID:258950 MGI:3030176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 342 transcript_id : NM_146948.1

name	Olfr344 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239293 GeneID:258621 MGI:3030178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 344 transcript_id : NM_146628.1

name	Olfr345 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239289 GeneID:258947 MGI:3030179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 345 transcript_id : NM_146945.1

name	Olfr346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129032 GeneID:258940 MGI:3030180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 346 transcript_id : NM_146938.1

name	Olfr347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129026 GeneID:258945 MGI:3030181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 347 transcript_id : NM_146943.1

name	Olfr348 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239291 GeneID:258946 MGI:3030182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 348 transcript_id : NM_146944.1

name	Olfr50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170059 GeneID:18350 MGI:1333746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 50 transcript_id : NM_146946.1

name	Olfr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170067 GeneID:18328 MGI:102697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 3 transcript_id : NM_206903.1

name	Olfr350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239295 GeneID:258620 MGI:3030184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 350 transcript_id : NM_146627.1

name	Olfr351 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129024 GeneID:258944 MGI:3030185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 351 transcript_id : NM_146942.1

name	Olfr352 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129028 GeneID:258942 MGI:3030186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 352 transcript_id : NM_146940.1

name	Olfr353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129030 GeneID:258943 MGI:3030187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 353 transcript_id : NM_146941.1

name	Olfr354 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129034 GeneID:258941 MGI:3030188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 354 transcript_id : NM_146939.1

name	Olfr355 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239287 GeneID:258618 MGI:3030189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 355 transcript_id : NM_146625.1

name	Olfr356 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239307 GeneID:258617 MGI:3030190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 356 transcript_id : NM_146624.1

name	Olfr357 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239281 GeneID:258616 MGI:3030191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 357 transcript_id : NM_146623.1

name	Olfr358 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402224 GeneID:227789 MGI:3030192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 358 transcript_id : NM_207235.1

name	Olfr360 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239255 GeneID:258615 MGI:3030194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 360 transcript_id : NM_146622.1

name	Olfr361 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129562 GeneID:258365 MGI:3030195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 361 transcript_id : NM_146368.1

name	Olfr362 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128848 GeneID:259053 MGI:3030196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 362 transcript_id : NM_147051.1

name	Olfr365 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239285 GeneID:258656 MGI:3030199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 365 transcript_id : NM_146662.1

name	Olfr366 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53933205 GeneID:236509 MGI:3030200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 366 transcript_id : NM_001005569.1

name	Olfr367 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486589 GeneID:545417 MGI:3030201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 367 transcript_id : NM_001081010.1

name	Olfr368 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129556 GeneID:258371 MGI:3030202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 368 transcript_id : NM_146374.1

name	Pdcl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475676 GeneID:67466 MGI:1914716
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosducin-like transcript_id : NM_026176.2

name	Rc3h2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249302 GeneID:319817 MGI:2442789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 132 ESTs, 7 Proteins product : ring finger and CCCH-type zinc finger domains 2, transcript variant 1 transcript_id : XM_130233.8

name	Zbtb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375919 GeneID:241322 MGI:2442998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 6 transcript_id : NM_146253.4

name	Zbtb26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037368 GeneID:320633 MGI:2444402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 26 transcript_id : NM_199025.2

name	Rabgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76880488 GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB GTPase activating protein 1 transcript_id : NM_146121.2

name	Rabgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76880497 GeneID:227800 MGI:2385139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB GTPase activating protein 1 transcript_id : NM_001033960.1

name	Gpr21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387873 GeneID:338346 MGI:2441890
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 21 transcript_id : NM_177383.3

name	6430510M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342413 GeneID:319517 MGI:2442183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430510M02 gene transcript_id : NM_176932.2

name	Strbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842376 GeneID:20744 MGI:104626
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatid perinuclear RNA binding protein transcript_id : NM_009261.2

name	Dennd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542026 GeneID:227801 MGI:2442794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DENN/MADD domain containing 1A transcript_id : NM_146122.2

name	Ttll11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625991 GeneID:74410 MGI:1921660
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : polyglutamylase product : tubulin tyrosine ligase-like family, member 11 protein_id : NP_083197.1

name	Ndufa8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312012 CCDS:CCDS15967.1 GeneID:68375 MGI:1915625
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 protein_id : NP_080979.1

name	1700010A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037413 CCDS:CCDS15968.1 GeneID:75495 MGI:1922745
definition	codon_start : 1 note : novel protein containing MORN domains product : hypothetical protein LOC75495 protein_id : NP_083585.1

name	Lhx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133893073 GeneID:16874 MGI:1306803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; LIM-homeodomain protein 6.1 product : LIM homeobox protein 6 isoform 2 protein_id : NP_001076594.1

name	Lhx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892051 GeneID:16874 MGI:1306803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; LIM-homeodomain protein 6.1 product : LIM homeobox protein 6 isoform 4 protein_id : NP_001076596.1

name	Lhx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133891794 GeneID:16874 MGI:1306803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; LIM-homeodomain protein 6.1 product : LIM homeobox protein 6 isoform 1 protein_id : NP_032526.2

name	Lhx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892446 GeneID:16874 MGI:1306803
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; LIM-homeodomain protein 6.1 product : LIM homeobox protein 6 isoform 3 protein_id : NP_001076595.1

name	Rbm18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385930 CCDS:CCDS15969.1 GeneID:67889 MGI:1915139
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 18 protein_id : NP_080710.1

name	LOC100042236 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249297 GeneID:100042236
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479303.1

name	Mrrf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312752 GeneID:67871 MGI:1915121
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] codon_start : 1 product : mitochondrial ribosome recycling factor protein_id : NP_080698.1

name	LOC100040493 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249256 GeneID:100040493
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474847.1

name	Ptgs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679537 CCDS:CCDS15970.1 GeneID:19224 MGI:97797
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA]; GO:0004666 - prostaglandin-endoperoxide synthase activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence NAS]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IMP] codon_start : 1 note : cyclooxygenase 1 product : prostaglandin-endoperoxide synthase 1 protein_id : NP_032995.1

name	Olfr335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487173 GeneID:666118 MGI:3030169
definition	codon_start : 1 note : GA_x6K02T2NLDC-33001193-33002131; olfactory receptor W1UHSO2293FU.01 product : olfactory receptor 335 protein_id : NP_001074879.1

name	Olfr338 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129021 CCDS:CCDS15971.1 GeneID:258949 MGI:3030172
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33070879-33071799; olfactory receptor MOR136-5 product : olfactory receptor 338 protein_id : NP_667158.1

name	LOC675440 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249299 GeneID:675440
definition	codon_start : 1 product : similar to SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) isoform 1 protein_id : XP_001479324.1

name	LOC675440 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249301 GeneID:675440
definition	codon_start : 1 product : similar to SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) isoform 2 protein_id : XP_001479332.1

name	Olfr339 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129017 CCDS:CCDS15972.1 GeneID:258951 MGI:3030173
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33116096-33117025; olfactory receptor MOR136-3 product : olfactory receptor 339 protein_id : NP_667160.1

name	Olfr340 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129019 CCDS:CCDS15973.1 GeneID:258953 MGI:3030174
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33147742-33148680; olfactory receptor MOR136-1 product : olfactory receptor 340 protein_id : NP_667162.1

name	Olfr341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203813 CCDS:CCDS15974.1 GeneID:258952 MGI:3030175
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33174915-33173974; olfactory receptor MOR136-2 product : olfactory receptor 341 protein_id : NP_667161.1

name	Olfr342 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129023 CCDS:CCDS15975.1 GeneID:258950 MGI:3030176
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33222024-33222962; olfactory receptor MOR136-4 product : olfactory receptor 342 protein_id : NP_667159.1

name	Olfr344 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239294 CCDS:CCDS15976.1 GeneID:258621 MGI:3030178
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33262744-33263673; olfactory receptor MOR136-12 product : olfactory receptor 344 protein_id : NP_666839.1

name	Olfr345 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239290 CCDS:CCDS15977.1 GeneID:258947 MGI:3030179
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33334179-33335114; olfactory receptor MOR136-7 product : olfactory receptor 345 protein_id : NP_667156.1

name	Olfr346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129033 CCDS:CCDS15978.1 GeneID:258940 MGI:3030180
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33382467-33383396; olfactory receptor MOR136-11 product : olfactory receptor 346 protein_id : NP_667149.1

name	Olfr347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129027 CCDS:CCDS15979.1 GeneID:258945 MGI:3030181
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33428755-33429693; olfactory receptor MOR136-9 product : olfactory receptor 347 protein_id : NP_667154.1

name	Olfr348 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239292 CCDS:CCDS15980.1 GeneID:258946 MGI:3030182
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33481050-33481991; olfactory receptor MOR136-8 product : olfactory receptor 348 protein_id : NP_667155.1

name	Olfr50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170060 CCDS:CCDS15981.1 GeneID:18350 MGI:1333746
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR136-6; GA_x6K02T2NLDC-33487752-33488690 product : olfactory receptor 50 protein_id : NP_667157.1

name	Olfr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170068 CCDS:CCDS15982.1 GeneID:18328 MGI:102697
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33507606-33506665; olfactory receptor MOR136-14 product : olfactory receptor 3 protein_id : NP_996786.1

name	Olfr350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239296 CCDS:CCDS15983.1 GeneID:258620 MGI:3030184
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33544602-33545540; olfactory receptor MOR136-13 product : olfactory receptor 350 protein_id : NP_666838.1

name	Olfr351 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129025 CCDS:CCDS15984.1 GeneID:258944 MGI:3030185
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33554926-33553994; olfactory receptor MOR127-2 product : olfactory receptor 351 protein_id : NP_667153.1

name	Olfr352 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129029 CCDS:CCDS15985.1 GeneID:258942 MGI:3030186
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33564136-33565083; olfactory receptor MOR136-10 product : olfactory receptor 352 protein_id : NP_667151.1

name	Olfr353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129031 CCDS:CCDS15986.1 GeneID:258943 MGI:3030187
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33585366-33584431; olfactory receptor MOR127-3 product : olfactory receptor 353 protein_id : NP_667152.1

name	Olfr354 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129035 CCDS:CCDS15987.1 GeneID:258941 MGI:3030188
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33601476-33602429; olfactory receptor MOR127-4 product : olfactory receptor 354 protein_id : NP_667150.1

name	Olfr355 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239288 CCDS:CCDS15988.1 GeneID:258618 MGI:3030189
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33622642-33621710; olfactory receptor MOR138-2 product : olfactory receptor 355 protein_id : NP_666836.1

name	Olfr356 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239308 CCDS:CCDS15989.1 GeneID:258617 MGI:3030190
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33631647-33632594; olfactory receptor MOR134-1 product : olfactory receptor 356 protein_id : NP_666835.1

name	Olfr357 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239282 CCDS:CCDS15990.1 GeneID:258616 MGI:3030191
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33688556-33689482; olfactory receptor MOR138-3 product : olfactory receptor 357 protein_id : NP_666834.1

name	Olfr358 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402225 CCDS:CCDS15991.1 GeneID:227789 MGI:3030192
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2NLDC-33697309-33696317 product : olfactory receptor 358 protein_id : NP_997118.1

name	Olfr360 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239256 CCDS:CCDS15992.1 GeneID:258615 MGI:3030194
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33760081-33761034; olfactory receptor MOR159-1 product : olfactory receptor 360 protein_id : NP_666833.1

name	Olfr361 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129563 CCDS:CCDS15993.1 GeneID:258365 MGI:3030195
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33777519-33776551; olfactory receptor MOR159-3 product : olfactory receptor 361 protein_id : NP_666480.1

name	Olfr362 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128849 CCDS:CCDS15994.1 GeneID:259053 MGI:3030196
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33797415-33796462; olfactory receptor MOR158-1 product : olfactory receptor 362 protein_id : NP_667262.1

name	Olfr365 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239286 CCDS:CCDS15995.1 GeneID:258656 MGI:3030199
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33885305-33886243; olfactory receptor MOR138-1 product : olfactory receptor 365 protein_id : NP_666873.1

name	Olfr366 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53933206 CCDS:CCDS15996.1 GeneID:236509 MGI:3030200
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33902472-33903401; olfactory receptor MOR138-5P product : olfactory receptor 366 protein_id : NP_001005569.1

name	Olfr367 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486590 GeneID:545417 MGI:3030201
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004984 - olfactory receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-33954853-33955794; olfactory receptor MOR128-1 product : olfactory receptor 367 protein_id : NP_001074479.1

name	Olfr368 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129557 CCDS:CCDS15997.1 GeneID:258371 MGI:3030202
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NLDC-34015743-34016726; olfactory receptor MOR178-1 product : olfactory receptor 368 protein_id : NP_666486.1

name	Pdcl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079230 CCDS:CCDS15998.1 GeneID:67466 MGI:1914716
definition	GO_process : GO:0050896 - response to stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosducin-like protein_id : NP_080452.1

name	Rc3h2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249303 GeneID:319817 MGI:2442789
definition	codon_start : 1 product : membrane-associated nucleic acid binding protein isoform 1 protein_id : XP_130233.7

name	Zbtb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122841 CCDS:CCDS16000.1 GeneID:241322 MGI:2442998
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 482 protein_id : NP_666365.1

name	Zbtb26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037369 CCDS:CCDS16001.1 GeneID:320633 MGI:2444402
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 483 protein_id : NP_950190.2

name	Rabgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76880489 CCDS:CCDS16002.1 GeneID:227800 MGI:2385139
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1; rab6 GTPase activating protein (GAP and centrosome-associated) product : RAB GTPase activating protein 1 isoform a protein_id : NP_666233.2

name	Rabgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76880498 CCDS:CCDS16003.1 GeneID:227800 MGI:2385139
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2; rab6 GTPase activating protein (GAP and centrosome-associated) product : RAB GTPase activating protein 1 isoform b protein_id : NP_001029132.1

name	Gpr21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893547 CCDS:CCDS16004.1 GeneID:338346 MGI:2441890
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR21 product : G protein-coupled receptor 21 protein_id : NP_796357.1

name	6430510M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892735 GeneID:319517 MGI:2442183
definition	codon_start : 1 product : hypothetical protein LOC319517 protein_id : NP_795906.1

name	Strbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842377 GeneID:20744 MGI:104626
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0003727 - single-stranded RNA binding [Evidence IDA] GO_process : GO:0006928 - cell motility [Evidence IMP]; GO:0007638 - mechanosensory behavior [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 product : spermatid perinuclear RNA-binding protein protein_id : NP_033287.2

name	Dennd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542027 CCDS:CCDS16007.1 GeneID:227801 MGI:2442794
definition	codon_start : 1 exception : mismatches in translation product : DENN/MADD domain containing 1A protein_id : NP_666234.2

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 1 pseudo : _no_value

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 2 pseudo : _no_value

name	Olfr364-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:227794
definition	number : 3 pseudo : _no_value

name	LOC639491 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639491
definition	number : 1 pseudo : _no_value

clone name	MSMg01-275N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308A13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-119C24.b	B6Ng01-119C24.g
ACC	DH923469	DH923470
length	1,161	1,182
definition	DH923469\|Mus musculus domesticus DNA, BAC clone: B6Ng01-119C24, 5' end.	DH923470\|Mus musculus domesticus DNA, BAC clone: B6Ng01-119C24, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaagacaacactgagat tccacttcactccagtcagaatggctaagatcaaaaactcaggtgacagc agatgctggcgaggatgtggagaaaggggaacacttctccattgttggtg ggattgcaagcttgtacaaccactctggaaatcagtctggcggttcctca gaaaattggacatagtagtaccggaggatcctgcaatacctctcctaggc atatatccagaagatgtcccaaccggtaagaagaacacatgctccactat gttcatagaagccttgtttataatagccagaagctggaaagaacccagat gcccctcaacagaggaatggatacagaaaacgtggtgcatttatacaatg taatattactcagctattaaaaagaatgaatttatgaaattcctaggtaa atggatggacctggaggctatcatcctgattgaggtaacccaatcacaaa ggaattcacacaatatgtattcactcataagtggatattagcccagaaac ttaggatacccaagatatatgatacaacttgccaaatgcatgaaattcaa gaagaacgaagaccaaagtgtggacactttaccctttcttagaaatggga acaaaacacccatggaaggagttacagagacaaaatttggagctgtgatg aaaggatggaccatctagagattgccatatccggggatccatcccataat cagcttccaaatcctgacaccattgcatatactagcaagattttgctgaa aggacccagatatagctctctcttgtgagactatgccggggcctagcaaa cacagtagtggatgatcacagtcagctattggatgggtcacacggcccca tggagagctagagaaatcacccaaggagctaaaggaactgcacctatagg tggacacatatgactaccagtacccgggagctctttagctgcatatgtat caaaagatggctcgtccgcatactgcagagaggacatgggactgccaact tttatgcccagtacaggggatgccaggtcaaaaagggggagtggtgtggg ttagggaattg	gaattctgcagagttacaccatacaacaagcctcacataagagggtgggt gccacccttagggtgagaaacagctgggaactgagaaggagacaggctta tataggctttcttaggaatagagttttccagagtagagatttccagtaat gagattggtgagatttcaagccaagcccagaaattggtgggatttttgtg cctaatttagagcaatttcacaatccttttaggacaggctgttggttaaa gggaatggtcttttgaatgatagatgtccatatgtaaaagatataatgaa tatgtgtagatacaaagaagtagagggagaagagaccaagtttaggtata aaagattttcagatcatttgtttgtgcagtggcagaaagttgccaccatt gaaaattgagaatgtcagtcttgtaactgtaaagaggccaagctgtttat aataatggagtaaggctttaataagatcctagttcatagaagaagatagg aagagtcacagaaattaatgcagctcctaagaagagaaggcaagcaaaga ggaagggcttcaacagagaaagagtagcaagtgtcttaacttcagagttg cctacatggtggagccctggaaggcttaacaggatggagaaaccttacca agtaggtgaagagagacaaatagtgcagctggagggaagaagtaactgaa gaaatagactctagaatttggaaccaaatatggatggtggcagaagtcag cagaaacaaacattcatacacttcttgatagagtcaaggccctttcagct ggccataccaacttcccagactcccaaagcctgagaacctccaggtctct gcttcaaatgtggtcaggtgggtcattcggcccaggtatgtccaaagcct tgcaaccattctgatcatgaccaaggtgccatcaagagggacattaaaac attcattgctcccatataccttgtaccatgagatcagactcagactccct ctagcaacactcaaagactagtagcattacatattaagggaatctaactt ctttcttctagatctagcaccacttttcattccaatgggattgggaccac ctctctttctgttatttcatgtctgagaaatagggcaagccttacctgaa cttaccatgctaccttatctggttattaatgg
quality values	Open. Hide. 53 46 19 16 57 39 30 23 20 61 61 43 61 61 61 61 61 25 27 61 61 61 47 61 61 47 55 22 28 10 8 20 12 25 23 49 55 52 59 61 61 59 59 61 59 59 61 61 43 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 49 37 61 41 32 36 35 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 59 59 61 59 59 61 61 61 61 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 55 59 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 53 47 42 57 57 53 57 57 57 53 57 52 57 57 57 57 57 53 47 57 57 53 57 57 57 53 57 57 53 53 57 57 45 53 57 57 53 53 57 57 52 57 53 57 53 57 57 47 57 45 53 57 57 53 53 57 57 53 53 53 57 57 47 52 57 57 53 41 57 41 33 52 52 57 41 38 57 53 37 33 50 53 53 41 52 57 40 53 53 38 57 53 57 57 53 57 36 16 57 57 53 57 53 32 52 53 41 33 43 50 57 47 39 57 53 57 57 41 57 34 38 41 57 57 42 53 28 46 44 35 43 53 53 53 52 51 52 46 31 35 52 57 57 52 50 37 38 38 47 57 50 53 53 53 42 40 53 57 37 38 57 57 53 30 33 53 52 57 57 52 47 41 52 57 32 35 40 52 52 40 38 19 53 52 30 52 53 33 52 34 47 57 35 34 33 36 57 57 40 32 57 53 53 39 53 29 40 41 41 37 40 37 37 40 37 57 57 30 41 33 29 57 45 37 34 47 36 41 47 41 40 37 44 37 37 31 44 40 16 40 27 31 31 32 30 36 36 51 51 48 25 20 25 47 24 31 27 46 29 29 44 34 34 30 30 30 38 41 38 20 23 31 24 51 48 30 29 29 36 48 29 26 27 29 32 18 23 41 32 29 29 39 32 29 28 43 39 34 27 30 24 30 27 20 13 51 51 29 29 31 41 24 29 51 29 17 29 29 16 43 34 26 16 41 26 31 41 29 28 29 31 29 34 28 31 33 38 23 30 35 35 41 27 35 23 30 26 29 29 28 31 29 51 46 28 26 29 35 31 17 29 29 51 31 29 25 27 11 23 20 21 7 18 20 31 11 16 29 23 20 27 14 29 23 28 25 38 29 28 34 19 12 15 34 22 22 11 12 25 51 23 7 7 11 14 14 11 13 9 32 38 38 14 7 6 17 25 12 8 9 12 26 28 28 27 28 17 29 51 19 26 28 23 29 38 27 7 11 24 5 29 19 35 35 16 36 13 29 51 13 23 26 28 33 14 35 30 23 26 10 19 25 29 15 17 17 29 24 10 24 30 33 16 23 26 16 35 13 18 39 10 23 18 12 17 29 26 33 18 14 36 6 11 5 28 14 22 13 37 31 23 15 29 29 26 29 22 25 18 29 14 5 9 14 9 14 25 31 14 9 8 10 23 21 28 9 20 9 8 9 5 20 12 10 27 6 15 15 12 5 7 1 3 2 3 9 13 10 8 6 11 4 25 6 21 10 21 4 8 5 18 12 15 7 6 4 4 4 5 5 17 28 18 14 9 6 10 9 5 11 27 30 8 4 2 7 7 13 8 13 4 1 4 8 19 13 30 4 13 27 27 23 8 4 3 3 5 13 4 9 5 5 12 17 6 10 12 20 21 8 5 5 4 12 9	Open. Hide. 55 47 52 49 28 28 20 14 21 12 12 32 28 43 32 30 59 59 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 50 55 37 36 41 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 61 59 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 52 61 42 39 61 61 61 53 50 50 50 53 52 47 50 45 57 53 57 57 57 57 53 57 53 47 53 53 53 57 57 57 53 57 57 53 57 45 57 57 47 47 57 53 53 53 53 52 42 53 53 53 53 57 45 57 57 57 52 57 53 53 57 45 53 53 53 57 53 57 53 45 57 47 52 46 47 47 53 50 53 50 57 45 53 53 47 32 47 53 50 53 38 57 57 57 28 46 47 57 45 53 47 43 53 52 36 47 47 30 52 38 57 50 50 50 53 38 47 57 31 26 57 52 57 42 57 41 35 42 47 52 47 37 37 50 45 52 45 50 40 33 46 52 53 53 52 38 53 38 52 47 34 20 36 52 53 50 52 47 53 53 38 37 42 50 53 40 57 52 22 41 33 25 33 24 53 53 35 48 36 42 42 41 52 46 52 35 53 57 33 37 42 31 42 37 48 43 36 44 35 57 22 14 57 33 41 44 37 40 21 20 14 45 53 47 36 40 57 44 39 37 57 40 25 57 53 22 40 37 41 43 30 44 40 29 23 35 40 18 53 57 38 35 30 53 36 37 30 40 32 28 22 31 30 31 20 29 27 48 31 34 30 41 29 29 31 29 36 26 38 36 29 30 23 48 20 47 25 44 47 29 23 27 20 31 39 48 34 8 21 19 29 30 29 29 24 29 35 22 46 25 33 34 27 16 31 19 29 24 36 23 24 45 38 23 25 30 22 36 34 17 34 29 23 28 27 21 31 28 28 51 28 30 33 33 28 35 29 29 28 28 23 46 29 28 29 8 29 46 25 29 20 26 43 14 43 51 46 23 28 31 20 33 27 13 23 17 39 28 26 15 35 26 29 31 28 28 28 27 9 39 7 18 6 13 28 26 28 21 39 16 14 29 14 32 22 25 24 28 33 34 24 19 28 25 29 17 24 21 13 29 15 16 30 15 20 15 31 24 21 29 17 29 22 51 28 14 17 17 16 28 25 38 38 25 20 19 19 30 30 19 29 23 35 28 20 8 31 30 12 19 13 22 19 25 17 29 19 31 14 16 28 22 22 15 19 5 6 32 15 24 15 14 30 11 26 19 15 10 17 9 13 15 42 25 14 10 11 26 9 19 4 10 17 6 10 19 24 25 35 15 19 14 8 4 4 5 4 15 9 18 12 17 15 20 23 14 29 5 14 22 8 9 13 42 10 12 12 16 13 5 13 18 16 12 7 6 4 18 17 9 9 8 9 4 6 6 15 5 4 6 24 10 6 4 14 11 11 12 20 30 30 19 11 22 7 8 7 11 6 17 5 14 23 8 11 13 23 12 21 4 3 9 7 24 5 17 6 9 6 18 4 22 5 20 4 9 5 6 4 5 20 5 5 3 5 8 1 3 9 9 13 4 15 27 16 12 16 7 13 16 5 4 3 13 4 4 19 15 13 15 8 5 20 8 16 10 7 19 4 6 5 9 2 6 8 4 4 7 8 4 9 6 3 5 5 20 20 3 2 4 6 13 10 5 6 15 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_36696516_36697717
seq2: B6Ng01-119C24.g_67_1248

seq1  GAATTCTGCAGAGTTACACCATACAACAAGCCTCACATAAGAGGGTGGGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGCAGAGTTACACCATACAACAAGCCTCACATAAGAGGGTGGGT  50

seq1  GCCACCCTTAGGGTGAGAAACAGCTGGGAACTGAGAAGGAGACAGGCTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACCCTTAGGGTGAGAAACAGCTGGGAACTGAGAAGGAGACAGGCTTA  100

seq1  TATAGGCTTTCTTAGGAATAGAGTTTTCCAGAGTAGAGATTTCCAGTAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGGCTTTCTTAGGAATAGAGTTTTCCAGAGTAGAGATTTCCAGTAAT  150

seq1  GAGATTGGTGAGATTTCAAGCCAAGCCCAGAAATTGGTGGGATTTTTGTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATTGGTGAGATTTCAAGCCAAGCCCAGAAATTGGTGGGATTTTTGTG  200

seq1  CCTAATTTAGAGCAATTTCACAATCCTTTTAGGACAGGCTGTTGGTTAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAATTTAGAGCAATTTCACAATCCTTTTAGGACAGGCTGTTGGTTAAA  250

seq1  GGGAATGGTCTTTTGAATGATAGATGTCCATATGTAAAAGATATAATGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAATGGTCTTTTGAATGATAGATGTCCATATGTAAAAGATATAATGAA  300

seq1  TATGTGTAGATACAAAGAAGTAGAGGGAGAAGAGACCAAGTTTAGGTATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTGTAGATACAAAGAAGTAGAGGGAGAAGAGACCAAGTTTAGGTATA  350

seq1  AAAGATTTTCAGATCATTTGTTTGTGCAGTGGCAGAAAGTTGCCACCATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATTTTCAGATCATTTGTTTGTGCAGTGGCAGAAAGTTGCCACCATT  400

seq1  GAAAATTGAGAATGTCAGTCTTGTAACTGTAAAGAGGCCAAGCTGTTTAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAATTGAGAATGTCAGTCTTGTAACTGTAAAGAGGCCAAGCTGTTTAT  450

seq1  AATAATGGAGTAAGGCTTTAATAAGATCCTAGTTCATAGAAGAAGATAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATGGAGTAAGGCTTTAATAAGATCCTAGTTCATAGAAGAAGATAGG  500

seq1  AAGAGTCACAGAAATTAATGCAGCTCCTAAGAAGAGAAGGCAAGCAAAGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGTCACAGAAATTAATGCAGCTCCTAAGAAGAGAAGGCAAGCAAAGA  550

seq1  GGAAGGGCTTCAACAGAGAAAGAGTAGCAAGTGTCTTAACTTCAGAGTTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGGCTTCAACAGAGAAAGAGTAGCAAGTGTCTTAACTTCAGAGTTG  600

seq1  CCTACATGGTGGAGCCCTGGAAGGCTTAACAGGATGGAGAAACCTTACCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTACATGGTGGAGCCCTGGAAGGCTTAACAGGATGGAGAAACCTTACCA  650

seq1  AGTAGGTGAAGAGAGACAAATAGTGCAGCTGGAGGGAAGAAGTAACTGAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGGTGAAGAGAGACAAATAGTGCAGCTGGAGGGAAGAAGTAACTGAA  700

seq1  GAAATAGACTCTAGAATTTGGAACCAAATATGGATGGTGGCAGAAGTCAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATAGACTCTAGAATTTGGAACCAAATATGGATGGTGGCAGAAGTCAG  750

seq1  CAGAAACAAACATTCATACACTTCTTGATAGAGTCAAGGCCCTTTCAGCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAACAAACATTCATACACTTCTTGATAGAGTCAAGGCCCTTTCAGCT  800

seq1  GGCCATACCAACTTCCCAGACTCCCAAAGCCTGAGAACCTCCAGGTCTCT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCATACCAACTTCCCAGACTCCCAAAGCCTGAGAACCTCCAGGTCTCT  850

seq1  GCTTCAAATGTGGTCAGGTGGGTCATTCGGCCCAGGTATGTCCAAGGCCT  900
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  GCTTCAAATGTGGTCAGGTGGGTCATTCGGCCCAGGTATGTCCAAAGCCT  900

seq1  TGCAAACCATTCTGATCATGACCAAGGTGCCATCAAGAGGGACATTAAAA  950
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGC-AACCATTCTGATCATGACCAAGGTGCCATCAAGAGGGACATTAAAA  949

seq1  CATTCATTGCTCCCATATACCTTGTACCATGGAGAATCAGACTCAGACTC  1000
      |||||||||||||||||||||||||||||| ||| |||||||||||||| 
seq2  CATTCATTGCTCCCATATACCTTGTACCAT-GAG-ATCAGACTCAGACT-  996

seq1  CCCTCTAGCCAACACTCAAAGACCTAGGTAGCCATTACATTATTAAGGGA  1050
      |||||||| ||||||||||||| ||| |||| ||||||| ||||||||||
seq2  CCCTCTAG-CAACACTCAAAGA-CTA-GTAG-CATTACA-TATTAAGGGA  1041

seq1  ATCTAACTCCTTTCTTCTAGATACTAGCACCACTTTTCAATCCCAATGGA  1100
      |||||||| ||||||||||||| |||||||||||||||| ||| |  |||
seq2  ATCTAACTTCTTTCTTCTAGAT-CTAGCACCACTTTTCATTCCAATGGGA  1090

seq1  TTTTGGGGGACCAACCTCTCCTTCCTGTTATTCTATGGTCTGAG-AATAG  1149
      ||    |||||| |||||| ||| ||||||||  || ||||||| |||||
seq2  TT----GGGACC-ACCTCT-CTTTCTGTTATTTCAT-GTCTGAGAAATAG  1133

seq1  GCACAGGCTTACCTG-ACTTACCAAATGCTACCTCTTATCTGTGTATTTA  1198
      |   || |||||||| |||||||  |||||||  |||||||| ||  |||
seq2  GGCAAGCCTTACCTGAACTTACC--ATGCTAC--CTTATCTG-GTTATTA  1178

seq1  ATGG  1202
      ||||
seq2  ATGG  1182

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information