MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-173L20
Chromosome	2 (Build37)
Map Location	34,166,577 - 34,324,767
singlet/doublet	doublet
Overlap gene	Pbx3, LOC665948, Mapkap1
Upstream gene	Ralgps1, Zbtb34, Zbtb43, LOC676764, Lmx1b, LOC100041918, 2610528K11Rik, LOC100041931
Downstream gene	LOC623448, LOC623269, Gapvd1, Hspa5, Rabepk, Fbxw2, EG623370, Psmd5, D730039F16Rik, Phf19, Traf1, Hc, AI182371, Rab14, Gsn, Stom, LOC654354, 4930568D16Rik, 4930402F06Rik, Ggta1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ralgps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241308 MGI:1922008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241311 MGI:2685195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 4 Proteins

name	Zbtb43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71834 MGI:1919084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC676764 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Lmx1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16917 MGI:1100513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041918 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 642 ESTs, 2 Proteins pseudo : _no_value

name	2610528K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72543 MGI:1919793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pbx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18516 MGI:97496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Mapkap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227743 MGI:2444554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1430 ESTs, 7 Proteins pseudo : _no_value

name	LOC623269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623269
definition	note : DnaJ homolog subfamily B member 6 pseudogene pseudo : _no_value

name	Gapvd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66691 MGI:1913941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspa5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14828 MGI:95835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabepk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227746 MGI:2139530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30050 MGI:1353435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623370 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623370 MGI:3644358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Psmd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66998 MGI:1914248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D730039F16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77996 MGI:1925246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74016 MGI:1921266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22029 MGI:101836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15139 MGI:96031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI182371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98870 MGI:2138853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68365 MGI:1915615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227753 MGI:95851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stom (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13830 MGI:95403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC654354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654354
definition	note : glyoxalase 1 pseudogene pseudo : _no_value

name	4930568D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75859 MGI:1923109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 Proteins

name	4930402F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74854 MGI:1922104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14594 MGI:95704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ralgps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352282 GeneID:241308 MGI:1922008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ral GEF with PH domain and SH3 binding motif 1 transcript_id : NM_175211.3

name	Zbtb34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366395 GeneID:241311 MGI:2685195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 4 Proteins product : zinc finger and BTB domain containing 34 transcript_id : XM_140881.6

name	Zbtb43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037380 GeneID:71834 MGI:1919084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 43 transcript_id : NM_001025594.1

name	Zbtb43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037382 GeneID:71834 MGI:1919084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 43 transcript_id : NM_027947.2

name	LOC676764 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249250 GeneID:676764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC676764 transcript_id : XM_001474275.1

name	Lmx1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754561 GeneID:16917 MGI:1100513
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox transcription factor 1 beta transcript_id : NM_010725.1

name	2610528K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893168 GeneID:72543 MGI:1919793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610528K11 gene transcript_id : NM_175184.4

name	LOC100041931 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249289 GeneID:100041931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041931 transcript_id : XM_001478858.1

name	Pbx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7949104 GeneID:18516 MGI:97496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre B-cell leukemia transcription factor 3 transcript_id : NM_016768.1

name	Mapkap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098167 GeneID:227743 MGI:2444554
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase associated protein 1 transcript_id : NM_177345.3

name	Gapvd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254513 GeneID:66691 MGI:1913941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase activating protein and VPS9 domains 1 transcript_id : NM_025709.2

name	Hspa5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981721 GeneID:14828 MGI:95835
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock 70kD protein 5 (glucose-regulated protein) transcript_id : NM_022310.2

name	Rabepk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368010 GeneID:227746 MGI:2139530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rab9 effector protein with kelch motifs transcript_id : NM_145522.3

name	Fbxw2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375978 GeneID:30050 MGI:1353435
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 2 transcript_id : NM_013890.3

name	EG623370 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82884412 GeneID:623370 MGI:3644358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG623370 transcript_id : XM_887818.1

name	Psmd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053912 GeneID:66998 MGI:1914248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 transcript_id : NM_080554.2

name	D730039F16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380367 GeneID:77996 MGI:1925246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D730039F16 gene transcript_id : NM_030021.2

name	Phf19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350606 GeneID:74016 MGI:1921266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 19 transcript_id : NM_028716.2

name	Traf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900511 GeneID:22029 MGI:101836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 1 transcript_id : NM_009421.3

name	Hc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754163 GeneID:15139 MGI:96031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemolytic complement transcript_id : NM_010406.1

name	AI182371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369448 GeneID:98870 MGI:2138853
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI182371 transcript_id : NM_178885.3

name	Rab14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86355517 GeneID:68365 MGI:1915615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB14, member RAS oncogene family transcript_id : NM_026697.3

name	Gsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130216 GeneID:227753 MGI:95851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gelsolin transcript_id : NM_146120.3

name	Stom (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129913 GeneID:13830 MGI:95403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stomatin transcript_id : NM_013515.2

name	4930568D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366402 GeneID:75859 MGI:1923109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 Proteins product : RIKEN cDNA 4930568D16 gene transcript_id : XM_130220.4

name	4930402F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123959717 GeneID:74854 MGI:1922104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930402F06 gene transcript_id : NM_001080709.1

name	Ggta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369425 GeneID:14594 MGI:95704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein galactosyltransferase alpha 1, 3 transcript_id : NM_010283.2

name	Ralgps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424836 CCDS:CCDS15939.1 GeneID:241308 MGI:1922008
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : Ral guanine nucleotide exchange factor RalGPS1A protein_id : NP_780420.1

name	Zbtb34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63489785 GeneID:241311 MGI:2685195
definition	codon_start : 1 product : similar to zinc finger and BTB domain containing 34 protein_id : XP_140881.4

name	Zbtb43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037383 CCDS:CCDS15942.1 GeneID:71834 MGI:1919084
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; zinc finger protein 297B; ortholog of zinc finger protein 297B ZNF297B product : zinc finger protein 297B isoform a protein_id : NP_082223.2

name	Zbtb43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037381 CCDS:CCDS15943.1 GeneID:71834 MGI:1919084
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; zinc finger protein 297B; ortholog of zinc finger protein 297B ZNF297B product : zinc finger protein 297B isoform b protein_id : NP_001020765.1

name	LOC676764 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249251 GeneID:676764
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474325.1

name	Lmx1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754562 CCDS:CCDS15944.1 GeneID:16917 MGI:1100513
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009953 - dorsal/ventral pattern formation [Evidence IEP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence ISS]; GO:0030326 - embryonic limb morphogenesis [Evidence NAS]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : transcription factor note : LIM homeo box transcription factor 1B product : LIM homeobox transcription factor 1 beta protein_id : NP_034855.1

name	2610528K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254287 CCDS:CCDS15946.1 GeneID:72543 MGI:1919793
definition	codon_start : 1 product : hypothetical protein LOC72543 protein_id : NP_780393.2

name	LOC100041931 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249290 GeneID:100041931
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478908.1

name	Pbx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949105 CCDS:CCDS15947.1 GeneID:18516 MGI:97496
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : pre B-cell leukemia transcription factor 3 protein_id : NP_058048.1

name	Mapkap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893485 CCDS:CCDS15948.1 GeneID:227743 MGI:2444554
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : mitogen-activated protein kinase associated protein 1 protein_id : NP_796319.1

name	Gapvd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254514 CCDS:CCDS15949.1 GeneID:66691 MGI:1913941
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : GTPase activating protein and VPS9 domains 1 protein_id : NP_079985.2

name	Hspa5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981722 CCDS:CCDS15950.1 GeneID:14828 MGI:95835
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043022 - ribosome binding [Evidence IDA] GO_process : GO:0006983 - ER overload response [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glucose regulated protein, 78 kDa; heat shock 70kD protein 5 (glucose-regulated protein, 78kD) product : heat shock 70kD protein 5 (glucose-regulated protein) protein_id : NP_071705.2

name	Rabepk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559945 CCDS:CCDS15951.1 GeneID:227746 MGI:2139530
definition	codon_start : 1 note : novel protein containing a Kelch motif product : Rab9 effector p40 protein_id : NP_663497.2

name	Fbxw2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980723 CCDS:CCDS15952.1 GeneID:30050 MGI:1353435
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : F-box and WD-40 domain protein 2 protein_id : NP_038918.2

name	EG623370 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82884413 GeneID:623370 MGI:3644358
definition	codon_start : 1 product : similar to beta-1,3-N-acetylglucosaminyltransferase 5 protein_id : XP_892911.1

name	Psmd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053913 CCDS:CCDS15953.1 GeneID:66998 MGI:1914248
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : proteasome 26S non-ATPase subunit 5 protein_id : NP_542121.2

name	D730039F16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037515 CCDS:CCDS15954.1 GeneID:77996 MGI:1925246
definition	codon_start : 1 product : hypothetical protein LOC77996 protein_id : NP_084297.1

name	Phf19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311998 CCDS:CCDS15955.1 GeneID:74016 MGI:1921266
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : PHD finger protein 19 protein_id : NP_082992.1

name	Traf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981953 CCDS:CCDS15956.1 GeneID:22029 MGI:101836
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Tnf receptor-associated factor 1 protein_id : NP_033447.2

name	Hc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754164 CCDS:CCDS15957.1 GeneID:15139 MGI:96031
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005579 - membrane attack complex [Evidence IEA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006957 - complement activation, alternative pathway [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0019835 - cytolysis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 product : hemolytic complement protein_id : NP_034536.1

name	AI182371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725720 CCDS:CCDS15958.1 GeneID:98870 MGI:2138853
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : hypothetical protein LOC98870 protein_id : NP_849216.1

name	Rab14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18390323 CCDS:CCDS15959.1 GeneID:68365 MGI:1915615
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB14, member RAS oncogene family protein_id : NP_080973.1

name	Gsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916693 CCDS:CCDS15960.1 GeneID:227753 MGI:95851
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005829 - cytosol [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence ISS] GO_process : GO:0030041 - actin filament polymerization [Evidence ISS]; GO:0051014 - actin filament severing [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0016192 - vesicle-mediated transport [Evidence IMP] codon_start : 1 product : gelsolin protein_id : NP_666232.2

name	Stom (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710018 CCDS:CCDS15961.1 GeneID:13830 MGI:95403
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : protein 7.2b product : erythrocyte protein band 7.2 protein_id : NP_038543.1

name	4930568D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82884425 GeneID:75859 MGI:1923109
definition	codon_start : 1 product : hypothetical protein LOC75859 protein_id : XP_130220.3

name	4930402F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123959718 GeneID:74854 MGI:1922104
definition	codon_start : 1 product : hypothetical protein LOC74854 protein_id : NP_001074178.1

name	Ggta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753982 CCDS:CCDS15964.1 GeneID:14594 MGI:95704
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0047276 - N-acetyllactosaminide 3-alpha-galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glycoprotein alpha galactosyl transferase 1; alpha Gal product : glycoprotein galactosyltransferase alpha 1, 3 protein_id : NP_034413.1

name	LOC665948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665948
definition	number : 2 pseudo : _no_value

name	LOC665948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665948
definition	number : 1 pseudo : _no_value

name	LOC100041918 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249288 GeneID:100041918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 642 ESTs, 2 Proteins product : similar to histone pseudo : _no_value transcript_id : XR_033935.1

name	LOC623448 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249291 GeneID:623448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1430 ESTs, 7 Proteins product : similar to Ribosomal protein S3a pseudo : _no_value transcript_id : XR_033976.1

clone name	MSMg01-350H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-309M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477M12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069H04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-173L20.b	B6Ng01-173L20.g
ACC	GA002007	GA002008
length	1,172	1,061
definition	B6Ng01-173L20.b	B6Ng01-173L20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(34,323,603 - 34,324,767)	(34,166,577 - 34,167,639)
sequence	gaattcctaatagcaagtggcacatagaggatgtaatggtatgtcagtca ctgcataagtgctttttaattatctatttatattctcaggataatcttat aaaggtgttaccatgacatcccttttacaatttaacaacaacaaccaaaa gaactctggctggcaagatggcttagtggctaagaacagttactatgggt ctgacctaagtgtggtccccagaactcacatgatgggaggagagaaccag ctccagcaggctagcctctgcctccacacggaggccatggctcatacata cacatcactctagcctctgcctccacacgcaggccatggcacatacacat cgtttataaataaataaatgcatgtagtttaaacttttttagaaagatta actaaaaacgtggagaaattatttgtctgcactacaacagctggggaagc taaagcaaacaaatccgcagcacactcttgacctccagaagctgactcat ccaacaaagcctcctgcaactgtcccgactctcacagagtggcagcagtc acagaggctgctgctgcagagccccaagaccaacttgagctacaactcct cctaatgactaccttagcttcagactgccccacaatggtgtgcactctac caccgccatggctgccttctgcatggtcctaaatactgttaatgaggctt cacttttttgcaagttgtcatataaaaattactctttcatttcctttaca acatgagaatgctttttcaaaatactattattccctcctcaaacataata tactagaaagcatggtgggaatgcctgcccttcaatgagagaaaagctgc tgaagttaggacacagtgaagaagccaggccagtgtgctttgcttcagcc aacaggatcggcacaaagtccttatccttacacagactctgcacacaagg gtttgaagatctaatggtaccatgttcttcaagaagaaagcctggccaac aatccctacgtgattgggcatcctgctggagtcagaacagacttcttgga gggcccatcacggcctaattcagtactgtgaaagaacaggaaatcagcaa tatatgttaaaactgaagaactctgctttcattcatttacagtcttctct actccattttacagaacaacag	gaattctttctcttatgctttcacagaagaaaatgccagagcaacaacta gctataatttgaaattaatcattaaatgagatcaccaataagttagataa aaaaaaaaaaaaaaaaaaaaaaaaaaacaaacaggagcatctctgagacc aggagaaactgaataaatttctatatttgaacaaagacaattcttaacat aaaatgctaaagaaaaaaaaaaaaaacaagttgacaaaagaaaaaacaca caatattatcttgcattatttccgttttttaaaaattgtcctaattatta ctattatgctctaaaccctgtatggatgatttccccttaaaaagattctg tttgcacagttcctaagctctgaagctgtagttagagaaacacatttgca gtgtgtagcgatgtagctccaactagcctgccactgtcagaatgcagggc ccagtatctacggatgcaaataaactgaggtggaggagcagtagggagct ctataattaaactctggagctacatgttttatacattcttaaatgagctg tgatatatagtggcgctataaaaagttatcatttattggtaatgaaaagt aaaaattaaccacctattcaatgatttttcacctcttcagaaggctttaa agtcgaatgcagcctgtgagatttatagtgactcatgacttttaacccca ctattttcaatatttccctctgtaagttacaaaattaatacaacttcaac tgtgattacttttttatggattagtataaaataaaatttcatcgtgtgtt cttccttggagcaactgaggttgtagtctttttctttttttttttttttt tcttttctttttgcaatactactaaaagactgaactaaacttccaatttg ttcaatttcttagttgtaatttttcaagccaaactaattatataatagaa accaggtgagattttaaaatgttccccctctcctttgataataataacca cattgatagagcaaagtaaattcgagaaccatatttgcatttatgccaac tgtcccagcat
quality values	Open. Hide. 9 18 9 8 15 13 15 62 44 41 56 32 32 38 31 41 62 62 62 37 56 56 62 54 62 62 56 62 62 62 59 31 25 24 18 18 16 28 19 27 29 23 29 32 27 20 28 54 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 49 43 51 43 48 50 50 48 43 36 34 49 42 56 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 54 54 62 54 47 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 58 58 58 58 58 58 58 58 58 58 58 54 54 58 46 54 58 52 58 58 58 58 58 58 58 58 58 58 54 58 54 54 50 58 58 58 58 52 58 54 58 40 54 54 58 54 58 58 58 54 52 58 48 48 54 50 58 58 58 58 58 54 58 58 42 42 58 52 58 54 54 51 46 52 58 58 42 51 53 58 58 49 48 33 50 46 29 47 58 46 58 58 58 48 49 39 58 54 58 49 41 58 51 58 50 51 49 51 58 53 52 46 54 49 51 58 53 48 44 50 50 58 58 52 53 54 50 58 54 58 58 51 51 53 40 50 58 58 33 51 58 38 50 58 50 50 40 51 51 58 53 52 49 44 33 58 51 26 39 35 58 52 50 39 40 50 58 58 58 58 50 50 39 41 46 38 41 40 58 39 41 38 52 38 39 33 58 54 54 32 42 41 44 40 47 42 49 54 35 37 32 53 54 34 44 51 33 54 34 31 42 29 49 53 32 39 40 47 33 54 14 19 49 31 46 54 54 54 54 27 30 54 54 44 35 38 33 17 35 33 31 26 19 28 29 49 25 37 35 30 37 39 37 54 33 24 27 20 7 54 35 42 32 31 42 34 36 15 52 53 49 25 31 32 32 45 25 9 15 49 36 36 25 25 30 11 14 16 30 29 52 32 34 39 34 46 19 28 31 34 21 40 24 33 33 33 33 25 29 32 39 33 38 31 43 41 28 42 36 36 32 15 30 26 31 28 16 25 23 37 35 44 19 36 35 18 43 43 25 10 27 22 15 8 9 20 36 30 31 31 31 48 31 34 34 43 37 31 26 11 38 37 28 30 21 23 27 16 32 20 26 14 19 11 28 21 7 46 7 11 37 30 17 15 26 20 23 17 18 39 11 5 6 5 12 11 14 25 19 32 27 31 35 16 13 19 17 25 15 22 6 43 36 8 32 18 12 17 15 16 22 27 17 17 25 22 23 32 33 9 18 9 13 12 23 9 19 15 28 14 8 8 19 28 7 6 4 5 10 31 34 11 29 12 18 17 19 11 15 26 19 24 22 30 12 19 34 37 32 18 24 15 10 21 33 16 21 10 31 13 9 15 34 32 33 8 10 20 21 33 9 14 9 16 24 10 11 27 21 5 3 3 13 8 7 6 11 17 6 9 14 14 9 34 28 11 21 6 30 11 16 6 7 19 17 7 8 11 27 6 28 21 5 5 11 4 5 19 7 11 6 8 15 32 28 12 13 24 13 7 7 10 6 9 11 20 16 8 4 10 18 11 9 2 4 5 9 6 4 4 7 27 28 16 11 12 19 7 22 4 6 11 6 9 3 2 2 3 2 17 4 21 8 7 6 15 7 17 22 5 8 5 5 9 4 17 13 18 10 4 5 3 6 7 6 7 6 5 5 28 17 6 5 8 10 16 5 12 6 11 9 7 14 4	Open. Hide. 62 59 62 62 62 62 62 62 62 62 41 30 14 12 12 13 23 18 25 28 27 23 22 34 15 25 28 49 38 54 62 62 62 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 46 34 45 36 28 32 32 40 56 38 43 42 35 43 42 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 41 41 34 43 34 34 40 49 24 49 50 44 34 38 34 43 46 39 34 27 27 31 11 31 38 39 27 34 23 34 22 43 41 34 43 40 46 46 34 37 37 43 34 50 46 39 34 27 30 34 26 39 34 30 34 48 43 43 39 35 34 25 28 43 34 45 45 46 43 43 40 49 39 43 34 40 49 50 43 34 27 50 34 46 48 34 27 18 40 43 43 62 62 62 62 62 62 62 43 43 38 34 30 34 27 31 31 24 25 28 30 30 38 34 18 13 27 13 39 40 34 34 34 23 34 23 23 30 30 23 30 34 31 27 27 30 40 30 34 23 23 35 30 30 39 35 31 37 27 28 34 49 49 51 49 34 41 43 43 34 23 40 30 39 19 34 35 23 34 30 34 34 24 30 23 30 27 27 30 34 30 30 30 37 27 28 34 24 34 41 31 43 34 23 18 34 13 18 17 34 34 23 18 28 27 27 27 29 35 43 39 46 29 27 34 18 37 34 30 24 34 30 23 30 18 28 23 34 30 34 29 19 34 24 27 31 30 45 43 27 43 41 19 29 34 30 19 24 39 30 18 30 28 41 23 24 22 38 24 24 19 28 22 34 34 23 39 30 32 22 38 38 30 31 24 10 16 10 31 16 30 11 16 25 24 23 27 22 29 22 23 15 25 20 33 22 10 30 21 37 37 20 18 20 14 27 23 27 17 22 23 37 10 14 17 10 35 24 20 38 24 14 38 56 56 43 56 39 27 20 23 27 30 34 23 27 30 35 34 27 27 34 23 13 9 30 14 22 38 23 27 24 35 29 28 27 10 35 27 33 27 26 37 19 22 28 25 21 40 22 34 28 23 21 22 32 32 25 21 33 36 35 35 32 35 34 22 30 29 31 20 33 25 34 17 25 19 17 30 18 27 40 29 25 33 19 26 25 26 26 17 32 27 42 32 25 46 40 26 23 27 29 15 29 19 30 18 37 37 32 32 46 47 42 19 25 10 30 21 37 32 34 34 35 40 50 58 42 42 33 37 29 22 22 31 39 29 35 36 35 28 31 23 46 18 21 34 27 31 41 41 42 43 37 50 24 50 37 39 35 21 36 23 19 13 39 29 16 50 52 32 33 43 31 50 29 21 25 43 31 50 58 58 39 25 42 23 50 35 31 41 37 19 42 29 20 54 23 32 37 15 30 29 39 45 49 34 49 19 39 12 51 32 21 49 29 31 28 53 53 27 53 19 35 25 21 33 31 54 31 30 31 33 35 18 40 19 35 30 45 33 32 37 39 32 53 54 51 11 32 31 33 52 40 16 22 31 31 35 32 53 52 28 32 35 11 20 27 31 40 25 35 51 8 26 33 18 45 24 32 12 18 40 18 28 20 15 51 51 18 14 21 31 24 32 24 36 28 20 24 31 28 38 22 31 31 22 45 18 28 30 23 31 21 30 10 51 47 51 51 10 31 22 42 27 24 18 26 30 14 12 9 18 29 46 42 42 31 31 48 48 31 30 47 29 18 21 32 33 36 10 41 8 31 25 20 29 13 15 37 36 28 21 39 13 19 18 33 22 25 31 20 27 35 11 33 17 13 31 7 23 16 6 33 33 39 39 39 13 35 32 36 33 41 36 41 36 41 18 28 30 35 38 32 30 30 7 18 8 38 22 12 8 7 21 29 22 11 26 29 19 22 11 18 26 19 21 22 19 18 48 48 31 17 26 21 21 17 9 15 32 26 7 43 29 24 9 10 19 22 19 14 24 36 20 34 19 27 22 24 10 19 16 13 11 7 18 19 5 6 7 8 8 7 12 28 31 33 37 23 32 32 28 11 13 10 11 28 7 15 11 38 20 10 5 9 5 5 6 20 8 17 18 18 20 33 16 14 21 11 24 14 7 10 16 5 25 6 30 38 21 18 28 27 18 6 16 14 11 22 47 40 40 32 9 7 7 5 11 8 21 13 24 24 12 21 8 4 5 6 6 9 15 10 8 7 20 13 18 7 9 19 9 6 5 11 18 6 4 25 17 5 6 5 26 16 9 8 13 1 1 6 7 10 9 9 10 6 5 14 17 14 7 5 10 5 25 19 6 5 6 5 4 3 7 9 8 20 4 5 3 11 10 18 15 9 24

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_34323603_34324767
seq2: B6Ng01-173L20.b_44_1215 (reverse)

seq1  CTGTTG-TCTGTAAAAT---GATGAGAAGACTGTAAATGATGGAAGGCAG  46
      |||||| ||||||||||   |  |||||||||||||||||  ||| ||||
seq2  CTGTTGTTCTGTAAAATGGAGTAGAGAAGACTGTAAATGAATGAAAGCAG  50

seq1  GAAGT--CTCAGTTTT-ACATATAATTTGCTGATCTCCTG-TCTTTCACA  92
        |||   |||||||| |||||||  |||||||| ||||| |||||||||
seq2  --AGTTCTTCAGTTTTAACATATA--TTGCTGATTTCCTGTTCTTTCACA  96

seq1  GTACTGAAATTAGGCCGTGGATTGGCCCTCCA--GAGTCTGTTCTGACTC  140
      |||||| ||||||||||| ||| |||||||||   |||||||||||||||
seq2  GTACTG-AATTAGGCCGT-GATGGGCCCTCCAAGAAGTCTGTTCTGACTC  144

seq1  CAGCAGGGATG-CCAATCACGTAGGGATTGTTGGCCAGGGCTTTC-TCTT  188
      ||||| ||||| ||||||||||||||||||||||||| ||||||| ||||
seq2  CAGCA-GGATGCCCAATCACGTAGGGATTGTTGGCCA-GGCTTTCTTCTT  192

seq1  G-AGAACAT-GTACCATTAGATCTTCAACCCTTTGTGTGCAGAGTCTGTG  236
      | ||||||| |||||||||||||||||| || ||||||||||||||||||
seq2  GAAGAACATGGTACCATTAGATCTTCAAACCCTTGTGTGCAGAGTCTGTG  242

seq1  TAAGGATAAGGAC-TTGTGCCGATCCTGTTGGCTGAAGCAAAGCACACTG  285
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TAAGGATAAGGACTTTGTGCCGATCCTGTTGGCTGAAGCAAAGCACACTG  292

seq1  GCCTGGCTTCTTCACTGTGTCCTAACTTCAGCAGCTTTTCTCTCATTGAA  335
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGGCTTCTTCACTGTGTCCTAACTTCAGCAGCTTTTCTCTCATTGAA  342

seq1  GGGCAGGCATTCCCACCATGCTTTCTAGTATATTATGTTTGAGGAGGGAA  385
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGGCATTCCCACCATGCTTTCTAGTATATTATGTTTGAGGAGGGAA  392

seq1  TAATAGTATTTTGAAAAAGCATTCTCATGTTGTAAAGGAAATGAAAGAGT  435
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATAGTATTTTGAAAAAGCATTCTCATGTTGTAAAGGAAATGAAAGAGT  442

seq1  AATTTTTATATGACAACTTGCAAAAAAGTGAAGCCTCATTAACAGTATTT  485
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTTTATATGACAACTTGCAAAAAAGTGAAGCCTCATTAACAGTATTT  492

seq1  AGGACCATGCAGAAGGCAGCCATGGCGGTGGTAGAGTGCACACCATTGTG  535
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACCATGCAGAAGGCAGCCATGGCGGTGGTAGAGTGCACACCATTGTG  542

seq1  GGGCAGTCTGAAGCTAAGGTAGTCATTAGGAGGAGTTGTAGCTCAAGTTG  585
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCAGTCTGAAGCTAAGGTAGTCATTAGGAGGAGTTGTAGCTCAAGTTG  592

seq1  GTCTTGGGGCTCTGCAGCAGCAGCCTCTGTGACTGCTGCCACTCTGTGAG  635
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTGGGGCTCTGCAGCAGCAGCCTCTGTGACTGCTGCCACTCTGTGAG  642

seq1  AGTCGGGACAGTTGCAGGAGGCTTTGTTGGATGAGTCAGCTTCTGGAGGT  685
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCGGGACAGTTGCAGGAGGCTTTGTTGGATGAGTCAGCTTCTGGAGGT  692

seq1  CAAGAGTGTGCTGCGGATTTGTTTGCTTTAGCTTCCCCAGCTGTTGTAGT  735
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAGTGTGCTGCGGATTTGTTTGCTTTAGCTTCCCCAGCTGTTGTAGT  742

seq1  GCAGACAAATAATTTCTCCACGTTTTTAGTTAATCTTTCTAAAAAAGTTT  785
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGACAAATAATTTCTCCACGTTTTTAGTTAATCTTTCTAAAAAAGTTT  792

seq1  AAACTACATGCATTTATTTATTTATAAACGATGTGTATGTGCCATGGCCT  835
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTACATGCATTTATTTATTTATAAACGATGTGTATGTGCCATGGCCT  842

seq1  GCGTGTGGAGGCAGAGGCTAGAGTGATGTGTATGTATGAGCCATGGCCTC  885
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGTGTGGAGGCAGAGGCTAGAGTGATGTGTATGTATGAGCCATGGCCTC  892

seq1  CGTGTGGAGGCAGAGGCTAGCCTGCTGGAGCTGGTTCTCTCCTCCCATCA  935
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGTGGAGGCAGAGGCTAGCCTGCTGGAGCTGGTTCTCTCCTCCCATCA  942

seq1  TGTGAGTTCTGGGGACCACACTTAGGTCAGACCCATAGTAACTGTTCTTA  985
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAGTTCTGGGGACCACACTTAGGTCAGACCCATAGTAACTGTTCTTA  992

seq1  GCCACTAAGCCATCTTGCCAGCCAGAGTTCTTTTGGTTGTTGTTGTTAAA  1035
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACTAAGCCATCTTGCCAGCCAGAGTTCTTTTGGTTGTTGTTGTTAAA  1042

seq1  TTGTAAAAGGGATGTCATGGTAACACCTTTATAAGATTATCCTGAGAATA  1085
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTAAAAGGGATGTCATGGTAACACCTTTATAAGATTATCCTGAGAATA  1092

seq1  TAAATAGATAATTAAAAAGCACTTATGCAGTGACTGACATACCATTACAT  1135
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATAGATAATTAAAAAGCACTTATGCAGTGACTGACATACCATTACAT  1142

seq1  CCTCTATGTGCCACTTGCTATTAGGAATTC  1165
      ||||||||||||||||||||||||||||||
seq2  CCTCTATGTGCCACTTGCTATTAGGAATTC  1172

seq1: chr2_34166577_34167639
seq2: B6Ng01-173L20.g_69_1129

seq1  GAATTCTTTCTCTTATGCTTTCACAGAAGAAAATGCCAGAGCAACAACTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTCTCTTATGCTTTCACAGAAGAAAATGCCAGAGCAACAACTA  50

seq1  GCTATAATTTGAAATTAATCATTAAATGAGATCACCAATAAGTTAGATAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATAATTTGAAATTAATCATTAAATGAGATCACCAATAAGTTAGATAA  100

seq1  AAAAAAAAAAAAAAAAAAAAAAAAAAACAAACAGGAGCATCTCTGAGACC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAAAAAAAAAAAAAAAAAAACAAACAGGAGCATCTCTGAGACC  150

seq1  AGGAGAAACTGAATAAATTTCTATATTTGAACAAAGACAATTCTTAACAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGAAACTGAATAAATTTCTATATTTGAACAAAGACAATTCTTAACAT  200

seq1  AAAATGCTAAAGAAAAAAAAAAAAAACAAGTTGACAAAAGAGAAAACACA  250
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  AAAATGCTAAAGAAAAAAAAAAAAAACAAGTTGACAAAAGAAAAAACACA  250

seq1  CAATATTATCTTGCATTATTTCCGTTTTTTAAAAATTGTCCTAATTATTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATATTATCTTGCATTATTTCCGTTTTTTAAAAATTGTCCTAATTATTA  300

seq1  CTATTATGCTCTAAACCCTGTATGGATGATTTCCCCTTAGAAAGATTCTG  350
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  CTATTATGCTCTAAACCCTGTATGGATGATTTCCCCTTAAAAAGATTCTG  350

seq1  TTTGCACAGTTCCTAAGCTCTGAAGCTGTAGTTAGAGAAACACATTTGCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCACAGTTCCTAAGCTCTGAAGCTGTAGTTAGAGAAACACATTTGCA  400

seq1  GTGTGTAGCGATGTAGCTCCGACTAGCCTGCCACTGTCAGAATGCAGGGC  450
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  GTGTGTAGCGATGTAGCTCCAACTAGCCTGCCACTGTCAGAATGCAGGGC  450

seq1  CCAGTATCTACGGATGCAGATAAACTGAGGTGGAGGAGCAGTAGGGAGCT  500
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  CCAGTATCTACGGATGCAAATAAACTGAGGTGGAGGAGCAGTAGGGAGCT  500

seq1  CTATAATTAAACTCTGGAGCTACATGTTTTATACATTCTTAAATGAGCTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATAATTAAACTCTGGAGCTACATGTTTTATACATTCTTAAATGAGCTG  550

seq1  TGATATATAGTGGCGCTATAAAAAGTTATCATTTATTGGTAATGAAAAGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATATATAGTGGCGCTATAAAAAGTTATCATTTATTGGTAATGAAAAGT  600

seq1  AAAAATTAACCACCTATTCAATGATTTTTCACCTCTTCAGAAGGCTTTAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATTAACCACCTATTCAATGATTTTTCACCTCTTCAGAAGGCTTTAA  650

seq1  AGTCGAATGCAGCCTGTGAGATTTATAGTGACTCATGACTTTTAA-CCCA  699
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  AGTCGAATGCAGCCTGTGAGATTTATAGTGACTCATGACTTTTAACCCCA  700

seq1  CTATTTTCAATATTT-CCTCTGTAAGTTACAAAATTAATACAACTTCAAC  748
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  CTATTTTCAATATTTCCCTCTGTAAGTTACAAAATTAATACAACTTCAAC  750

seq1  TGTGATTAC-TTTTTATGGATTAGTATAAAATAAAATTTCATCGTGTGTT  797
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  TGTGATTACTTTTTTATGGATTAGTATAAAATAAAATTTCATCGTGTGTT  800

seq1  CTTCCTTGGAGCAACTGAGGTTGTAGTCTTTTTCTTTTTTTTTTTTTTTT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCTTGGAGCAACTGAGGTTGTAGTCTTTTTCTTTTTTTTTTTTTTTT  850

seq1  TCTTTTTCTTTTTTGCAATACTACTAAAAGACTGAACTAAAC-TCCAATT  896
      ||||||   ||||||||||||||||||||||||||||||||| |||||||
seq2  TCTTTT--CTTTTTGCAATACTACTAAAAGACTGAACTAAACTTCCAATT  898

seq1  TGTTCAATTTCTTAGTTGTTATTTTTCAAAGCCAAACTAAATATATAAAT  946
      ||||||||||||||||||| ||||||| |||||||||||| ||||| |||
seq2  TGTTCAATTTCTTAGTTGTAATTTTTC-AAGCCAAACTAATTATAT-AAT  946

seq1  AGAAACCAGGTGAGAATTTTAAAATGTTCCCC--CTCCTTTGATAATAAT  994
      |||||||||||||| |||||||||||||||||  ||||||||||||||||
seq2  AGAAACCAGGTGAG-ATTTTAAAATGTTCCCCCTCTCCTTTGATAATAAT  995

seq1  AA-CACA-TGATAGAGGCAAAGTAAA-TCCAGACACATATTTTGGCAATT  1041
      || |||| ||||||| |||||||||| || |||  |||||||  |||  |
seq2  AACCACATTGATAGA-GCAAAGTAAATTCGAGAACCATATTT--GCA--T  1040

seq1  TTATGCAGACTGTCGCCAGCAT  1063
      ||||||  |||||| |||||||
seq2  TTATGCCAACTGTC-CCAGCAT  1061

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information