MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-215N06
Chromosome	2 (Build37)
Map Location	88,777,018 - 88,879,808
singlet/doublet	doublet
Overlap gene	Olfr1212, Olfr1213, Olfr1214, Olfr1215, Olfr1216, Olfr1217
Upstream gene	Olfr1155, Olfr1156, Olfr1157, Olfr74, Olfr1158, Olfr1159-ps1, Olfr1160, Olfr1161, Olfr73, Olfr1162, Olfr1163, Olfr1164, Olfr1165, Olfr1166, Olfr1167, Olfr1168, Olfr1169-ps1, Olfr1170, Olfr1171-ps1, Olfr1172-ps1, Olfr1173, Olfr1174, Olfr1175, Olfr1176, Olfr1177, Olfr1178, Olfr1179, Olfr1180, Olfr1181, Olfr1182, Olfr1183, Olfr1184, Olfr1185-ps1, Olfr1186, Olfr1187-ps1, Olfr1188, LOC668528, Olfr1189, GA_x5J8B7W4NS2-37772-38277, Olfr475-ps1, Olfr526-ps1, Olfr1192-ps1, Olfr1193, Olfr1194-ps1, Olfr1195, Olfr1196, Olfr1197, Olfr1198, Olfr1199, Olfr1200, Olfr1201, Olfr1202, Olfr1203, Olfr1204, Olfr1206, Olfr1208, Olfr1209, Olfr1211
Downstream gene	Olfr1218, Olfr1219, Olfr1220, Olfr1221, Olfr1222, Olfr1223, Olfr1224-ps1, Olfr1225, LOC435676, Olfr1226, LOC100042983, GA_x5J8B7TTH1T-1160-261, Olfr1227-ps1, Olfr1228, Olfr1229, Olfr1230, Olfr1231, Olfr1232, Olfr1233, Olfr1234, Olfr1235-ps1, GA_x5J8B7W62NC-668773-668438, Olfr1237-ps1, Olfr1238, Olfr1239, Olfr1240, Olfr1241, Olfr1242, Olfr1243, Olfr1244-ps1, Olfr1245, Olfr1246, Olfr1247, Olfr1248, Olfr1249, Olfr1541-ps1, Olfr1250, Olfr1251, GA_x5J8B7TT7VM-20-924, Olfr1252, GA_x5J8B7W62NC-992588-991951, Olfr1253-ps1, Olfr1254, Olfr1255, Olfr1256, Olfr48, Olfr1257, Olfr1258, Olfr1259, Olfr1260, Olfr1261, Olfr1262, Olfr1263, Olfr1264, Olfr1265
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr1155 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258636 MGI:3030989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258814 MGI:3030990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1157 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258846 MGI:3030991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr74 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117005 MGI:2151909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1158 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258639 MGI:3030992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1159-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258012 MGI:3030993
definition	gene_synonym : MOR135-23P note : olfactory receptor 1159, pseudogene 1 pseudo : _no_value

name	Olfr1160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258643 MGI:3030994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258845 MGI:3030995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr73 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117004 MGI:2151908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1162 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258105 MGI:3030996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258638 MGI:3030997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258634 MGI:3030998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1165 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258642 MGI:3030999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258644 MGI:3031000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258291 MGI:3031001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1168 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258524 MGI:3031002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1169-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404482 MGI:3031003
definition	note : olfactory receptor 1169, pseudogene 1 pseudo : _no_value

name	Olfr1170 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258525 MGI:3031004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1171-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257896 MGI:3031005
definition	gene_synonym : MOR174-17P note : olfactory receptor 1171, pseudogene 1 pseudo : _no_value

name	Olfr1172-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404483 MGI:3031006
definition	note : olfactory receptor 1172, pseudogene 1 pseudo : _no_value

name	Olfr1173 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404329 MGI:3031007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546769 MGI:3031008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 389 Proteins

name	Olfr1175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546770 MGI:3031009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2079 Proteins

name	Olfr1176 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258767 MGI:3031010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1177 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545443 MGI:3031011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1347 Proteins

name	Olfr1178 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258203 MGI:3031012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258919 MGI:3031013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1180 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258920 MGI:3031014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258060 MGI:3031015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1182 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258167 MGI:3031016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1183 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258522 MGI:3031017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1184 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258820 MGI:3031018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1185-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258059 MGI:3031019
definition	gene_synonym : MOR230-10P; MOR230-11 note : olfactory receptor 1185, pseudogene 1 pseudo : _no_value

name	Olfr1186 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258523 MGI:3031020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1187-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404484 MGI:3031021
definition	note : olfactory receptor 1187, pseudogene 1 pseudo : _no_value

name	Olfr1188 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258921 MGI:3031022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668528 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr1189 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258768 MGI:3031023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W4NS2-37772-38277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257726
definition	note : olfactory receptor GA_x5J8B7W4NS2-37772-38277 pseudo : _no_value

name	Olfr475-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404395 MGI:3030309
definition	note : olfactory receptor 475, pseudogene 1 pseudo : _no_value

name	Olfr526-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404399 MGI:3030360
definition	gene_synonym : MOR230-9 note : olfactory receptor 526, pseudogene 1 pseudo : _no_value

name	Olfr1192-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257937 MGI:3031026
definition	gene_synonym : MOR225-11 note : olfactory receptor 1192, pseudogene 1 pseudo : _no_value

name	Olfr1193 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329460 MGI:3031027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1194-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258243 MGI:3031028
definition	gene_synonym : MOR230-9 note : olfactory receptor 1194, pseudogene 1 pseudo : _no_value

name	Olfr1195 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258748 MGI:3031029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258456 MGI:3031030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1197 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433449 MGI:3031031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1198 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404330 MGI:3031032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1199 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258450 MGI:3031033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1200 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257887 MGI:3031034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1201 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258897 MGI:3031035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1202 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258454 MGI:3031036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258898 MGI:3031037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1204 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258455 MGI:3031038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1206 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258896 MGI:3031040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1208 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258774 MGI:3031042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1209 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258453 MGI:3031043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1211 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258025 MGI:3031045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1212 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258241 MGI:3031046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258900 MGI:3031047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258899 MGI:3031048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1215 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258451 MGI:3031049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1216 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258895 MGI:3031050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1217 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258903 MGI:3031051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1218 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258815 MGI:3031052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258901 MGI:3031053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1220 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258902 MGI:3031054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1221 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258904 MGI:3031055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1222 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258177 MGI:3031056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258894 MGI:3031057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1224-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258026 MGI:3031058
definition	gene_synonym : MOR233-15 note : olfactory receptor 1224, pseudogene 1 pseudo : _no_value

name	Olfr1225 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258893 MGI:3031059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	Olfr1226 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258969 MGI:3031060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	GA_x5J8B7TTH1T-1160-261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257863
definition	note : olfactory receptor GA_x5J8B7TTH1T-1160-261 pseudo : _no_value

name	Olfr1227-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404489 MGI:3031061
definition	note : olfactory receptor 1227, pseudogene 1 pseudo : _no_value

name	Olfr1228 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258973 MGI:3031062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1229 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257921 MGI:3031063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1230 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258785 MGI:3031064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1231 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258446 MGI:3031065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1232 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258320 MGI:3031066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1233 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258974 MGI:3031067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1234 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258975 MGI:3031068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1235-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404490 MGI:3031069
definition	note : olfactory receptor 1235, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W62NC-668773-668438 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257785
definition	note : olfactory receptor GA_x5J8B7W62NC-668773-668438 pseudo : _no_value

name	Olfr1237-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404492 MGI:3031071
definition	note : olfactory receptor 1237, pseudogene 1 pseudo : _no_value

name	Olfr1238 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258786 MGI:3031072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1239 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258972 MGI:3031073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1240 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258804 MGI:3031074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1241 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258447 MGI:3031075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1242 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258970 MGI:3031076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1243 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258971 MGI:3031077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1244-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404493 MGI:3031078
definition	note : olfactory receptor 1244, pseudogene 1 pseudo : _no_value

name	Olfr1245 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258784 MGI:3031079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1246 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258788 MGI:3031080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1247 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258968 MGI:3031081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258787 MGI:3031082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1249 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257984 MGI:3031083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1541-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258024 MGI:3031375
definition	gene_synonym : MOR231-16P note : olfactory receptor 1541, pseudogene 1 pseudo : _no_value

name	Olfr1250 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258967 MGI:3031084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1251 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259145 MGI:3031085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TT7VM-20-924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257743
definition	note : olfactory receptor GA_x5J8B7TT7VM-20-924 pseudo : _no_value

name	Olfr1252 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404331 MGI:3031086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W62NC-992588-991951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257782
definition	note : olfactory receptor GA_x5J8B7W62NC-992588-991951 pseudo : _no_value

name	Olfr1253-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258370 MGI:3031087
definition	gene_synonym : MOR231-18 note : olfactory receptor 1253, pseudogene 1 pseudo : _no_value

name	Olfr1254 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258468 MGI:3031088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1255 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258979 MGI:3031089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1256 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258985 MGI:3031090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18347 MGI:1333765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1257 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258984 MGI:3031091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1258 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258980 MGI:3031092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258338 MGI:3031093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258983 MGI:3031094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1261 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258466 MGI:3031095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1262 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258976 MGI:3031096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258790 MGI:3031097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1264 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258206 MGI:3031098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258340 MGI:3031099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1155 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671322 GeneID:258636 MGI:3030989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1155 transcript_id : NM_146643.2

name	Olfr1156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286813 GeneID:258814 MGI:3030990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1156 transcript_id : NM_146817.2

name	Olfr1157 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129164 GeneID:258846 MGI:3030991
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1157 transcript_id : NM_146849.1

name	Olfr74 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821674 GeneID:117005 MGI:2151909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 74 transcript_id : NM_054091.2

name	Olfr1158 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239203 GeneID:258639 MGI:3030992
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1158 transcript_id : NM_146645.1

name	Olfr1160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983621 GeneID:258643 MGI:3030994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1160 transcript_id : NM_146649.2

name	Olfr1161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129170 GeneID:258845 MGI:3030995
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1161 transcript_id : NM_146848.1

name	Olfr73 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905122 GeneID:117004 MGI:2151908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 73 transcript_id : NM_054090.1

name	Olfr1162 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801433 GeneID:258105 MGI:3030996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1162 transcript_id : NM_001011835.1

name	Olfr1163 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239189 GeneID:258638 MGI:3030997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1163 transcript_id : NM_146644.1

name	Olfr1164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380650 GeneID:258634 MGI:3030998
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1164 transcript_id : NM_146641.1

name	Olfr1165 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239187 GeneID:258642 MGI:3030999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1165 transcript_id : NM_146648.1

name	Olfr1166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118304 GeneID:258644 MGI:3031000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1166 transcript_id : NM_146650.2

name	Olfr1167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129696 GeneID:258291 MGI:3031001
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1167 transcript_id : NM_146294.1

name	Olfr1168 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239193 GeneID:258524 MGI:3031002
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1168 transcript_id : NM_146531.1

name	Olfr1170 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239199 GeneID:258525 MGI:3031004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1170 transcript_id : NM_146532.1

name	Olfr1173 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430583 GeneID:404329 MGI:3031007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1173 transcript_id : NM_207566.1

name	Olfr1174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249885 GeneID:546769 MGI:3031008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 389 Proteins product : olfactory receptor 1174 transcript_id : XM_621554.4

name	Olfr1175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249887 GeneID:546770 MGI:3031009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2079 Proteins product : olfactory receptor 1175 transcript_id : XM_621555.3

name	Olfr1176 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129308 GeneID:258767 MGI:3031010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1176 transcript_id : NM_146771.1

name	Olfr1177 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249889 GeneID:545443 MGI:3031011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1347 Proteins product : olfactory receptor 1177 transcript_id : XM_619781.4

name	Olfr1178 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801497 GeneID:258203 MGI:3031012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1178 transcript_id : NM_001011868.1

name	Olfr1179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735415 GeneID:258919 MGI:3031013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1179 transcript_id : NM_146917.2

name	Olfr1180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129058 GeneID:258920 MGI:3031014
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1180 transcript_id : NM_146918.1

name	Olfr1181 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801397 GeneID:258060 MGI:3031015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1181 transcript_id : NM_001011816.1

name	Olfr1182 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372147 GeneID:258167 MGI:3031016
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1182 transcript_id : NM_001011535.1

name	Olfr1183 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983490 GeneID:258522 MGI:3031017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1183 transcript_id : NM_146529.2

name	Olfr1184 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129210 GeneID:258820 MGI:3031018
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1184 transcript_id : NM_146823.1

name	Olfr1186 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239039 GeneID:258523 MGI:3031020
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1186 transcript_id : NM_146530.1

name	Olfr1188 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129052 GeneID:258921 MGI:3031022
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1188 transcript_id : NM_146919.1

name	Olfr1189 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735419 GeneID:258768 MGI:3031023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1189 transcript_id : NM_146772.2

name	Olfr1193 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58696423 GeneID:329460 MGI:3031027
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1193 transcript_id : NM_001011517.1

name	Olfr1195 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129338 GeneID:258748 MGI:3031029
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1195 transcript_id : NM_146753.1

name	Olfr1196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582638 GeneID:258456 MGI:3031030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1196 transcript_id : NM_146464.2

name	Olfr1197 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61806455 GeneID:433449 MGI:3031031
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1197 transcript_id : NM_001005225.1

name	Olfr1198 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430593 GeneID:404330 MGI:3031032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1198 transcript_id : NM_207567.1

name	Olfr1199 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239037 GeneID:258450 MGI:3031033
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1199 transcript_id : NM_146458.1

name	Olfr1200 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421323 GeneID:257887 MGI:3031034
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1200 transcript_id : NM_001005227.1

name	Olfr1201 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129092 GeneID:258897 MGI:3031035
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1201 transcript_id : NM_146895.1

name	Olfr1202 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239029 GeneID:258454 MGI:3031036
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1202 transcript_id : NM_146462.1

name	Olfr1203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129094 GeneID:258898 MGI:3031037
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1203 transcript_id : NM_146896.1

name	Olfr1204 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671323 GeneID:258455 MGI:3031038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1204 transcript_id : NM_146463.2

name	Olfr1206 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174761 GeneID:258896 MGI:3031040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1206 transcript_id : NM_001001810.2

name	Olfr1208 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129290 GeneID:258774 MGI:3031042
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1208 transcript_id : NM_146778.1

name	Olfr1209 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239035 GeneID:258453 MGI:3031043
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1209 transcript_id : NM_146461.1

name	Olfr1211 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801373 GeneID:258025 MGI:3031045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1211 transcript_id : NM_001011804.1

name	Olfr1212 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369488 GeneID:258241 MGI:3031046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1212 transcript_id : NM_207140.1

name	Olfr1213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129090 GeneID:258900 MGI:3031047
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1213 transcript_id : NM_146898.1

name	Olfr1214 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583724 GeneID:258899 MGI:3031048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1214 transcript_id : NM_146897.2

name	Olfr1215 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239023 GeneID:258451 MGI:3031049
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1215 transcript_id : NM_146459.1

name	Olfr1216 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583726 GeneID:258895 MGI:3031050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1216 transcript_id : NM_146893.2

name	Olfr1217 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129080 GeneID:258903 MGI:3031051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1217 transcript_id : NM_146901.1

name	Olfr1218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983593 GeneID:258815 MGI:3031052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1218 transcript_id : NM_146818.2

name	Olfr1219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129084 GeneID:258901 MGI:3031053
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1219 transcript_id : NM_146899.1

name	Olfr1220 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129086 GeneID:258902 MGI:3031054
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1220 transcript_id : NM_146900.1

name	Olfr1221 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129082 GeneID:258904 MGI:3031055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1221 transcript_id : NM_146902.1

name	Olfr1222 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801477 GeneID:258177 MGI:3031056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1222 transcript_id : NM_001011860.1

name	Olfr1223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983591 GeneID:258894 MGI:3031057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1223 transcript_id : NM_146892.2

name	Olfr1225 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129100 GeneID:258893 MGI:3031059
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1225 transcript_id : NM_146891.1

name	Olfr1226 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128992 GeneID:258969 MGI:3031060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1226 transcript_id : NM_146967.1

name	LOC100042983 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249909 GeneID:100042983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042983 transcript_id : XM_001478414.1

name	Olfr1228 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128984 GeneID:258973 MGI:3031062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1228 transcript_id : NM_146971.1

name	Olfr1229 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801309 GeneID:257921 MGI:3031063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1229 transcript_id : NM_001011761.1

name	Olfr1230 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129270 GeneID:258785 MGI:3031064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1230 transcript_id : NM_146789.1

name	Olfr1231 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239025 GeneID:258446 MGI:3031065
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1231 transcript_id : NM_146454.1

name	Olfr1232 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129650 GeneID:258320 MGI:3031066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1232 transcript_id : NM_146323.1

name	Olfr1233 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128986 GeneID:258974 MGI:3031067
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1233 transcript_id : NM_146972.1

name	Olfr1234 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128980 GeneID:258975 MGI:3031068
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1234 transcript_id : NM_146973.1

name	Olfr1238 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129272 GeneID:258786 MGI:3031072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1238 transcript_id : NM_146790.1

name	Olfr1239 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128990 GeneID:258972 MGI:3031073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1239 transcript_id : NM_146970.1

name	Olfr1240 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129238 GeneID:258804 MGI:3031074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1240 transcript_id : NM_146808.1

name	Olfr1241 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239033 GeneID:258447 MGI:3031075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1241 transcript_id : NM_146455.1

name	Olfr1242 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128994 GeneID:258970 MGI:3031076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1242 transcript_id : NM_146968.1

name	Olfr1243 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128988 GeneID:258971 MGI:3031077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1243 transcript_id : NM_146969.1

name	Olfr1245 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129276 GeneID:258784 MGI:3031079
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1245 transcript_id : NM_146788.1

name	Olfr1246 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129268 GeneID:258788 MGI:3031080
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1246 transcript_id : NM_146792.1

name	Olfr1247 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128998 GeneID:258968 MGI:3031081
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1247 transcript_id : NM_146966.1

name	Olfr1248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129266 GeneID:258787 MGI:3031082
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1248 transcript_id : NM_146791.1

name	Olfr1249 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801357 GeneID:257984 MGI:3031083
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1249 transcript_id : NM_001011796.1

name	Olfr1250 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128996 GeneID:258967 MGI:3031084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1250 transcript_id : NM_146965.1

name	Olfr1251 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372137 GeneID:259145 MGI:3031085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1251 transcript_id : NM_001011529.1

name	Olfr1252 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430587 GeneID:404331 MGI:3031086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1252 transcript_id : NM_207568.1

name	Olfr1254 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239031 GeneID:258468 MGI:3031088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1254 transcript_id : NM_146476.1

name	Olfr1255 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128978 GeneID:258979 MGI:3031089
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1255 transcript_id : NM_146977.1

name	Olfr1256 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128964 GeneID:258985 MGI:3031090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1256 transcript_id : NM_146983.1

name	Olfr48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778831 GeneID:18347 MGI:1333765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 48 transcript_id : NM_010990.1

name	Olfr1257 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227473 GeneID:258984 MGI:3031091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1257 transcript_id : NM_146982.1

name	Olfr1258 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128972 GeneID:258980 MGI:3031092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1258 transcript_id : NM_146978.1

name	Olfr1259 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129615 GeneID:258338 MGI:3031093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1259 transcript_id : NM_146341.1

name	Olfr1260 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128970 GeneID:258983 MGI:3031094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1260 transcript_id : NM_146981.1

name	Olfr1261 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27883863 GeneID:258466 MGI:3031095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1261 transcript_id : NM_146474.1

name	Olfr1262 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128982 GeneID:258976 MGI:3031096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1262 transcript_id : NM_146974.1

name	Olfr1263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129264 GeneID:258790 MGI:3031097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1263 transcript_id : NM_146794.1

name	Olfr1264 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11496248 GeneID:258206 MGI:3031098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1264 transcript_id : NM_021368.1

name	Olfr1265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129611 GeneID:258340 MGI:3031099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1265 transcript_id : NM_146343.1

name	Olfr1155 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239198 CCDS:CCDS16316.1 GeneID:258636 MGI:3030989
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49426894-49425950; olfactory receptor MOR174-10 product : olfactory receptor 1155 protein_id : NP_666854.1

name	Olfr1156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286814 GeneID:258814 MGI:3030990
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49433499-49432537; olfactory receptor MOR174-3 product : olfactory receptor 1156 protein_id : NP_667028.2

name	Olfr1157 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129165 CCDS:CCDS16317.1 GeneID:258846 MGI:3030991
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49446395-49445457; olfactory receptor MOR174-1 product : olfactory receptor 1157 protein_id : NP_667060.1

name	Olfr74 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821675 CCDS:CCDS16318.1 GeneID:117005 MGI:2151909
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005549 - odorant binding [Evidence IDA]; GO:0004984 - olfactory receptor activity [Evidence IDA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IDA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49458388-49457432; olfactory receptor MOR174-4 product : olfactory receptor 74 protein_id : NP_473432.2

name	Olfr1158 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239204 CCDS:CCDS16319.1 GeneID:258639 MGI:3030992
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49480812-49481753; olfactory receptor MOR173-3 product : olfactory receptor 1158 protein_id : NP_666856.1

name	Olfr1160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983622 CCDS:CCDS16320.1 GeneID:258643 MGI:3030994
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49498697-49497765; olfactory receptor MOR173-1 product : olfactory receptor 1160 protein_id : NP_666860.2

name	Olfr1161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129171 CCDS:CCDS16321.1 GeneID:258845 MGI:3030995
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49516664-49517629; olfactory receptor MOR174-2 product : olfactory receptor 1161 protein_id : NP_667059.1

name	Olfr73 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905123 CCDS:CCDS16322.1 GeneID:117004 MGI:2151908
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005549 - odorant binding [Evidence IDA]; GO:0004984 - olfactory receptor activity [Evidence IDA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IDA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IDA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49527073-49526132; olfactory receptor MOR174-9 product : olfactory receptor 73 protein_id : NP_473431.1

name	Olfr1162 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801434 CCDS:CCDS16323.1 GeneID:258105 MGI:3030996
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49542541-49541597; olfactory receptor MOR174-14 product : olfactory receptor 1162 protein_id : NP_001011835.1

name	Olfr1163 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239190 CCDS:CCDS16324.1 GeneID:258638 MGI:3030997
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49563265-49562315; olfactory receptor MOR174-8 product : olfactory receptor 1163 protein_id : NP_666855.1

name	Olfr1164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380651 CCDS:CCDS16325.1 GeneID:258634 MGI:3030998
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49585842-49584862; olfactory receptor MOR174-11 product : olfactory receptor 1164 protein_id : NP_666852.1

name	Olfr1165 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239188 GeneID:258642 MGI:3030999
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-49593880-49592930; olfactory receptor MOR174-7 product : olfactory receptor 1165 protein_id : NP_666859.1

name	Olfr1166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56118305 CCDS:CCDS16326.1 GeneID:258644 MGI:3031000
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49616865-49615915; olfactory receptor MOR174-6 product : olfactory receptor 1166 protein_id : NP_666861.2

name	Olfr1167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129697 CCDS:CCDS16327.1 GeneID:258291 MGI:3031001
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49641892-49640942; olfactory receptor MOR174-16 product : olfactory receptor 1167 protein_id : NP_666406.1

name	Olfr1168 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239194 CCDS:CCDS16328.1 GeneID:258524 MGI:3031002
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49669483-49670421; olfactory receptor MOR174-13 product : olfactory receptor 1168 protein_id : NP_666742.1

name	Olfr1170 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239200 CCDS:CCDS16329.1 GeneID:258525 MGI:3031004
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49709783-49708833; olfactory receptor MOR174-12 product : olfactory receptor 1170 protein_id : NP_666743.1

name	Olfr1173 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430584 CCDS:CCDS16330.1 GeneID:404329 MGI:3031007
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MOR174-20_p; GA_x6K02T2Q125-49759783-49758845 product : olfactory receptor 1173 protein_id : NP_997449.1

name	Olfr1174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249886 GeneID:546769 MGI:3031008
definition	codon_start : 1 product : olfactory receptor 1174 protein_id : XP_621554.4

name	Olfr1175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249888 GeneID:546770 MGI:3031009
definition	codon_start : 1 product : olfactory receptor 1175 protein_id : XP_621555.3

name	Olfr1176 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129309 CCDS:CCDS16331.1 GeneID:258767 MGI:3031010
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49824309-49825256; olfactory receptor MOR174-5 product : olfactory receptor 1176 protein_id : NP_666982.1

name	Olfr1177 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249890 GeneID:545443 MGI:3031011
definition	codon_start : 1 product : olfactory receptor 1177 protein_id : XP_619781.4

name	Olfr1178 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801498 CCDS:CCDS16332.1 GeneID:258203 MGI:3031012
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49870417-49871388; olfactory receptor MOR225-6P product : olfactory receptor 1178 protein_id : NP_001011868.1

name	Olfr1179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735416 CCDS:CCDS16333.1 GeneID:258919 MGI:3031013
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49890854-49889931; olfactory receptor MOR225-2 product : olfactory receptor 1179 protein_id : NP_667128.2

name	Olfr1180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129059 CCDS:CCDS16334.1 GeneID:258920 MGI:3031014
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-49900552-49899623; olfactory receptor MOR225-1 product : olfactory receptor 1180 protein_id : NP_667129.1

name	Olfr1181 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801398 CCDS:CCDS16335.1 GeneID:258060 MGI:3031015
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49911636-49910701; olfactory receptor MOR225-9P product : olfactory receptor 1181 protein_id : NP_001011816.1

name	Olfr1182 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372148 CCDS:CCDS16336.1 GeneID:258167 MGI:3031016
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49934557-49933640; MOR225-16_p; olfactory receptor MOR225-7P product : olfactory receptor 1182 protein_id : NP_001011535.1

name	Olfr1183 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239042 CCDS:CCDS16337.1 GeneID:258522 MGI:3031017
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49948903-49949814; olfactory receptor MOR230-6 product : olfactory receptor 1183 protein_id : NP_666740.1

name	Olfr1184 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129211 CCDS:CCDS16338.1 GeneID:258820 MGI:3031018
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-49974190-49975125; olfactory receptor MOR225-3 product : olfactory receptor 1184 protein_id : NP_667034.1

name	Olfr1186 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239040 CCDS:CCDS16339.1 GeneID:258523 MGI:3031020
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50012960-50013871; olfactory receptor MOR230-5 product : olfactory receptor 1186 protein_id : NP_666741.1

name	Olfr1188 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129053 CCDS:CCDS16340.1 GeneID:258921 MGI:3031022
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50046879-50047784; olfactory receptor MOR238-2 product : olfactory receptor 1188 protein_id : NP_667130.1

name	Olfr1189 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735420 CCDS:CCDS16341.1 GeneID:258768 MGI:3031023
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50079044-50079964; olfactory receptor MOR237-2 product : olfactory receptor 1189 protein_id : NP_666983.2

name	Olfr1193 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58696424 CCDS:CCDS16342.1 GeneID:329460 MGI:3031027
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50154044-50154826; olfactory receptor MOR226-1; olfactory receptor 1193, pseudogene 1 product : olfactory receptor 1193 protein_id : NP_001011517.1

name	Olfr1195 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129339 CCDS:CCDS16343.1 GeneID:258748 MGI:3031029
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50163514-50162588; MOR230-12_p; olfactory receptor MOR230-4 product : olfactory receptor 1195 protein_id : NP_666964.1

name	Olfr1196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582639 CCDS:CCDS16344.1 GeneID:258456 MGI:3031030
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50181139-50180195; olfactory receptor MOR225-5 product : olfactory receptor 1196 protein_id : NP_666675.2

name	Olfr1197 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61806456 CCDS:CCDS16345.1 GeneID:433449 MGI:3031031
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50202854-50201910 product : olfactory receptor 1197 protein_id : NP_001005225.1

name	Olfr1198 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430594 CCDS:CCDS16346.1 GeneID:404330 MGI:3031032
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50221692-50220766 product : olfactory receptor 1198 protein_id : NP_997450.1

name	Olfr1199 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239038 CCDS:CCDS16347.1 GeneID:258450 MGI:3031033
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50231574-50230642; olfactory receptor MOR230-8 product : olfactory receptor 1199 protein_id : NP_666669.1

name	Olfr1200 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421324 CCDS:CCDS16348.1 GeneID:257887 MGI:3031034
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50243231-50242221 product : olfactory receptor 1200 protein_id : NP_001005227.1

name	Olfr1201 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129093 CCDS:CCDS16349.1 GeneID:258897 MGI:3031035
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50268830-50269753; olfactory receptor MOR230-2 product : olfactory receptor 1201 protein_id : NP_667106.1

name	Olfr1202 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239030 CCDS:CCDS16350.1 GeneID:258454 MGI:3031036
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50290367-50291296; olfactory receptor MOR232-7 product : olfactory receptor 1202 protein_id : NP_666673.1

name	Olfr1203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129095 CCDS:CCDS16351.1 GeneID:258898 MGI:3031037
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50304328-50305251; olfactory receptor MOR230-1 product : olfactory receptor 1203 protein_id : NP_667107.1

name	Olfr1204 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671324 CCDS:CCDS16352.1 GeneID:258455 MGI:3031038
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50322618-50323547; olfactory receptor MOR232-6 product : olfactory receptor 1204 protein_id : NP_666674.2

name	Olfr1206 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174762 CCDS:CCDS16353.1 GeneID:258896 MGI:3031040
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50338497-50339264; olfactory receptor MOR230-3; olfactory receptor 1206, pseudogene 1 product : olfactory receptor 1206 protein_id : NP_001001810.2

name	Olfr1208 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129291 CCDS:CCDS16354.1 GeneID:258774 MGI:3031042
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50372411-50371485; olfactory receptor MOR225-4 product : olfactory receptor 1208 protein_id : NP_666989.1

name	Olfr1209 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239036 CCDS:CCDS16355.1 GeneID:258453 MGI:3031043
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50386882-50385950; olfactory receptor MOR230-7 product : olfactory receptor 1209 protein_id : NP_666672.1

name	Olfr1211 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801374 CCDS:CCDS16356.1 GeneID:258025 MGI:3031045
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50409367-50408432; olfactory receptor MOR233-16P product : olfactory receptor 1211 protein_id : NP_001011804.1

name	Olfr1212 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369489 CCDS:CCDS16357.1 GeneID:258241 MGI:3031046
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50437014-50437949; olfactory receptor MOR233-17 product : olfactory receptor 1212 protein_id : NP_997023.1

name	Olfr1213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129091 CCDS:CCDS16358.1 GeneID:258900 MGI:3031047
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50452032-50451097; olfactory receptor MOR233-7 product : olfactory receptor 1213 protein_id : NP_667109.1

name	Olfr1214 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583725 CCDS:CCDS16359.1 GeneID:258899 MGI:3031048
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50468705-50467770; olfactory receptor MOR233-8 product : olfactory receptor 1214 protein_id : NP_667108.2

name	Olfr1215 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239024 CCDS:CCDS16360.1 GeneID:258451 MGI:3031049
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50482823-50481885; olfactory receptor MOR233-13 product : olfactory receptor 1215 protein_id : NP_666670.1

name	Olfr1216 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583727 CCDS:CCDS16361.1 GeneID:258895 MGI:3031050
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50494588-50493653; olfactory receptor MOR233-9 product : olfactory receptor 1216 protein_id : NP_667104.2

name	Olfr1217 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129081 CCDS:CCDS16362.1 GeneID:258903 MGI:3031051
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50504545-50503631; olfactory receptor MOR233-4 product : olfactory receptor 1217 protein_id : NP_667112.1

name	Olfr1218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983594 CCDS:CCDS16363.1 GeneID:258815 MGI:3031052
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50536041-50535106; olfactory receptor MOR233-12 product : olfactory receptor 1218 protein_id : NP_667029.2

name	Olfr1219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129085 CCDS:CCDS16364.1 GeneID:258901 MGI:3031053
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50555603-50554668; olfactory receptor MOR233-6 product : olfactory receptor 1219 protein_id : NP_667110.1

name	Olfr1220 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129087 CCDS:CCDS16365.1 GeneID:258902 MGI:3031054
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50579531-50578596; olfactory receptor MOR233-5 product : olfactory receptor 1220 protein_id : NP_667111.1

name	Olfr1221 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129083 CCDS:CCDS16366.1 GeneID:258904 MGI:3031055
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50591144-50590209; olfactory receptor MOR233-3 product : olfactory receptor 1221 protein_id : NP_667113.1

name	Olfr1222 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801478 CCDS:CCDS16367.1 GeneID:258177 MGI:3031056
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50604368-50603433; olfactory receptor MOR233-14 product : olfactory receptor 1222 protein_id : NP_001011860.1

name	Olfr1223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983592 CCDS:CCDS16368.1 GeneID:258894 MGI:3031057
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50623664-50622729; olfactory receptor MOR233-10 product : olfactory receptor 1223 protein_id : NP_667103.2

name	Olfr1225 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129101 CCDS:CCDS16369.1 GeneID:258893 MGI:3031059
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50650037-50649102; olfactory receptor MOR233-11 product : olfactory receptor 1225 protein_id : NP_667102.1

name	Olfr1226 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128993 CCDS:CCDS16370.1 GeneID:258969 MGI:3031060
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50672630-50671698; olfactory receptor MOR233-2 product : olfactory receptor 1226 protein_id : NP_667178.1

name	LOC100042983 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249910 GeneID:100042983
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478464.1

name	Olfr1228 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128985 CCDS:CCDS16371.1 GeneID:258973 MGI:3031062
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50696209-50695274; olfactory receptor MOR233-1 product : olfactory receptor 1228 protein_id : NP_667182.1

name	Olfr1229 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801310 CCDS:CCDS16372.1 GeneID:257921 MGI:3031063
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50727797-50726862; olfactory receptor MOR233-19 product : olfactory receptor 1229 protein_id : NP_001011761.1

name	Olfr1230 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129271 CCDS:CCDS16373.1 GeneID:258785 MGI:3031064
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50741934-50741017; olfactory receptor MOR237-1 product : olfactory receptor 1230 protein_id : NP_667000.1

name	Olfr1231 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239026 CCDS:CCDS16374.1 GeneID:258446 MGI:3031065
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50748233-50747292; olfactory receptor MOR235-2 product : olfactory receptor 1231 protein_id : NP_666665.1

name	Olfr1232 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129651 CCDS:CCDS16375.1 GeneID:258320 MGI:3031066
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50770831-50769896; olfactory receptor MOR233-18 product : olfactory receptor 1232 protein_id : NP_666435.1

name	Olfr1233 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128987 CCDS:CCDS16376.1 GeneID:258974 MGI:3031067
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50784973-50784056; olfactory receptor MOR238-1 product : olfactory receptor 1233 protein_id : NP_667183.1

name	Olfr1234 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128981 CCDS:CCDS16377.1 GeneID:258975 MGI:3031068
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-50805620-50804676; olfactory receptor MOR231-2 product : olfactory receptor 1234 protein_id : NP_667184.1

name	Olfr1238 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129273 CCDS:CCDS16378.1 GeneID:258786 MGI:3031072
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50849945-50848998; olfactory receptor MOR231-11 product : olfactory receptor 1238 protein_id : NP_667001.1

name	Olfr1239 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128991 CCDS:CCDS16379.1 GeneID:258972 MGI:3031073
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50861284-50860367; olfactory receptor MOR231-3 product : olfactory receptor 1239 protein_id : NP_667181.1

name	Olfr1240 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129239 CCDS:CCDS16380.1 GeneID:258804 MGI:3031074
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50883183-50882239; olfactory receptor MOR231-8 product : olfactory receptor 1240 protein_id : NP_667019.1

name	Olfr1241 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239034 CCDS:CCDS16381.1 GeneID:258447 MGI:3031075
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50926215-50925271; olfactory receptor MOR231-14 product : olfactory receptor 1241 protein_id : NP_666666.1

name	Olfr1242 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128995 CCDS:CCDS16382.1 GeneID:258970 MGI:3031076
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50937307-50936387; olfactory receptor MOR231-5 product : olfactory receptor 1242 protein_id : NP_667179.1

name	Olfr1243 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128989 CCDS:CCDS16383.1 GeneID:258971 MGI:3031077
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-50972538-50971621; olfactory receptor MOR231-4 product : olfactory receptor 1243 protein_id : NP_667180.1

name	Olfr1245 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129277 CCDS:CCDS16384.1 GeneID:258784 MGI:3031079
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51020951-51020028; olfactory receptor MOR231-12 product : olfactory receptor 1245 protein_id : NP_666999.1

name	Olfr1246 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129269 CCDS:CCDS16385.1 GeneID:258788 MGI:3031080
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51034790-51033846; olfactory receptor MOR231-9 product : olfactory receptor 1246 protein_id : NP_667003.1

name	Olfr1247 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128999 CCDS:CCDS16386.1 GeneID:258968 MGI:3031081
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51051555-51050611; olfactory receptor MOR231-6 product : olfactory receptor 1247 protein_id : NP_667177.1

name	Olfr1248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129267 CCDS:CCDS16387.1 GeneID:258787 MGI:3031082
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51059648-51058725; olfactory receptor MOR231-10 product : olfactory receptor 1248 protein_id : NP_667002.1

name	Olfr1249 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801358 CCDS:CCDS16388.1 GeneID:257984 MGI:3031083
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51072323-51071367; MOR231-25_p; olfactory receptor MOR231-17P product : olfactory receptor 1249 protein_id : NP_001011796.1

name	Olfr1250 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128997 CCDS:CCDS16389.1 GeneID:258967 MGI:3031084
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51098877-51097933; olfactory receptor MOR231-7 product : olfactory receptor 1250 protein_id : NP_667176.1

name	Olfr1251 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372138 CCDS:CCDS16390.1 GeneID:259145 MGI:3031085
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51109312-51108356; MOR231-24_p; olfactory receptor MOR231-15P product : olfactory receptor 1251 protein_id : NP_001011529.1

name	Olfr1252 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430588 CCDS:CCDS16391.1 GeneID:404331 MGI:3031086
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MOR231-22_p; GA_x6K02T2Q125-51162884-51161940 product : olfactory receptor 1252 protein_id : NP_997451.1

name	Olfr1254 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239032 CCDS:CCDS16392.1 GeneID:258468 MGI:3031088
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51230155-51229211; olfactory receptor MOR231-13 product : olfactory receptor 1254 protein_id : NP_666687.1

name	Olfr1255 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128979 CCDS:CCDS16393.1 GeneID:258979 MGI:3031089
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-51257221-51258135; olfactory receptor MOR232-4 product : olfactory receptor 1255 protein_id : NP_667188.1

name	Olfr1256 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128965 CCDS:CCDS16394.1 GeneID:258985 MGI:3031090
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51276848-51275928; olfactory receptor MOR231-1 product : olfactory receptor 1256 protein_id : NP_667194.1

name	Olfr48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778832 CCDS:CCDS16395.1 GeneID:18347 MGI:1333765
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR232-5; GA_x6K02T2Q125-51285881-51284976 product : olfactory receptor 48 protein_id : NP_035120.1

name	Olfr1257 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227474 CCDS:CCDS16396.1 GeneID:258984 MGI:3031091
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51319458-51320387; olfactory receptor MOR232-1 product : olfactory receptor 1257 protein_id : NP_667193.1

name	Olfr1258 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128973 CCDS:CCDS16397.1 GeneID:258980 MGI:3031092
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51361752-51362687; olfactory receptor MOR232-3 product : olfactory receptor 1258 protein_id : NP_667189.1

name	Olfr1259 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129616 CCDS:CCDS16398.1 GeneID:258338 MGI:3031093
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51376062-51375133; olfactory receptor MOR232-9 product : olfactory receptor 1259 protein_id : NP_666453.1

name	Olfr1260 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128971 CCDS:CCDS16399.1 GeneID:258983 MGI:3031094
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51409740-51410672; olfactory receptor MOR232-2 product : olfactory receptor 1260 protein_id : NP_667192.1

name	Olfr1261 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27883864 CCDS:CCDS16400.1 GeneID:258466 MGI:3031095
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51425355-51426275; olfactory receptor MOR234-3 product : olfactory receptor 1261 protein_id : NP_666685.1

name	Olfr1262 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128983 CCDS:CCDS16401.1 GeneID:258976 MGI:3031096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51434523-51435437; olfactory receptor MOR234-1 product : olfactory receptor 1262 protein_id : NP_667185.1

name	Olfr1263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129265 CCDS:CCDS16402.1 GeneID:258790 MGI:3031097
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51447049-51447969; olfactory receptor MOR234-2 product : olfactory receptor 1263 protein_id : NP_667005.1

name	Olfr1264 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11496249 CCDS:CCDS16403.1 GeneID:258206 MGI:3031098
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51454183-51453257; odorant receptor 16; olfactory receptor MOR236-1 product : olfactory receptor 1264 protein_id : NP_067343.1

name	Olfr1265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129612 CCDS:CCDS16404.1 GeneID:258340 MGI:3031099
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-51469027-51469956; olfactory receptor MOR228-2 product : olfactory receptor 1265 protein_id : NP_666455.1

name	LOC668528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668528
definition	number : 1 pseudo : _no_value

name	LOC668528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668528
definition	number : 2 pseudo : _no_value

name	LOC668528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668528
definition	number : 3 pseudo : _no_value

name	LOC435676 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435676
definition	number : 1 pseudo : _no_value

clone name	MSMg01-148M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497A11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-386I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544O11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-104G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-362J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-387G07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-415G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-452K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311E03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-159E05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447N01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-120D19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-271B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-378B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-097C14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-191E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386M10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096D10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-112G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270B09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-080N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-498F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464D23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-422D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-215N06.b	B6Ng01-215N06.g
ACC	GA032681	GA032682
length	643	1,104
definition	B6Ng01-215N06.b	B6Ng01-215N06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(88,777,018 - 88,777,660)	(88,878,700 - 88,879,808)
sequence	gaattctctatttttcttctcttaataatttatatacctttaggagacaa tgtgatgcctaaaacaccaacctagttcagaacatcggcagcttcacatt ctgaacagttctgggatgaggacctggtggtctttatgagtgcagtcacc gcagaatggaagaattaagaggacatgatgagaccaacagcttgagtcac tcttatatttagtgttctccattctgtatgtcagtatgtggttgtggata aagcacattttatgttctctagcaataactacatagggtagagcatcgct tctgtctctatgattctgccaatatactttatagtttcaaagcatgctaa atttatttttagaaaaatagagtgatgaaaacattagtatactagaccaa tgagattgtgtttgtaacacttaaagtcctacttagataagatagaaaat gttcatttagtgaatttttagtttgtctggtttcaagctaaaagaaacat ttttatttgtaacaattaaagagctttttacaaacatggttagaagaaaa ttttttaaaaaggagaagaaataaaatatggagggaagaaaggaaggaag aggaaggaaagggaaggaagaaaagatggaaggaaggaaggaa	gaattcagcatagagacacactattggcttattcaaacatcagcagaaaa attatatgtacatgcagggtatcagagttctgtgaattgttgactcagtt cagaaagccctgttatgtcctcacattcctctttatctttatggtcaagc tgttcccaggaatgttttaactatggggcatgcccgggtttgtttttctt tattctcagccccaggcagcctctaggctcacaaacaaaaagcaatttct gagtactttatatgaattacaggtcttgaaatttcatctttctttcacag ttaaggagggattttgactctattatttcttctttatccttaaagtataa ttaaggctgtgtgagaggaacattggcaacattctccatcttcactagta tatttcttattatggaatgaaaaattggctacaaatattgccttttcgtc aatactcaatggaattttcttcatagagaataagaactagccatctctag atatttcaccaaaacattgcatggtaggactgataaatataattttatat ttttagaaatattttaattatgaaaaggtgctttgcatttgttttgtggt caggacattatgtgtttaatgaaaacattgagtttttttctgcataactg ggtacacaagggcatcacatacttataccttttttgtaacccaaatcaag acacacagaagttagtaaaagtatagaagaacacaagaaagtagcactta aaggtagtaacaacctaagtccaaaaatatttgttatagagccaagtcct ctctgccttctctccccattttcttccttgcttccttctttatttccttc catccttcctcccttcattttctttgcaatatactttgcttgctttctaa gtacatattcaactctagtgaataaagtcatctttcctgtttgaatataa atgtgaaatttcttgagactgtataaaggatattggttaaagggtgatgg tacatcaatacacttgataactcgacgaataatgtaaacaaaataacgtt tgttttacacttgtttatatgacactcatactgagaaactaagggaacat gatc
quality values	Open. Hide. 62 31 31 37 62 62 62 62 47 62 54 62 62 62 62 62 62 62 62 62 62 62 44 62 62 62 62 62 62 24 14 16 18 13 18 14 18 18 18 18 17 18 23 25 54 62 59 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 54 35 46 43 38 25 48 45 32 28 45 32 28 46 51 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 54 62 62 54 59 59 54 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 34 38 62 62 62 62 62 62 62 62 62 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 46 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 43 54 58 58 58 58 51 58 58 58 58 58 58 58 58 58 58 51 58 58 58 49 58 58 47 41 58 58 58 51 58 40 58 58 58 49 58 54 58 58 58 58 58 58 58 52 58 51 58 50 58 58 58 58 52 47 33 58 58 50 58 58 58 58 58 50 58 43 43 39 41 14 8	Open. Hide. 62 49 56 59 62 59 43 59 45 43 26 19 10 25 13 28 43 30 27 25 25 23 28 36 48 54 54 62 62 59 62 62 62 59 49 54 62 59 59 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 56 46 35 48 34 48 43 31 28 28 49 42 33 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 59 54 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 59 62 54 42 54 62 62 62 62 62 62 62 54 54 62 54 54 62 54 49 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 49 49 49 62 62 62 62 62 62 62 62 62 62 62 49 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 54 46 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 39 54 58 54 58 58 58 58 58 58 54 58 58 31 54 52 54 58 58 58 58 52 58 58 54 54 58 58 58 58 58 58 54 42 58 58 58 58 58 58 58 54 58 58 58 51 51 58 58 58 58 53 58 58 46 58 51 51 58 58 42 49 51 58 50 51 58 58 58 49 58 58 35 58 58 58 49 58 58 58 48 50 47 58 58 58 52 53 51 58 58 58 58 58 53 53 38 37 41 39 33 58 48 49 58 58 49 46 52 50 49 58 22 50 54 58 30 50 52 54 52 50 49 40 58 41 51 58 58 41 54 32 58 50 52 58 58 58 58 40 52 33 41 20 42 44 51 24 54 49 50 45 29 50 50 47 32 38 49 38 49 41 35 26 35 26 45 53 39 41 32 26 54 54 51 32 39 31 32 38 39 42 53 26 52 36 39 32 50 35 35 34 53 54 32 33 33 33 31 45 40 33 35 52 34 54 30 47 42 31 45 32 33 37 37 45 28 33 28 30 40 35 33 27 21 15 13 9 52 52 49 32 39 30 30 52 49 31 28 51 32 32 32 21 53 26 31 33 12 38 22 18 20 51 34 31 26 28 32 35 26 33 32 30 34 30 35 30 31 46 46 28 33 31 51 51 32 40 19 31 27 36 22 31 32 23 23 17 19 33 28 30 30 30 51 30 30 19 46 31 29 42 19 31 31 42 25 26 26 46 16 27 23 32 23 31 41 24 25 27 27 26 30 46 46 28 34 25 41 24 15 12 18 31 26 46 21 31 31 37 47 20 29 27 28 16 32 24 39 47 26 20 31 27 26 13 30 30 32 32 31 29 14 10 27 23 32 32 38 31 30 27 35 35 31 37 16 7 9 30 26 32 16 32 22 26 13 22 36 28 20 24 18 26 20 48 31 28 30 9 10 10 16 21 48 29 26 31 15 26 28 48 31 23 47 29 30 20 12 22 19 11 26 16 17 33 10 13 11 11 37 9 23 10 14 12 10 6 20 14 17 4 5 20 33 21 19 39 26 5 6 17 12 14 25 6 7 25 8 31 25 17 13 17 19 17 7 21 7 7 7 7 13 11 25 11 6 7 6 10 28 9 31 19 5 5 8 25 18 14 24 28 5 6 15 30 28 23 23 11 4 4 8 18 40 14 7 6 34 34 21 19 7 6 18 13 13 9 7 22 7 7 11 7 20 9 7 7 15 9 4 19 5 16 7 25 7 8 19 4 5 27 13 2 8 16 6 17 29 11 11 13 4 4 4 7 12 9 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_88777018_88777660
seq2: B6Ng01-215N06.b_44_686

seq1  GAATTCTCTATTTTTCTTCTCTTAATAATTTATATACCTTTAGGAGACAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTATTTTTCTTCTCTTAATAATTTATATACCTTTAGGAGACAA  50

seq1  TGTGATGCCTAAAACACCAACCTAGTTCAGAACATCGGCAGCTTCACATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGATGCCTAAAACACCAACCTAGTTCAGAACATCGGCAGCTTCACATT  100

seq1  CTGAACAGTTCTGGGATGAGGACCTGGTGGTCTTTATGAGTGCAGTCACC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAACAGTTCTGGGATGAGGACCTGGTGGTCTTTATGAGTGCAGTCACC  150

seq1  GCAGAATGGAAGAATTAAGAGGACATGATGAGACCAACAGCTTGAGTCAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAATGGAAGAATTAAGAGGACATGATGAGACCAACAGCTTGAGTCAC  200

seq1  TCTTATATTTAGTGTTCTCCATTCTGTATGTCAGTATGTGGTTGTGGATA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATATTTAGTGTTCTCCATTCTGTATGTCAGTATGTGGTTGTGGATA  250

seq1  AAGCACATTTTATGTTCTCTAGCAATAACTACATAGGGTAGAGCATCGCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCACATTTTATGTTCTCTAGCAATAACTACATAGGGTAGAGCATCGCT  300

seq1  TCTGTCTCTATGATTCTGCCAATATACTTTATAGTTTCAAAGCATGCTAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCTCTATGATTCTGCCAATATACTTTATAGTTTCAAAGCATGCTAA  350

seq1  ATTTATTTTTAGAAAAATAGAGTGATGAAAACATTAGTATACTAGACCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATTTTTAGAAAAATAGAGTGATGAAAACATTAGTATACTAGACCAA  400

seq1  TGAGATTGTGTTTGTAACACTTAAAGTCCTACTTAGATAAGATAGAAAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGATTGTGTTTGTAACACTTAAAGTCCTACTTAGATAAGATAGAAAAT  450

seq1  GTTCATTTAGTGAATTTTTAGTTTGTCTGGTTTCAAGCTAAAAGAAACAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCATTTAGTGAATTTTTAGTTTGTCTGGTTTCAAGCTAAAAGAAACAT  500

seq1  TTTTATTTGTAACAATTAAAGAGCTTTTTACAAACATGGTTAGAAGAAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATTTGTAACAATTAAAGAGCTTTTTACAAACATGGTTAGAAGAAAA  550

seq1  TTTTTTAAAAAGGAGAAGAAATAAAATATGGAGGGAAGAAAGGAAGGAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTAAAAAGGAGAAGAAATAAAATATGGAGGGAAGAAAGGAAGGAAG  600

seq1  AGGAAGGAAAGGGAAGGAAGAAAAGATGGAAGGAAGGAAGGAA  643
      |||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGGAAAGGGAAGGAAGAAAAGATGGAAGGAAGGAAGGAA  643

seq1: chr2_88878700_88879808
seq2: B6Ng01-215N06.g_69_1172 (reverse)

seq1  GATCATGTTCCCTTAGTTTTCTTCAGTATGGGTTGTCATATAA--CAGTG  48
      |||||||||||||||||||   |||||||| | ||||||||||   ||||
seq2  GATCATGTTCCCTTAGTTT--CTCAGTATGAG-TGTCATATAAACAAGTG  47

seq1  TAAAACAAACGTTTTATTTTTGTTTACAATATTTCGTCGAGTTTATC-AG  97
      |||||||||||||    ||||||||||| || ||||||||| ||||| ||
seq2  TAAAACAAACGTT---ATTTTGTTTACATTA-TTCGTCGAG-TTATCAAG  92

seq1  TGTATTGATGTACCATCACCCTTT-ACCAATATCCTTTATACAGTCTCAA  146
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  TGTATTGATGTACCATCACCCTTTAACCAATATCCTTTATACAGTCTCAA  142

seq1  GAAATTTCACATTTATATTCAAACAGGAAAGATGACTTTATTCACTAGAG  196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATTTCACATTTATATTCAAACAGGAAAGATGACTTTATTCACTAGAG  192

seq1  TTGAATATGTACTTAGAAAGCAAGCAAAGTATTATTGCAAAGAAAATGAA  246
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TTGAATATGTACTTAGAAAGCAAGCAAAGTA-TATTGCAAAGAAAATGAA  241

seq1  GGGAGGAAGGATGGAAGGAAATAAAGAAGGAAGCAAGGAAGAAAATGGGG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGAAGGATGGAAGGAAATAAAGAAGGAAGCAAGGAAGAAAATGGGG  291

seq1  AGAGAAGGCAGAGAGGACTTGGCTCTATAACAAATATTTTTGGACTTAGG  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAAGGCAGAGAGGACTTGGCTCTATAACAAATATTTTTGGACTTAGG  341

seq1  TTGTTACTACCTTTAAGTGCTACTTTCTTGTGTTCTTCTATACTTTTACT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTACTACCTTTAAGTGCTACTTTCTTGTGTTCTTCTATACTTTTACT  391

seq1  AACTTCTGTGTGTCTTGATTTGGGTTACAAAAAAGGTATAAGTATGTGAT  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTCTGTGTGTCTTGATTTGGGTTACAAAAAAGGTATAAGTATGTGAT  441

seq1  GCCCTTGTGTACCCAGTTATGCAGAAAAAAACTCAATGTTTTCATTAAAC  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTTGTGTACCCAGTTATGCAGAAAAAAACTCAATGTTTTCATTAAAC  491

seq1  ACATAATGTCCTGACCACAAAACAAATGCAAAGCACCTTTTCATAATTAA  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATAATGTCCTGACCACAAAACAAATGCAAAGCACCTTTTCATAATTAA  541

seq1  AATATTTCTAAAAATATAAAATTATATTTATCAGTCCTACCATGCAATGT  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATTTCTAAAAATATAAAATTATATTTATCAGTCCTACCATGCAATGT  591

seq1  TTTGGTGAAATATCTAGAGATGGCTAGTTCTTATTCTCTATGAAGAAAAT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGTGAAATATCTAGAGATGGCTAGTTCTTATTCTCTATGAAGAAAAT  641

seq1  TCCATTGAGTATTGACGAAAAGGCAATATTTGTAGCCAATTTTTCATTCC  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATTGAGTATTGACGAAAAGGCAATATTTGTAGCCAATTTTTCATTCC  691

seq1  ATAATAAGAAATATACTAGTGAAGATGGAGAATGTTGCCAATGTTCCTCT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATAAGAAATATACTAGTGAAGATGGAGAATGTTGCCAATGTTCCTCT  741

seq1  CACACAGCCTTAATTATACTTTAAGGATAAAGAAGAAATAATAGAGTCAA  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACAGCCTTAATTATACTTTAAGGATAAAGAAGAAATAATAGAGTCAA  791

seq1  AATCCCTCCTTAACTGTGAAAGAAAGATGAAATTTCAAGACCTGTAATTC  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCCTCCTTAACTGTGAAAGAAAGATGAAATTTCAAGACCTGTAATTC  841

seq1  ATATAAAGTACTCAGAAATTGCTTTTTGTTTGTGAGCCTAGAGGCTGCCT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAAAGTACTCAGAAATTGCTTTTTGTTTGTGAGCCTAGAGGCTGCCT  891

seq1  GGGGCTGAGAATAAAGAAAAACAAACCCGGGCATGCCCCATAGTTAAAAC  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGCTGAGAATAAAGAAAAACAAACCCGGGCATGCCCCATAGTTAAAAC  941

seq1  ATTCCTGGGAACAGCTTGACCATAAAGATAAAGAGGAATGTGAGGACATA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCTGGGAACAGCTTGACCATAAAGATAAAGAGGAATGTGAGGACATA  991

seq1  ACAGGGCTTTCTGAACTGAGTCAACAATTCACAGAACTCTGATACCCTGC  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGGCTTTCTGAACTGAGTCAACAATTCACAGAACTCTGATACCCTGC  1041

seq1  ATGTACATATAATTTTTCTGCTGATGTTTGAATAAGCCAATAGTGTGTCT  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTACATATAATTTTTCTGCTGATGTTTGAATAAGCCAATAGTGTGTCT  1091

seq1  CTATGCTGAATTC  1109
      |||||||||||||
seq2  CTATGCTGAATTC  1104

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information