MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-228M06
Chromosome	2 (Build37)
Map Location	84,689,952 - 84,844,492
singlet/doublet	doublet
Overlap gene	Slc43a1, Rtn4rl2, Slc43a3, Prg2, Prg3, P2rx3
Upstream gene	D430039N05Rik, Zswim2, LOC668096, LOC668100, LOC545432, LOC668107, LOC668113, LOC668115, LOC668119, LOC383725, Calcrl, Tfpi, LOC672763, Ctnnd1, 2700094K13Rik, Txndc14, Med19, Zdhhc5, Clp1, Ypel4, Serping1, Ube2l6, Smtnl1, Timm10
Downstream gene	Ssrp1, Tnks1bp1, Agtrl1, LOC625033, Lrrc55, Olfr987, GA_x5J8B7W531T-1241080-1240524, Olfr988, GA_x5J8B7W531T-1286425-1285652, Olfr990-ps1, Olfr991-ps1, Olfr992, Olfr993, Olfr994, Olfr995, 4833423E24Rik, Olfr996, Olfr997-ps1, Olfr998, Olfr999-ps1, Olfr1000, Olfr1001-ps1, Olfr1002, GA_x5J8B7W531T-1558688-1559570, Olfr1004-ps1, Olfr154, GA_x5J8B7W531T-1577060-1577325, Olfr1006, GA_x5J8B7W531T-1588603-1588734, Olfr1008, Olfr1009, Olfr1010, Olfr1012, Olfr1013, Olfr1014, Olfr1015, Olfr1016, GA_x5J8B7W3KVV-518538-519236, Olfr1018, Olfr1019, Olfr1020, Olfr1021-ps1, Olfr1022, Olfr1023, Olfr1024, Olfr1025-ps1, Olfr1026, Olfr1027-ps1, Olfr1028, Olfr1029, Olfr1030, Olfr1031
Link	Open Mouse BAC browser

Click to get alignment info.

name	D430039N05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241520 MGI:2444579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zswim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71861 MGI:1919111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 97 ESTs, 4 Proteins pseudo : _no_value

name	LOC668100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins pseudo : _no_value

name	LOC545432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins

name	LOC668107 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins pseudo : _no_value

name	LOC668113 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 4 Proteins pseudo : _no_value

name	LOC668115 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 4 Proteins pseudo : _no_value

name	LOC668119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 96 ESTs, 4 Proteins pseudo : _no_value

name	LOC383725 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383725
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Calcrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54598 MGI:1926944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tfpi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21788 MGI:1095418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672763 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ctnnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12388 MGI:105100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700094K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72657 MGI:1919907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Txndc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66958 MGI:1914208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381379 MGI:1914234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228136 MGI:1923573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98985 MGI:2138968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ypel4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241525 MGI:3605071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serping1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12258 MGI:894696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2l6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56791 MGI:1914500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smtnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68678 MGI:1915928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30059 MGI:1353429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc43a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Rtn4rl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269295 MGI:2669796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc43a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58207 MGI:1931054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19074 MGI:103294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53856 MGI:1858200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228139 MGI:1097160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20833 MGI:107912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnks1bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228140 MGI:2446193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agtrl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23796 MGI:1346086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lrrc55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241528 MGI:2685197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr987 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257951 MGI:3030821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1241080-1240524 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257732
definition	note : olfactory receptor GA_x5J8B7W531T-1241080-1240524 pseudo : _no_value

name	Olfr988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258166 MGI:3030822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1286425-1285652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257816
definition	note : olfactory receptor GA_x5J8B7W531T-1286425-1285652 pseudo : _no_value

name	Olfr990-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258009 MGI:3030824
definition	gene_synonym : MOR203-6P note : olfactory receptor 990, pseudogene 1 pseudo : _no_value

name	Olfr991-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404455 MGI:3030825
definition	note : olfactory receptor 991, pseudogene 1 pseudo : _no_value

name	Olfr992 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258865 MGI:3030826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr993 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258427 MGI:3030827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr994 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258425 MGI:3030828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr995 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258426 MGI:3030829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833423E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228151 MGI:2687041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr996 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258429 MGI:3030830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr997-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257998 MGI:3030831
definition	gene_synonym : MOR175-8P note : olfactory receptor 997, pseudogene 1 pseudo : _no_value

name	Olfr998 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258428 MGI:3030832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr999-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258076 MGI:3030833
definition	gene_synonym : MOR175-7P note : olfactory receptor 999, pseudogene 1 pseudo : _no_value

name	Olfr1000 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257899 MGI:3030834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1001-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258078 MGI:3030835
definition	gene_synonym : MOR175-6 note : olfactory receptor 1001, pseudogene 1 pseudo : _no_value

name	Olfr1002 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258566 MGI:3030836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1558688-1559570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257814
definition	note : olfactory receptor GA_x5J8B7W531T-1558688-1559570 pseudo : _no_value

name	Olfr1004-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258244 MGI:3030838
definition	gene_synonym : GA_x5J8B7W2F7R-2521-3120; MOR213-8 note : olfactory receptor 1004, pseudogene 1 pseudo : _no_value

name	Olfr154 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27216 MGI:1351316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1577060-1577325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257813
definition	note : olfactory receptor GA_x5J8B7W531T-1577060-1577325 pseudo : _no_value

name	Olfr1006 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258563 MGI:3030840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1588603-1588734 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257812
definition	note : olfactory receptor GA_x5J8B7W531T-1588603-1588734 pseudo : _no_value

name	Olfr1008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258866 MGI:3030842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258565 MGI:3030843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1010 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258255 MGI:3030844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1012 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258561 MGI:3030846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1013 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258757 MGI:3030847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1014 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258562 MGI:3030848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1015 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258564 MGI:3030849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257915 MGI:3030850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3KVV-518538-519236 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257840
definition	note : olfactory receptor GA_x5J8B7W3KVV-518538-519236 pseudo : _no_value

name	Olfr1018 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258579 MGI:3030852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1019 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259017 MGI:3030853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1020 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258573 MGI:3030854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1021-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258574 MGI:3030855
definition	gene_synonym : MOR201-1 note : olfactory receptor 1021, pseudogene 1 pseudo : _no_value

name	Olfr1022 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258582 MGI:3030856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1023 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258580 MGI:3030857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1024 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257900 MGI:3030858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1025-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258083 MGI:3030859
definition	gene_synonym : MOR196-5P; MOR196-6_p note : olfactory receptor 1025, pseudogene 1 pseudo : _no_value

name	Olfr1026 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258577 MGI:3030860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1027-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258082 MGI:3030861
definition	gene_synonym : MOR198-2P; MOR198-5_p note : olfactory receptor 1027, pseudogene 1 pseudo : _no_value

name	Olfr1028 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257936 MGI:3030862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1029 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258154 MGI:3030863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1030 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258581 MGI:3030864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1031 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257916 MGI:3030865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430039N05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803219 GeneID:241520 MGI:2444579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430039N05 gene transcript_id : NM_175514.2

name	Zswim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803525 GeneID:71861 MGI:1919111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, SWIM domain containing 2 transcript_id : NM_027964.2

name	Calcrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055257 GeneID:54598 MGI:1926944
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcitonin receptor-like transcript_id : NM_018782.1

name	Tfpi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859643 GeneID:21788 MGI:1095418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue factor pathway inhibitor transcript_id : NM_011576.1

name	LOC672763 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249856 GeneID:672763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical LOC672763 transcript_id : XM_001475504.1

name	Ctnnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131110 GeneID:12388 MGI:105100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin (cadherin associated protein), delta 1 transcript_id : NM_007615.3

name	2700094K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546882 GeneID:72657 MGI:1919907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700094K13 gene transcript_id : NM_001037279.1

name	2700094K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546880 GeneID:72657 MGI:1919907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700094K13 gene transcript_id : NM_001033166.2

name	Txndc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385816 GeneID:66958 MGI:1914208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 14 transcript_id : NM_025868.2

name	Med19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922679 GeneID:381379 MGI:1914234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 19 homolog (yeast) transcript_id : NM_025885.2

name	Zdhhc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476269 GeneID:228136 MGI:1923573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 5 transcript_id : NM_144887.3

name	Clp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130843 GeneID:98985 MGI:2138968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae) transcript_id : NM_133840.2

name	Ypel4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53292601 GeneID:241525 MGI:3605071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 4 (Drosophila) transcript_id : NM_001005342.2

name	Serping1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370111 GeneID:12258 MGI:894696
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade G, member 1 transcript_id : NM_009776.2

name	Ube2l6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910601 GeneID:56791 MGI:1914500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2L 6 transcript_id : NM_019949.1

name	Smtnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129859 GeneID:68678 MGI:1915928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : smoothelin-like 1 transcript_id : NM_024230.2

name	Timm10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305574 GeneID:30059 MGI:1353429
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 10 homolog (yeast) transcript_id : NM_013899.1

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949131 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_001081349.2

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948640 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_024497.1

name	Slc43a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948178 GeneID:72401 MGI:1931352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 1 transcript_id : NM_001083809.1

name	Rtn4rl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40363806 GeneID:269295 MGI:2669796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 4 receptor-like 2 transcript_id : NM_199223.1

name	Slc43a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587004 GeneID:58207 MGI:1931054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 43, member 3 transcript_id : NM_021398.2

name	Prg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376074 GeneID:19074 MGI:103294
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteoglycan 2, bone marrow transcript_id : NM_008920.3

name	Prg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130834 GeneID:53856 MGI:1858200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteoglycan 3 transcript_id : NM_016914.2

name	P2rx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781757 GeneID:228139 MGI:1097160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 3 transcript_id : NM_145526.2

name	Ssrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366943 GeneID:20833 MGI:107912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : structure specific recognition protein 1 transcript_id : NM_182990.3

name	Tnks1bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486922 GeneID:228140 MGI:2446193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tankyrase 1 binding protein 1 transcript_id : NM_001081260.1

name	Agtrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542120 GeneID:23796 MGI:1346086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiotensin receptor-like 1 transcript_id : NM_011784.2

name	LOC625033 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367084 GeneID:625033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC625033 transcript_id : XM_898561.2

name	Lrrc55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796638 GeneID:241528 MGI:2685197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 55 transcript_id : NM_001033346.2

name	Olfr987 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801339 GeneID:257951 MGI:3030821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 987 transcript_id : NM_001011785.1

name	Olfr988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372139 GeneID:258166 MGI:3030822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 988 transcript_id : NM_001011534.1

name	Olfr992 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129146 GeneID:258865 MGI:3030826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 992 transcript_id : NM_146865.1

name	Olfr993 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544950 GeneID:258427 MGI:3030827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 993 transcript_id : NM_146435.1

name	Olfr994 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239125 GeneID:258425 MGI:3030828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 994 transcript_id : NM_146433.1

name	Olfr995 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239123 GeneID:258426 MGI:3030829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 995 transcript_id : NM_146434.1

name	4833423E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157489 GeneID:228151 MGI:2687041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833423E24 gene transcript_id : NM_001081664.1

name	Olfr996 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239183 GeneID:258429 MGI:3030830
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 996 transcript_id : NM_146437.1

name	Olfr998 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239185 GeneID:258428 MGI:3030832
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 998 transcript_id : NM_146436.1

name	Olfr1000 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58743311 GeneID:257899 MGI:3030834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1000 transcript_id : NM_001011695.1

name	Olfr1002 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583706 GeneID:258566 MGI:3030836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1002 transcript_id : NM_146573.2

name	Olfr154 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305340 GeneID:27216 MGI:1351316
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 154 transcript_id : NM_013728.1

name	Olfr1006 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983508 GeneID:258563 MGI:3030840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1006 transcript_id : NM_146570.2

name	Olfr1008 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129140 GeneID:258866 MGI:3030842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1008 transcript_id : NM_146866.1

name	Olfr1009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129498 GeneID:258565 MGI:3030843
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1009 transcript_id : NM_146572.1

name	Olfr1010 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821663 GeneID:258255 MGI:3030844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1010 transcript_id : NM_207149.2

name	Olfr1012 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129506 GeneID:258561 MGI:3030846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1012 transcript_id : NM_146568.1

name	Olfr1013 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583642 GeneID:258757 MGI:3030847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1013 transcript_id : NM_146762.2

name	Olfr1014 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582636 GeneID:258562 MGI:3030848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1014 transcript_id : NM_146569.2

name	Olfr1015 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129504 GeneID:258564 MGI:3030849
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1015 transcript_id : NM_146571.1

name	Olfr1016 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801303 GeneID:257915 MGI:3030850
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1016 transcript_id : NM_001011758.1

name	Olfr1018 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583728 GeneID:258579 MGI:3030852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1018 transcript_id : NM_146586.2

name	Olfr1019 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128910 GeneID:259017 MGI:3030853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1019 transcript_id : NM_147015.1

name	Olfr1020 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129488 GeneID:258573 MGI:3030854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1020 transcript_id : NM_146580.1

name	Olfr1022 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129468 GeneID:258582 MGI:3030856
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1022 transcript_id : NM_146589.1

name	Olfr1023 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195675 GeneID:258580 MGI:3030857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1023 transcript_id : NM_146587.2

name	Olfr1024 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421325 GeneID:257900 MGI:3030858
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1024 transcript_id : NM_001005230.1

name	Olfr1026 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583708 GeneID:258577 MGI:3030860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1026 transcript_id : NM_146584.2

name	Olfr1028 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801323 GeneID:257936 MGI:3030862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1028 transcript_id : NM_001011774.1

name	Olfr1029 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801461 GeneID:258154 MGI:3030863
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1029 transcript_id : NM_001011852.1

name	Olfr1030 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129472 GeneID:258581 MGI:3030864
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1030 transcript_id : NM_146588.1

name	Olfr1031 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801305 GeneID:257916 MGI:3030865
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1031 transcript_id : NM_001011759.1

name	D430039N05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202059 CCDS:CCDS16182.1 GeneID:241520 MGI:2444579
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : hypothetical protein LOC241520 protein_id : NP_780723.1

name	Zswim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313666 CCDS:CCDS16183.1 GeneID:71861 MGI:1919111
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger SWIM domain containing 2 product : zinc finger, SWIM domain containing 2 protein_id : NP_082240.1

name	Calcrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055258 CCDS:CCDS16184.1 GeneID:54598 MGI:1926944
definition	GO_function : GO:0004948 - calcitonin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007507 - heart development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0048661 - positive regulation of smooth muscle cell proliferation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : calcitonin receptor-like receptor product : calcitonin receptor-like protein_id : NP_061252.1

name	Tfpi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859644 CCDS:CCDS16185.1 GeneID:21788 MGI:1095418
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0030414 - protease inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA] codon_start : 1 product : tissue factor pathway inhibitor protein_id : NP_035706.1

name	LOC672763 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249857 GeneID:672763
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475554.1

name	Ctnnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745122 CCDS:CCDS16186.1 GeneID:12388 MGI:105100
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : p120-catenin; catenin src product : catenin (cadherin associated protein), delta 1 protein_id : NP_031641.2

name	2700094K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76781489 CCDS:CCDS16187.1 GeneID:72657 MGI:1919907
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 product : selenoprotein H protein_id : NP_001028338.1 transl_except : (pos:complement(84510538..84510540),aa:Sec)

name	2700094K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82546883 CCDS:CCDS16187.1 GeneID:72657 MGI:1919907
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 product : selenoprotein H protein_id : NP_001032356.1 transl_except : (pos:complement(84510538..84510540),aa:Sec)

name	Txndc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313210 CCDS:CCDS16188.1 GeneID:66958 MGI:1914208
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 product : thioredoxin-related transmembrane protein 2 protein_id : NP_080144.1

name	Med19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313194 CCDS:CCDS16189.1 GeneID:381379 MGI:1914234
definition	GO_component : GO:0000119 - mediator complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : lung cancer metastasis-related protein 1 homolog protein_id : NP_080161.1

name	Zdhhc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450253 CCDS:CCDS16190.1 GeneID:228136 MGI:1923573
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC domain containing 5 protein_id : NP_659136.1

name	Clp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527056 CCDS:CCDS16191.1 GeneID:98985 MGI:2138968
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATP/GTP-binding protein protein_id : NP_598601.1

name	Ypel4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52693937 CCDS:CCDS16192.1 GeneID:241525 MGI:3605071
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : yippee-like 4 protein_id : NP_001005342.1

name	Serping1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753218 CCDS:CCDS16193.1 GeneID:12258 MGI:894696
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : complement component 1 inhibitor; serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1 product : serine (or cysteine) proteinase inhibitor, clade G, member 1 protein_id : NP_033906.1

name	Ube2l6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910602 CCDS:CCDS16194.1 GeneID:56791 MGI:1914500
definition	GO_function : GO:0042296 - ISG15 conjugating enzyme activity [Evidence IDA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008639 - small protein conjugating enzyme activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0032020 - ISG15-protein conjugation [Evidence IDA]; GO:0019941 - modification-dependent protein catabolism [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitin-conjugating enzyme 8 product : E2 ubiquitin conjugating enzyme protein_id : NP_064333.1

name	Smtnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195656 CCDS:CCDS16195.1 GeneID:68678 MGI:1915928
definition	codon_start : 1 note : calponin homology-associated smooth muscle protein product : smoothelin-like 1 protein_id : NP_077192.1

name	Timm10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305575 GeneID:30059 MGI:1353429
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy product : translocase of inner mitochondrial membrane 13 homolog a protein_id : NP_038927.1

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139949132 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 1 protein_id : NP_001074818.2

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948179 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 3 protein_id : NP_001077278.1

name	Slc43a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948641 GeneID:72401 MGI:1931352
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; prostate cancer overexpressed gene 1 product : solute carrier family 43, member 1 isoform 2 protein_id : NP_078773.1

name	Rtn4rl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40363807 CCDS:CCDS16197.1 GeneID:269295 MGI:2669796
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0031103 - axon regeneration [Evidence TAS] codon_start : 1 note : nogo-66 receptor-related protein 2; nogo receptor-like 3; nogo-66 receptor homolog 1 product : reticulon 4 receptor-like 2 protein_id : NP_954693.1

name	Slc43a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587005 GeneID:58207 MGI:1931054
definition	codon_start : 1 note : selectively expressed in embryonic epithelia protein-1; embryonic epithelial gene 1 product : solute carrier family 43, member 3 protein_id : NP_067373.2

name	Prg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679457 CCDS:CCDS16198.1 GeneID:19074 MGI:103294
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : proteoglycan 2, bone marrow protein_id : NP_032946.1

name	Prg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394042 CCDS:CCDS16199.1 GeneID:53856 MGI:1858200
definition	GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : major basic protein 2 product : proteoglycan 3 protein_id : NP_058610.1

name	P2rx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781758 CCDS:CCDS16200.1 GeneID:228139 MGI:1097160
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004931 - ATP-gated cation channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : P2X purinoceptor 3 product : purinergic receptor P2X3 protein_id : NP_663501.2

name	Ssrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154063 GeneID:20833 MGI:107912
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : structure specific recognition protein 1 protein_id : NP_892035.2

name	Tnks1bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486923 GeneID:228140 MGI:2446193
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : tankyrase 1 binding protein 1 protein_id : NP_001074729.1

name	Agtrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753014 CCDS:CCDS16201.1 GeneID:23796 MGI:1346086
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : apelin receptor product : angiotensin II receptor-like 1 protein_id : NP_035914.1

name	LOC625033 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886411 GeneID:625033
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903654.1

name	Lrrc55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701836 GeneID:241528 MGI:2685197
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 55 protein_id : NP_001028518.1

name	Olfr987 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801340 CCDS:CCDS16203.1 GeneID:257951 MGI:3030821
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46808500-46807571; olfactory receptor MOR203-7P product : olfactory receptor 987 protein_id : NP_001011785.1

name	Olfr988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372140 CCDS:CCDS16204.1 GeneID:258166 MGI:3030822
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46830591-46829662; olfactory receptor MOR203-5P product : olfactory receptor 988 protein_id : NP_001011534.1

name	Olfr992 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129147 CCDS:CCDS16205.1 GeneID:258865 MGI:3030826
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46877170-46876241; olfactory receptor MOR203-1 product : olfactory receptor 992 protein_id : NP_667076.1

name	Olfr993 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544951 CCDS:CCDS16206.1 GeneID:258427 MGI:3030827
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46891524-46890580; olfactory receptor MOR203-2 product : olfactory receptor 993 protein_id : NP_666646.1

name	Olfr994 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239126 CCDS:CCDS16207.1 GeneID:258425 MGI:3030828
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46907515-46906571; olfactory receptor MOR203-4 product : olfactory receptor 994 protein_id : NP_666644.1

name	Olfr995 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239124 CCDS:CCDS16208.1 GeneID:258426 MGI:3030829
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-46915844-46914897; olfactory receptor MOR203-3 product : olfactory receptor 995 protein_id : NP_666645.1

name	4833423E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157490 GeneID:228151 MGI:2687041
definition	codon_start : 1 product : hypothetical protein LOC228151 protein_id : NP_001075133.1

name	Olfr996 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239184 CCDS:CCDS16209.1 GeneID:258429 MGI:3030830
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47058060-47059004; olfactory receptor MOR175-4 product : olfactory receptor 996 protein_id : NP_666648.1

name	Olfr998 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239186 CCDS:CCDS16210.1 GeneID:258428 MGI:3030832
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47069356-47070300; olfactory receptor MOR175-5 product : olfactory receptor 998 protein_id : NP_666647.1

name	Olfr1000 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58743312 CCDS:CCDS16211.1 GeneID:257899 MGI:3030834
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47087719-47086775; olfactory receptor MOR175-9 product : olfactory receptor 1000 protein_id : NP_001011695.1

name	Olfr1002 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583707 CCDS:CCDS16212.1 GeneID:258566 MGI:3030836
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47127746-47126790; olfactory receptor MOR175-2 product : olfactory receptor 1002 protein_id : NP_666784.2

name	Olfr154 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305341 CCDS:CCDS16213.1 GeneID:27216 MGI:1351316
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR175-1; olfactory receptor 4 cluster, gene 3; GA_x6K02T2Q125-47143827-47142871 product : olfactory receptor 154 protein_id : NP_038756.1

name	Olfr1006 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983509 GeneID:258563 MGI:3030840
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47154544-47153606; olfactory receptor MOR213-4 product : olfactory receptor 1006 protein_id : NP_666781.2

name	Olfr1008 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129141 CCDS:CCDS16215.1 GeneID:258866 MGI:3030842
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47170431-47171372; olfactory receptor MOR187-3 product : olfactory receptor 1008 protein_id : NP_667077.1

name	Olfr1009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129499 CCDS:CCDS16216.1 GeneID:258565 MGI:3030843
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47195323-47196267; olfactory receptor MOR175-3 product : olfactory receptor 1009 protein_id : NP_666783.1

name	Olfr1010 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821664 GeneID:258255 MGI:3030844
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-47228321-47229256; olfactory receptor MOR213-1 product : olfactory receptor 1010 protein_id : NP_997032.2

name	Olfr1012 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129507 CCDS:CCDS16217.1 GeneID:258561 MGI:3030846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47239120-47238185; olfactory receptor MOR213-6 product : olfactory receptor 1012 protein_id : NP_666779.1

name	Olfr1013 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583643 CCDS:CCDS16218.1 GeneID:258757 MGI:3030847
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47248551-47249468; olfactory receptor MOR213-2 product : olfactory receptor 1013 protein_id : NP_666973.2

name	Olfr1014 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582637 CCDS:CCDS16219.1 GeneID:258562 MGI:3030848
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47255337-47256254; olfactory receptor MOR213-5 product : olfactory receptor 1014 protein_id : NP_666780.2

name	Olfr1015 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129505 CCDS:CCDS16220.1 GeneID:258564 MGI:3030849
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47264151-47265089; olfactory receptor MOR213-3 product : olfactory receptor 1015 protein_id : NP_666782.1

name	Olfr1016 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801304 CCDS:CCDS16221.1 GeneID:257915 MGI:3030850
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47278889-47277960; olfactory receptor MOR213-9 product : olfactory receptor 1016 protein_id : NP_001011758.1

name	Olfr1018 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583729 CCDS:CCDS16222.1 GeneID:258579 MGI:3030852
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47301584-47302519; olfactory receptor MOR260-5 product : olfactory receptor 1018 protein_id : NP_666797.2

name	Olfr1019 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128911 CCDS:CCDS16223.1 GeneID:259017 MGI:3030853
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47320309-47319377; olfactory receptor MOR180-1 product : olfactory receptor 1019 protein_id : NP_667226.1

name	Olfr1020 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129489 CCDS:CCDS16224.1 GeneID:258573 MGI:3030854
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47327964-47328917; olfactory receptor MOR201-2 product : olfactory receptor 1020 protein_id : NP_666791.1

name	Olfr1022 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129469 CCDS:CCDS16225.1 GeneID:258582 MGI:3030856
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47347069-47348016; olfactory receptor MOR196-1 product : olfactory receptor 1022 protein_id : NP_666800.1

name	Olfr1023 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195676 CCDS:CCDS16226.1 GeneID:258580 MGI:3030857
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47363965-47364900; olfactory receptor MOR196-3 product : olfactory receptor 1023 protein_id : NP_666798.2

name	Olfr1024 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421326 CCDS:CCDS16227.1 GeneID:257900 MGI:3030858
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47384320-47383337; olfactory receptor MOR197-1 product : olfactory receptor 1024 protein_id : NP_001005230.1

name	Olfr1026 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583709 CCDS:CCDS16228.1 GeneID:258577 MGI:3030860
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47402610-47403533; olfactory receptor MOR196-4 product : olfactory receptor 1026 protein_id : NP_666795.2

name	Olfr1028 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801324 CCDS:CCDS16229.1 GeneID:257936 MGI:3030862
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47430129-47431103; olfactory receptor MOR198-4 product : olfactory receptor 1028 protein_id : NP_001011774.1

name	Olfr1029 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801462 CCDS:CCDS16230.1 GeneID:258154 MGI:3030863
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47454152-47455126; olfactory receptor MOR198-1P product : olfactory receptor 1029 protein_id : NP_001011852.1

name	Olfr1030 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129473 CCDS:CCDS16231.1 GeneID:258581 MGI:3030864
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47462755-47463693; olfactory receptor MOR196-2 product : olfactory receptor 1030 protein_id : NP_666799.1

name	Olfr1031 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801306 CCDS:CCDS16232.1 GeneID:257916 MGI:3030865
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47470765-47471775; olfactory receptor MOR200-1 product : olfactory receptor 1031 protein_id : NP_001011759.1

name	LOC383725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383725
definition	number : 1 pseudo : _no_value

name	LOC383725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383725
definition	number : 2 pseudo : _no_value

name	LOC383725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383725
definition	number : 3 pseudo : _no_value

name	LOC668096 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249872 GeneID:668096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 97 ESTs, 4 Proteins product : hypothetical LOC668096 pseudo : _no_value transcript_id : XR_002134.2

name	LOC668100 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249873 GeneID:668100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins product : hypothetical LOC668100 pseudo : _no_value transcript_id : XR_002136.2

name	LOC545432 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249874 GeneID:545432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins product : similar to CG12750-PA transcript_id : XR_001626.2

name	LOC668107 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249875 GeneID:668107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 ESTs, 4 Proteins product : hypothetical LOC668107 pseudo : _no_value transcript_id : XR_002138.2

name	LOC668113 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249876 GeneID:668113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 4 Proteins product : hypothetical LOC668113 pseudo : _no_value transcript_id : XR_002140.2

name	LOC668115 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249877 GeneID:668115
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 98 ESTs, 4 Proteins product : hypothetical LOC668115 pseudo : _no_value transcript_id : XR_002141.2

name	LOC668119 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249878 GeneID:668119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 96 ESTs, 4 Proteins product : hypothetical LOC668119 pseudo : _no_value transcript_id : XR_002143.2

clone name	MSMg01-478D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-205J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079K10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-309O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405D20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347H11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-228M06.b	B6Ng01-228M06.g
ACC	GA042100	GA042101
length	591	1,166
definition	B6Ng01-228M06.b	B6Ng01-228M06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(84,689,952 - 84,690,548)	(84,843,335 - 84,844,492)
sequence	tcatggaccgctttgggcccaggcctcttcgactggtgggcaggtgaggt ggctgggttgtgcggagatgcagggccaggaaggtgatgcagaggaaggg aggcaaaaaaaaaaaaaaaaaatcatgccccatgtttctgtgtccttaca gtgcctgctttgccgcatcctgcactctaatggccttggcctccagggac actgaaggtaagccacctgccttcgtgtgccttctctagaatgggtgaga tgaaggtgggccttgactctcacggccccacaaatgccctcatctaccct tctttctcttcccagttttgtctccattgatattcctggcactgtccttg aatggatttgctggcatctgcttaacgtttacctcactcacggtgagtat tactgatttgccctggctgccatccagacacctaggagtgggtggggtta gaaatgagtgagagggggctgaagagatggctcagcatttcagaacgtta tgctgttcttctagaggaccagattgggttgtcagcaccccttggcctct agctcacaactgcctataactcaagcaccagagaaactaac	gaattctcccattgtatgagaacatagaatttagaaggattctgagatct tgtaccaggatgcctgtacccttaacagctagctaaagacagatggttca gagattccaagtttgggctgtggagtcatagaatcagaagtcatcagact caagcaagtcacctgctcttctctctccaaacctataaaatgggtcaata atagtgcattattcatgaggttaactgaggtaatctgcatatatttgtgg gtctctatatttagtgggtactgagatggtcatgacctgttcagaccctc aagctagcctgagagccacaggtttctaaaatcttctacccatctcaaat acttcttttcctaacttcttcaagatctccctggaggtctccttggaatc ccgggttcttgtgtctcatcacggacataaaaacagtccccttccttttg tccatttcatcatcctcctgctgctttggagtggaattcattctgctttg ccttgacctgtgaagcacgctcccaccattacccagtgggagacataaca tgccagagttgcccagacataacttaccaaagttaaagatggccttgttc ctcacaccctttccctgacctccaggccctccttccagctcagtggctct gcttcattcagcatcccctagggggtcactttcattgtcccctgggcctc actctctggagaagagactcctgccttccctcactctgcccacagggatc acctttgagtcagtaccccctgagagtatttccactgaaatggttctcag tcttcctcagcaggttcagcactcaggccttgcccaggcacagggcaggg gccagaaatctgtctgctacctgaactttcctgtactgctgcttgatcat gacagaggcgtctgggccttgagctttcctcttctgtaaatgggagcacc taggatagggatccaaaggggacatagactgccttaaaagatgcatttac gtgaaaccactgcacaagggtacacatggaacaagaggagttctacatag ggaagacccaaggttgccagcctgtggaagctgtttatgctgggctggca tgggccaagcaagggagaaagcccagaatgtgatatgaggcctgaaactg gttctgtaagcaattg
quality values	Open. Hide. 62 38 33 47 62 62 31 14 17 10 10 13 62 62 62 62 49 62 62 44 37 62 62 62 62 24 34 25 24 25 10 28 23 28 29 40 38 56 62 62 59 59 56 62 59 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 56 56 43 34 35 35 32 54 56 50 48 42 56 59 62 62 62 59 59 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 59 59 59 59 56 56 59 59 56 54 56 62 59 62 62 62 62 59 62 51 50 59 62 59 62 59 62 59 54 62 62 62 62 62 56 59 59 62 62 62 62 62 59 56 59 59 56 46 54 54 59 62 59 59 62 59 59 62 59 59 59 59 59 59 49 50 56 59 59 59 59 59 59 59 59 62 59 62 59 62 62 50 59 59 59 59 59 62 62 59 59 56 59 59 50 59 62 56 56 59 59 54 43 54 50 59 59 59 43 56 56 59 62 59 56 51 50 59 34 54 43 43 62 59 51 62 51 56 59 62 62 62 62 62 62 59 59 59 56 56 59 51 56 54 54 62 62 62 62 56 62 59 59 62 62 62 59 62 59 54 56 56 59 59 59 59 62 62 62 62 62 62 59 59 59 59 56 56 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 48 59 56 56 59 59 59 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 62 59 56 62 59 62 59 62 62 62 62 62 62 62 59 56 62 59 56 62 59 62 62 62 62 62 59 62 62 59 59 59 56 59 59 51 59 62 62 59 59 59 62 51 54 54 51 51 50 59 51 51 59 59 62 62 62 62 62 62 62 62 62 62 62 56 59 62 62 62 62 62 62 59 59 51 39 59 59 51 59 59 59 59 51 59 59 51 59 62 59 62 62 62 62 62 62 62 59 62 44 62 59 59 56 56 62 37 56 56 62 50 47 51 62 62 62 62 56 56 39 56 39 20 51 24 39 38 38 20 12 24 16 10 8 14 14 7 20 21 27 20 10 38 27 20 30 31 26 23 32 21 20 24 22 13 7 11 17 12 9 15 10 9 10 11 13 22 10 22 24 9 47 33 17 28 36 47 30 38 30 22 33 19 10 18 29 24 28 18 21 17 10 9 17 23 17 17 13 13 19 10 13 23 14 17 12 12 25 15 12 22 24 15 12 14 26 13 12 9 16 20 25 9 17 17 13 13 15 12 9 19 9 21 14 13 9 12 9 13 9	Open. Hide. 62 49 47 47 62 62 62 62 62 37 24 22 21 21 14 16 29 22 32 20 32 28 28 44 59 51 51 62 62 59 62 59 59 62 62 62 62 49 59 49 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 49 24 45 29 33 43 32 43 43 49 33 50 56 56 62 62 59 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 59 62 62 62 62 62 62 62 62 62 49 43 49 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 56 43 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 50 54 62 50 62 62 62 62 62 62 54 62 53 62 62 62 62 54 62 50 54 62 62 62 62 62 62 58 58 42 45 52 58 52 54 58 54 54 58 52 58 52 54 42 50 58 52 58 54 58 42 58 54 58 52 58 58 52 54 54 54 58 49 47 54 34 58 58 22 58 58 58 58 58 58 58 58 58 54 54 52 49 41 58 52 58 58 45 46 58 52 54 58 47 50 58 54 52 52 52 49 54 39 52 47 54 52 52 54 46 52 42 33 37 50 58 41 41 21 50 58 58 46 53 50 54 51 50 50 58 42 32 46 48 41 32 40 49 50 53 46 47 41 47 51 34 11 58 46 47 43 24 46 25 31 48 58 51 50 37 39 35 50 40 41 50 43 39 42 41 51 48 42 58 37 46 37 50 54 48 46 35 26 41 43 51 18 49 38 12 58 32 46 29 50 26 51 40 51 46 50 39 35 32 54 38 37 40 15 28 50 40 37 41 16 58 43 34 42 21 6 49 44 16 32 39 34 53 39 53 58 50 39 46 17 50 42 42 22 39 34 39 50 44 50 47 35 42 53 21 51 29 39 18 15 54 33 26 41 27 40 28 40 21 54 6 13 49 35 13 32 29 30 22 29 28 9 11 20 26 13 49 30 26 26 19 35 30 18 49 28 21 26 20 17 31 30 21 32 24 14 28 32 38 14 40 27 10 19 21 39 25 46 39 26 29 34 33 11 51 37 18 39 28 53 54 36 26 33 32 17 31 54 30 31 31 31 53 30 45 26 25 24 29 21 20 53 26 22 32 40 26 29 40 21 32 32 18 46 31 32 31 32 51 28 34 36 32 31 33 38 31 27 29 31 27 25 21 18 15 12 20 9 13 16 11 9 9 18 34 46 12 12 14 6 18 29 31 10 24 8 51 24 29 27 31 32 26 30 19 11 26 15 15 40 30 17 42 46 30 26 6 30 14 36 38 19 12 19 18 26 16 30 26 46 6 23 6 46 31 7 46 11 33 40 32 22 27 13 8 11 10 6 22 24 21 32 13 29 31 11 11 46 36 24 7 22 20 27 11 44 11 46 27 9 11 10 33 20 18 18 29 6 12 7 15 19 20 19 16 25 9 27 20 41 21 8 13 18 6 19 10 29 18 17 17 9 7 6 17 16 25 19 7 26 9 21 9 12 6 11 21 10 11 9 17 31 18 7 5 16 6 8 33 10 5 7 14 11 6 9 16 5 16 25 22 18 18 31 12 5 13 15 25 12 5 6 7 7 6 40 7 7 9 9 13 17 18 31 16 9 31 15 17 19 12 6 5 34 14 6 6 27 8 6 16 30 21 4 34 8 11 5 21 22 12 4 9 6 29 7 4 22 24 4 3 3 5 4 6 5 7 6 11 10 21 5 6 24 10 28 34 20 6 4 3 3 3 8 17 10 6 5 6 18 4 2 3 5 6 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_84689952_84690548
seq2: B6Ng01-228M06.b_46_642

seq1  GAATTCTCATGGACCGCTTTGGGCCCAGGCCTCTTCGACTGGTGGGCAGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCATGGACCGCTTTGGGCCCAGGCCTCTTCGACTGGTGGGCAGG  50

seq1  TGAGGTGGCTGGGTTGTGCGGAGATGCAGGGCCAGGAAGGTGATGCAGAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGTGGCTGGGTTGTGCGGAGATGCAGGGCCAGGAAGGTGATGCAGAG  100

seq1  GAAGGGAGGCAAAAAAAAAAAAAAAAAATCATGCCCCATGTTTCTGTGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGAGGCAAAAAAAAAAAAAAAAAATCATGCCCCATGTTTCTGTGTC  150

seq1  CTTACAGTGCCTGCTTTGCCGCATCCTGCACTCTAATGGCCTTGGCCTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACAGTGCCTGCTTTGCCGCATCCTGCACTCTAATGGCCTTGGCCTCC  200

seq1  AGGGACACTGAAGGTAAGCCACCTGCCTTCGTGTGCCTTCTCTAGAATGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGACACTGAAGGTAAGCCACCTGCCTTCGTGTGCCTTCTCTAGAATGG  250

seq1  GTGAGATGAAGGTGGGCCTTGACTCTCACGGCCCCACAAATGCCCTCATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGATGAAGGTGGGCCTTGACTCTCACGGCCCCACAAATGCCCTCATC  300

seq1  TACCCTTCTTTCTCTTCCCAGTTTTGTCTCCATTGATATTCCTGGCACTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCTTCTTTCTCTTCCCAGTTTTGTCTCCATTGATATTCCTGGCACTG  350

seq1  TCCTTGAATGGATTTGCTGGCATCTGCTTAACGTTTACCTCACTCACGGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTGAATGGATTTGCTGGCATCTGCTTAACGTTTACCTCACTCACGGT  400

seq1  GAGTATTACTGATTTGCCCTGGCTGCCATCCAGACACCTAGGAGTGGGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTATTACTGATTTGCCCTGGCTGCCATCCAGACACCTAGGAGTGGGTG  450

seq1  GGGTTAGAAATGAGTGAGAGGGGGCTGAAGAGATGGCTCAGCAGTTCAGA  500
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  GGGTTAGAAATGAGTGAGAGGGGGCTGAAGAGATGGCTCAGCATTTCAGA  500

seq1  ACGTTATGCTGTTCTTCTAGAGGACCAGATTGGGTTGTCAGCACCCCTAG  550
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  ACGTTATGCTGTTCTTCTAGAGGACCAGATTGGGTTGTCAGCACCCCTTG  550

seq1  GCCTCTAGCTCACAACTGCCTATAACTCAAGCACCAGAGAAACTAAC  597
      |||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCTAGCTCACAACTGCCTATAACTCAAGCACCAGAGAAACTAAC  597

seq1: chr2_84843335_84844492
seq2: B6Ng01-228M06.g_68_1233 (reverse)

seq1  CAATGGCTTACAGAA-CAGTTTCA-GCCTCATCT-ACATTCTGGGCTTTT  47
      |||| |||||||||| |||||||| ||||||| | ||||||||||| |||
seq2  CAATTGCTTACAGAACCAGTTTCAGGCCTCATATCACATTCTGGGC-TTT  49

seq1  CTCCCTTTGCTT-GCCCATGCCAGCCCCAGCAT-AACAGCTTCCACAGGC  95
      ||||| |||||| ||||||||||| |||||||| ||||||||||||||||
seq2  CTCCC-TTGCTTGGCCCATGCCAG-CCCAGCATAAACAGCTTCCACAGGC  97

seq1  TGCCAACCTTGGGGTCCTTCCCTATGTAG-ACTCCTCTTGTTCCATGTGT  144
      || ||||||||||   ||||||||||||| ||||||||||||||||||||
seq2  TGGCAACCTTGGG--TCTTCCCTATGTAGAACTCCTCTTGTTCCATGTGT  145

seq1  ACCCTTGTGCAGT-GTTTCACGTAATTGCATCTTTTAAGGCAGTCTATGT  193
      ||||||||||||| ||||||||||| ||||||||||||||||||||||||
seq2  ACCCTTGTGCAGTGGTTTCACGTAAATGCATCTTTTAAGGCAGTCTATGT  195

seq1  CCCCTT--GGTTCCTATCCTAGGTGCTCCCATTTTACAGAAGAGG-AAGC  240
      ||||||  | | ||||||||||||||||||| ||||||||||||| ||||
seq2  CCCCTTTGGATCCCTATCCTAGGTGCTCCCA-TTTACAGAAGAGGAAAGC  244

seq1  TC-AGGCCCAGACGCCTCTGTCATGATCAAGCAGCAGTACAGGAAAGTTC  289
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGCCCAGACGCCTCTGTCATGATCAAGCAGCAGTACAGGAAAGTTC  294

seq1  AGGTAGCAGACAGATTTCTGG-CCCTG-CCTGTGCCTGGGCAAGGCCTGA  337
      ||||||||||||||||||||| ||||| ||||||||||||||||||||||
seq2  AGGTAGCAGACAGATTTCTGGCCCCTGCCCTGTGCCTGGGCAAGGCCTGA  344

seq1  GTGCTGAACCTGCTGAGGAAGACTGAGAACCA-TTCAGTGGAAATACTCT  386
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  GTGCTGAACCTGCTGAGGAAGACTGAGAACCATTTCAGTGGAAATACTCT  394

seq1  CAGGGGGTACTGACTCAAAGGTGATCCCTGTGGGCAGAGTGAGGGAAGGC  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGGGTACTGACTCAAAGGTGATCCCTGTGGGCAGAGTGAGGGAAGGC  444

seq1  AGGAGTCTCTTCTCCAGAGAGTGAGGCCCAGGGGACAATGAAAGTGACCC  486
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGTCTCTTCTCCAGAGAGTGAGGCCCAGGGGACAATGAAAGTGACCC  494

seq1  CCTAGGGGATGCTGAATGAAGCAGAGCCACTGAGCTGGAAGGAGGGCCTG  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGGGGATGCTGAATGAAGCAGAGCCACTGAGCTGGAAGGAGGGCCTG  544

seq1  GAGGTCAGGGAAAGGGTGTGAGGAACAAGGCCATCTTTAACTTTGGTAAG  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTCAGGGAAAGGGTGTGAGGAACAAGGCCATCTTTAACTTTGGTAAG  594

seq1  TTATGTCTGGGCAACTCTGGCATGTTATGTCTCCCACTGGGTAATGGTGG  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGTCTGGGCAACTCTGGCATGTTATGTCTCCCACTGGGTAATGGTGG  644

seq1  GAGCGTGCTTCACAGGTCAAGGCAAAGCAGAATGAATTCCACTCCAAAGC  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCGTGCTTCACAGGTCAAGGCAAAGCAGAATGAATTCCACTCCAAAGC  694

seq1  AGCAGGAGGATGATGAAATGGACAAAAGGAAGGGGACTGTTTTTATGTCC  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGAGGATGATGAAATGGACAAAAGGAAGGGGACTGTTTTTATGTCC  744

seq1  GTGATGAGACACAAGAACCCGGGATTCCAAGGAGACCTCCAGGGAGATCT  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATGAGACACAAGAACCCGGGATTCCAAGGAGACCTCCAGGGAGATCT  794

seq1  TGAAGAAGTTAGGAAAAGAAGTATTTGAGATGGGTAGAAGATTTTAGAAA  836
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGAAGTTAGGAAAAGAAGTATTTGAGATGGGTAGAAGATTTTAGAAA  844

seq1  CCTGTGGCTCTCAGGCTAGCTTGAGGGTCTGAACAGGTCATGACCATCTC  886
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTGGCTCTCAGGCTAGCTTGAGGGTCTGAACAGGTCATGACCATCTC  894

seq1  AGTACCCACTAAATATAGAGACCCACAAATATATGCAGATTACCTCAGTT  936
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACCCACTAAATATAGAGACCCACAAATATATGCAGATTACCTCAGTT  944

seq1  AACCTCATGAATAATGCACTATTATTGACCCATTTTATAGGTTTGGAGAG  986
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTCATGAATAATGCACTATTATTGACCCATTTTATAGGTTTGGAGAG  994

seq1  AGAAGAGCAGGTGACTTGCTTGAGTCTGATGACTTCTGATTCTATGACTC  1036
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAGCAGGTGACTTGCTTGAGTCTGATGACTTCTGATTCTATGACTC  1044

seq1  CACAGCCCAAACTTGGAATCTCTGAACCATCTGTCTTTAGCTAGCTGTTA  1086
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGCCCAAACTTGGAATCTCTGAACCATCTGTCTTTAGCTAGCTGTTA  1094

seq1  AGGGTACAGGCATCCTGGTACAAGATCTCAGAATCCTTCTAAATTCTATG  1136
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTACAGGCATCCTGGTACAAGATCTCAGAATCCTTCTAAATTCTATG  1144

seq1  TTCTCATACAATGGGAGAATTC  1158
      ||||||||||||||||||||||
seq2  TTCTCATACAATGGGAGAATTC  1166

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information