MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-258B17
Chromosome	2 (Build37)	5 (Build37)
Map Location	119,413,571 - 119,414,423	124,739,674 - 124,739,937
singlet/doublet	singlet	singlet
Overlap gene	LOC100043307
Upstream gene	LOC640461, Bub1b, Pak6, Gm1337, Plcb2, LOC100043272, A430105I19Rik, Disp2, D2Ertd750e, Ivd, Bahd1, Chst14, LOC677379, Ccdc32, Rpusd2, Casc5, Rad51, 1200015F23Rik, Gchfr, Dnajc17, OTTMUSG00000015762, LOC545640, Zfyve19, Ppp1r14d, Spint1, Rhov, Vps18, LOC100043609, Dll4, Chac1, Inoc1, LOC100043612, Exdl1, 1500003O03Rik
Downstream gene	Oip5, Nusap1, Ndufaf1, LOC625328, LOC100043622, Rtf1, Itpka, Ltk, Rpap1, Tyro3, 6330405D24Rik, LOC625403, Mga, Mapkbp1, Pla2g4b, Spnb5, Ehd4, Pla2g4e, LOC100043635, Pla2g4d, Pla2g4f, Vps39, Tmem87a, Ganc, Capn3, Zfp106, Snap23
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC640461 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Bub1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12236 MGI:1333889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pak6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214230 MGI:2679420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1337 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383787 MGI:2686183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plcb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18796 MGI:107465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043272 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	A430105I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214239 MGI:2685199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Disp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214240 MGI:2388733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Ertd750e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51944 MGI:1289298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ivd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56357 MGI:1929242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bahd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228536 MGI:2139371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chst14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72136 MGI:1919386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677379 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 82 ESTs

name	Ccdc32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269336 MGI:2685477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpusd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271842 MGI:1918066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76464 MGI:1923714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19361 MGI:97890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200015F23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67809 MGI:1915059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gchfr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320415 MGI:2443977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69408 MGI:1916658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015762 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623781 MGI:3651144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545640 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 523 ESTs, 1 Protein pseudo : _no_value

name	Zfyve19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72008 MGI:1919258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r14d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72112 MGI:1919362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spint1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20732 MGI:1338033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhov (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228543 MGI:2444227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228545 MGI:2443626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043609 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Dll4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54485 MGI:1859388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69065 MGI:1916315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inoc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68142 MGI:1915392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs

name	Exdl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241624 MGI:3045306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500003O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56398 MGI:1927185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043307 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs

name	Oip5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70645 MGI:1917895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nusap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108907 MGI:2675669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ndufaf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69702 MGI:1916952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 1433 ESTs, 27 Proteins

name	LOC100043622 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 141 ESTs, 1 Protein pseudo : _no_value

name	Rtf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76246 MGI:1309480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs, 5 Proteins

name	Itpka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228550 MGI:1333822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17005 MGI:96840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Rpap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68925 MGI:1916175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tyro3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22174 MGI:104294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330405D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70715 MGI:1917965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	LOC625403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 7 Proteins pseudo : _no_value

name	Mga (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29808 MGI:1352483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapkbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26390 MGI:1347004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211429 MGI:2384819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spnb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640524 MGI:2685200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 22 Proteins

name	Ehd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98878 MGI:1919619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329502 MGI:1919144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043635 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Pla2g4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78390 MGI:1925640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271844 MGI:2685493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269338 MGI:2443189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem87a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211499 MGI:2441844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ganc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76051 MGI:1923301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12335 MGI:107437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20402 MGI:1270153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snap23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20619 MGI:109356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bub1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357365 GeneID:12236 MGI:1333889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae) transcript_id : NM_009773.2

name	Pak6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347489 GeneID:214230 MGI:2679420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : p21 (CDKN1A)-activated kinase 6 transcript_id : NM_001033254.2

name	Gm1337 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517479 GeneID:383787 MGI:2686183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1337, (NCBI) transcript_id : NM_001081971.1

name	Plcb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61676178 GeneID:18796 MGI:107465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase C, beta 2 transcript_id : NM_177568.2

name	LOC100043272 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249963 GeneID:100043272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to F32B6.11 transcript_id : XM_001479861.1

name	A430105I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233831 GeneID:214239 MGI:2685199
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430105I19 gene transcript_id : NM_001001982.1

name	Disp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130048 GeneID:214240 MGI:2388733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dispatched homolog 2 (Drosophila) transcript_id : NM_170593.2

name	D2Ertd750e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801803 GeneID:51944 MGI:1289298
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, ERATO Doi 750, expressed transcript_id : NM_026412.2

name	Ivd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130613 GeneID:56357 MGI:1929242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isovaleryl coenzyme A dehydrogenase transcript_id : NM_019826.3

name	Bahd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930704 GeneID:228536 MGI:2139371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromo adjacent homology domain containing 1 transcript_id : NM_001045523.1

name	Chst14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980714 GeneID:72136 MGI:1919386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 14 transcript_id : NM_028117.2

name	LOC677379 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250042 GeneID:677379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 82 ESTs product : similar to ubiquinol-cytochrome c reductase hinge protein transcript_id : XM_001480278.1

name	Ccdc32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556291 GeneID:269336 MGI:2685477
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 32 transcript_id : NM_199310.1

name	Rpusd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802660 GeneID:271842 MGI:1918066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA pseudouridylate synthase domain containing 2 transcript_id : NM_173450.2

name	Casc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628637 GeneID:76464 MGI:1923714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cancer susceptibility candidate 5 transcript_id : NM_029617.2

name	Rad51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348430 GeneID:19361 MGI:97890
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD51 homolog (S. cerevisiae) transcript_id : NM_011234.3

name	1200015F23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131146 GeneID:67809 MGI:1915059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200015F23 gene transcript_id : NM_001033136.2

name	Gchfr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803176 GeneID:320415 MGI:2443977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP cyclohydrolase I feedback regulator transcript_id : NM_177157.4

name	Dnajc17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20982830 GeneID:69408 MGI:1916658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 17 transcript_id : NM_139139.1

name	OTTMUSG00000015762 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380666 GeneID:623781 MGI:3651144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000015762 transcript_id : NM_001039223.2

name	Zfyve19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374895 GeneID:72008 MGI:1919258
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 19 transcript_id : NM_028054.2

name	Ppp1r14d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19920330 GeneID:72112 MGI:1919362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 14D transcript_id : NM_028104.2

name	Spint1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778981 GeneID:20732 MGI:1338033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine protease inhibitor, Kunitz type 1 transcript_id : NM_016907.3

name	Rhov (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704043 GeneID:228543 MGI:2444227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member V transcript_id : NM_145530.1

name	Vps18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542060 GeneID:228545 MGI:2443626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 18 (yeast) transcript_id : NM_172269.2

name	LOC100043609 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250054 GeneID:100043609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043609 transcript_id : XM_001480340.1

name	Dll4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802441 GeneID:54485 MGI:1859388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : delta-like 4 (Drosophila) transcript_id : NM_019454.2

name	Chac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385952 GeneID:69065 MGI:1916315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ChaC, cation transport regulator-like 1 (E. coli) transcript_id : NM_026929.3

name	Inoc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129872 GeneID:68142 MGI:1915392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : INO80 complex homolog 1 (S. cerevisiae) transcript_id : NM_026574.3

name	LOC100043612 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250056 GeneID:100043612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs product : hypothetical protein LOC100043612 transcript_id : XM_001480350.1

name	Exdl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351361 GeneID:241624 MGI:3045306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vexonuclease 3'-5' domain-like 1 transcript_id : NM_172857.2

name	1500003O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120319 GeneID:56398 MGI:1927185
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500003O03 gene transcript_id : NM_019769.3

name	LOC100043307 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249967 GeneID:100043307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs product : hypothetical protein LOC100043307 transcript_id : XM_001479922.1

name	Oip5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120324 GeneID:70645 MGI:1917895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Opa interacting protein 5 transcript_id : NM_001042653.1

name	Nusap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111118997 GeneID:108907 MGI:2675669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar and spindle associated protein 1 transcript_id : NM_133851.3

name	Nusap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111118995 GeneID:108907 MGI:2675669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar and spindle associated protein 1 transcript_id : NM_001042652.1

name	Ndufaf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803171 GeneID:69702 MGI:1916952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 transcript_id : NM_027175.3

name	LOC625328 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250064 GeneID:625328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1433 ESTs, 27 Proteins product : similar to H3 histone, family 3A transcript_id : XM_889893.3

name	Rtf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250062 GeneID:76246 MGI:1309480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs, 5 Proteins product : Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) transcript_id : XM_283757.7

name	Itpka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130226 GeneID:228550 MGI:1333822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-trisphosphate 3-kinase A transcript_id : NM_146125.2

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935378 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_206942.1

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935372 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_203345.1

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935374 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_008523.2

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935376 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_206941.1

name	Rpap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144445948 GeneID:68925 MGI:1916175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase II associated protein 1 transcript_id : NM_177294.4

name	Tyro3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68989242 GeneID:22174 MGI:104294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TYRO3 protein tyrosine kinase 3 transcript_id : NM_019392.2

name	6330405D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249970 GeneID:70715 MGI:1917965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : RIKEN cDNA 6330405D24 gene transcript_id : XM_917516.3

name	Mga (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444913 GeneID:29808 MGI:1352483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAX gene associated transcript_id : NM_013720.2

name	Mapkbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037374 GeneID:26390 MGI:1347004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase binding protein 1 transcript_id : NM_011941.2

name	Pla2g4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249336 GeneID:211429 MGI:2384819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVB (cytosolic) transcript_id : NM_145378.2

name	Spnb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249972 GeneID:640524 MGI:2685200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 22 Proteins product : spectrin beta 5 transcript_id : XM_001481329.1

name	Ehd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803304 GeneID:98878 MGI:1919619
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EH-domain containing 4 transcript_id : NM_133838.3

name	Pla2g4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861233 GeneID:329502 MGI:1919144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVE transcript_id : NM_177845.4

name	LOC100043635 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250067 GeneID:100043635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043635 transcript_id : XM_001480419.1

name	Pla2g4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906182 GeneID:78390 MGI:1925640
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVD transcript_id : NM_001024137.1

name	Pla2g4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972422 GeneID:271844 MGI:2685493
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVF transcript_id : NM_001024145.1

name	Vps39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892962 GeneID:269338 MGI:2443189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 39 (yeast) transcript_id : NM_178851.2

name	Vps39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30578430 GeneID:269338 MGI:2443189
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 39 (yeast) transcript_id : NM_147153.2

name	Tmem87a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343465 GeneID:211499 MGI:2441844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 87A transcript_id : NM_173734.2

name	Ganc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487338 GeneID:76051 MGI:1923301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase, alpha; neutral C transcript_id : NM_172672.2

name	Capn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680843 GeneID:12335 MGI:107437
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 3 transcript_id : NM_007601.1

name	Zfp106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948268 GeneID:20402 MGI:1270153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 106 transcript_id : NM_011743.2

name	Snap23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389019 GeneID:20619 MGI:109356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptosomal-associated protein 23 transcript_id : NM_009222.3

name	Bub1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753212 CCDS:CCDS16579.1 GeneID:12236 MGI:1333889
definition	GO_component : GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0000940 - outer kinetochore of condensed chromosome [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation function : probable component of the mitotic checkpoint that delays anaphase until all chromosomes are properly attached to the mitotic spindle product : budding uninhibited by benzimidazoles 1 homolog, beta protein_id : NP_033903.1

name	Pak6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781773 CCDS:CCDS16580.1 GeneID:214230 MGI:2679420
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : p21 (CDKN1A)-activated kinase 6 protein_id : NP_001028426.1

name	Gm1337 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517480 GeneID:383787 MGI:2686183
definition	codon_start : 1 note : novel ankyrin repeat domain containing protein product : hypothetical protein LOC383787 protein_id : NP_001075440.1

name	Plcb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61676179 CCDS:CCDS16582.1 GeneID:18796 MGI:107465
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0050913 - sensory perception of bitter taste [Evidence IMP] codon_start : 1 product : phospholipase C, beta 2 protein_id : NP_808236.2

name	LOC100043272 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249964 GeneID:100043272
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479911.1

name	A430105I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50233832 GeneID:214239 MGI:2685199
definition	codon_start : 1 product : hypothetical protein LOC214239 protein_id : NP_001001982.1

name	Disp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24528557 CCDS:CCDS16584.1 GeneID:214240 MGI:2388733
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : dispatched B product : dispatched homolog 2 protein_id : NP_733481.1

name	D2Ertd750e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385906 CCDS:CCDS16585.1 GeneID:51944 MGI:1289298
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : TRAF4 associated factor 1 homolog protein_id : NP_080688.1

name	Ivd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789985 CCDS:CCDS16586.1 GeneID:56357 MGI:1929242
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isovaleryl dehydrogenase product : isovaleryl coenzyme A dehydrogenase protein_id : NP_062800.1

name	Bahd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930705 GeneID:228536 MGI:2139371
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : bromo adjacent homology domain containing 1 protein_id : NP_001038988.1

name	Chst14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980715 CCDS:CCDS16587.1 GeneID:72136 MGI:1919386
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001537 - N-acetylgalactosamine 4-O-sulfotransferase activity [Evidence ISS]; GO:0042301 - phosphate binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0030208 - dermatan sulfate biosynthesis [Evidence ISS]; GO:0050655 - dermatan sulfate proteoglycan metabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation note : dermatan 4 sulfotransferase 1 product : dermatan-4-sulfotransferase-1 protein_id : NP_082393.2

name	LOC677379 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250043 GeneID:677379
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480328.1

name	Ccdc32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556292 GeneID:269336 MGI:2685477
definition	codon_start : 1 product : coiled-coil domain containing 32 protein_id : NP_955014.1

name	Rpusd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734094 CCDS:CCDS16588.1 GeneID:271842 MGI:1918066
definition	GO_function : GO:0009982 - pseudouridine synthase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : CG6187-like product : RNA pseudouridylate synthase domain containing 2 protein_id : NP_775626.1

name	Casc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628638 GeneID:76464 MGI:1923714
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : cancer susceptibility candidate 5 protein_id : NP_083893.2

name	Rad51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755276 CCDS:CCDS16590.1 GeneID:19361 MGI:97890
definition	GO_component : GO:0000793 - condensed chromosome [Evidence IDA]; GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA]; GO:0000795 - synaptonemal complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence ISS]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA] [Evidence TAS]; GO:0006268 - DNA unwinding during replication [Evidence ISS]; GO:0000724 - double-strand break repair via homologous recombination [Evidence IDA] [Evidence ISS]; GO:0007126 - meiosis [Evidence IDA]; GO:0007131 - meiotic recombination [Evidence TAS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : RAD51 homolog protein_id : NP_035364.1

name	1200015F23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701644 CCDS:CCDS16591.1 GeneID:67809 MGI:1915059
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67809 protein_id : NP_001028308.1

name	Gchfr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893139 GeneID:320415 MGI:2443977
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : GTP cyclohydrolase I feedback regulator protein_id : NP_796131.1

name	Dnajc17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20982831 CCDS:CCDS16593.1 GeneID:69408 MGI:1916658
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DnaJ (Hsp40) homolog, subfamily C, member 17 protein_id : NP_631878.1

name	OTTMUSG00000015762 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986613 CCDS:CCDS16594.1 GeneID:623781 MGI:3651144
definition	codon_start : 1 product : hypothetical protein LOC623781 protein_id : NP_001034312.1

name	Zfyve19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312534 CCDS:CCDS16595.1 GeneID:72008 MGI:1919258
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger, FYVE domain containing 19 protein_id : NP_082330.1

name	Ppp1r14d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16904385 CCDS:CCDS16596.1 GeneID:72112 MGI:1919362
definition	GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] codon_start : 1 product : PKC-dependent PP1 inhibitory protein subunit 14 protein_id : NP_082380.1

name	Spint1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328234 CCDS:CCDS16597.1 GeneID:20732 MGI:1338033
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0001763 - morphogenesis of a branching structure [Evidence IMP] codon_start : 1 note : Kunitz-type protease inhibitor 1; hepatocyte growth factor activator inhibitor type 1 product : Kunitz-type protease inhibitor 1 precursor protein_id : NP_058603.2

name	Rhov (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704044 CCDS:CCDS16598.1 GeneID:228543 MGI:2444227
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ras homolog gene family, member V protein_id : NP_663505.1

name	Vps18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542061 CCDS:CCDS16599.1 GeneID:228545 MGI:2443626
definition	GO_component : GO:0005884 - actin filament [Evidence IDA]; GO:0005769 - early endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vacuolar protein sorting 18 protein_id : NP_758473.2

name	LOC100043609 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250055 GeneID:100043609
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480390.1

name	Dll4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506547 CCDS:CCDS16600.1 GeneID:54485 MGI:1859388
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005112 - Notch binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007219 - Notch signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : delta-like 4 protein_id : NP_062327.1

name	Chac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312195 CCDS:CCDS16601.1 GeneID:69065 MGI:1916315
definition	codon_start : 1 product : ChaC, cation transport regulator-like 1 protein_id : NP_081205.1

name	Inoc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62234443 CCDS:CCDS16602.1 GeneID:68142 MGI:1915392
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : yeast INO80-like protein protein_id : NP_080850.2

name	LOC100043612 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250057 GeneID:100043612
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480400.1

name	Exdl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370298 CCDS:CCDS16603.1 GeneID:241624 MGI:3045306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : vexonuclease 3'-5' domain-like 1 protein_id : NP_766445.1

name	1500003O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790225 CCDS:CCDS16604.1 GeneID:56398 MGI:1927185
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : calcium binding protein P22 protein_id : NP_062743.1

name	LOC100043307 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249968 GeneID:100043307
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479972.1

name	Oip5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111120325 GeneID:70645 MGI:1917895
definition	codon_start : 1 product : Opa interacting protein 5 protein_id : NP_001036118.1

name	Nusap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527068 CCDS:CCDS16605.1 GeneID:108907 MGI:2675669
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005876 - spindle microtubule [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA] GO_process : GO:0000281 - cytokinesis after mitosis [Evidence ISS]; GO:0040001 - establishment of mitotic spindle localization [Evidence ISS]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0000070 - mitotic sister chromatid segregation [Evidence ISS]; GO:0045840 - positive regulation of mitosis [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1; nucleolar protein ANKT product : nucleolar and spindle associated protein 1 isoform a protein_id : NP_598612.1

name	Nusap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111118996 GeneID:108907 MGI:2675669
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005876 - spindle microtubule [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA] GO_process : GO:0000281 - cytokinesis after mitosis [Evidence ISS]; GO:0040001 - establishment of mitotic spindle localization [Evidence ISS]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0000070 - mitotic sister chromatid segregation [Evidence ISS]; GO:0045840 - positive regulation of mitosis [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2; nucleolar protein ANKT product : nucleolar and spindle associated protein 1 isoform b protein_id : NP_001036117.1

name	Ndufaf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980802 GeneID:69702 MGI:1916952
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : NADH dehydrogenase (ubiquinone) 1 assembly factor 1 product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 protein_id : NP_081451.3

name	LOC625328 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886797 GeneID:625328
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894986.1

name	Rtf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250063 GeneID:76246 MGI:1309480
definition	codon_start : 1 product : Rtf1, Paf1/RNA polymerase II complex component, homolog protein_id : XP_283757.6

name	Itpka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122643 CCDS:CCDS16607.1 GeneID:228550 MGI:1333822
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence TAS]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006020 - myo-inositol metabolism [Evidence IMP] codon_start : 1 note : IP3-kinase A product : inositol 1,4,5-trisphosphate 3-kinase A protein_id : NP_666237.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935379 CCDS:CCDS16609.1 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform C is encoded by transcript variant 3; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform C protein_id : NP_996825.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935373 CCDS:CCDS16608.1 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform D is encoded by transcript variant 4; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform D protein_id : NP_976220.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935375 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant 1; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform A protein_id : NP_032549.2 transl_except : (pos:complement(119584032..119584034),aa:Met)

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935377 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant 2; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform B protein_id : NP_996824.1 transl_except : (pos:complement(119584032..119584034),aa:Met)

name	Rpap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537534 CCDS:CCDS16610.1 GeneID:68925 MGI:1916175
definition	GO_component : GO:0030880 - RNA polymerase complex [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : RNA polymerase II associated protein 1 protein_id : NP_796268.2

name	Tyro3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68989243 CCDS:CCDS16611.1 GeneID:22174 MGI:104294
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : TYRO3 protein tyrosine kinase 3 protein_id : NP_062265.2

name	6330405D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249971 GeneID:70715 MGI:1917965
definition	codon_start : 1 product : hypothetical protein LOC70715 protein_id : XP_922609.3

name	Mga (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444914 GeneID:29808 MGI:1352483
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Max dimerization protein 5 product : MAX-interacting protein protein_id : NP_038748.2

name	Mapkbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037375 CCDS:CCDS16612.1 GeneID:26390 MGI:1347004
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007256 - activation of JNKK activity [Evidence IDA] codon_start : 1 exception : mismatches in translation note : JNK-binding protein 1; Jun N-terminal kinase-binding protein 1; Jun N-terminal kinase binding protein 1; mitogen activated protein kinase binding proten 1 product : mitogen activated protein kinase binding protein 1 protein_id : NP_036071.2

name	Pla2g4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249337 GeneID:211429 MGI:2384819
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IEA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : cytosolic phospholipase A2 beta; phospholipase A2 group IVB (cytosolic) product : phospholipase A2, group IVB protein_id : NP_663353.2

name	Spnb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249973 GeneID:640524 MGI:2685200
definition	codon_start : 1 note : overriding stop codons product : similar to beta V spectrin protein_id : XP_001481379.1 transl_except : (pos:complement(119884630..119884632),aa:OTHER)

name	Ehd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981592 CCDS:CCDS16615.1 GeneID:98878 MGI:1919619
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : EH domain containing protein MPAST2 product : EH-domain containing 4 protein_id : NP_598599.2

name	Pla2g4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63999319 CCDS:CCDS16616.1 GeneID:329502 MGI:1919144
definition	EC_number : 3.1.1.4 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVE product : cytosolic phospholipase A2 epsilon protein_id : NP_808513.2

name	LOC100043635 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250068 GeneID:100043635
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480469.1

name	Pla2g4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906183 CCDS:CCDS16617.1 GeneID:78390 MGI:1925640
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVD product : cytosolic phospholipase A2 delta protein_id : NP_001019308.1

name	Pla2g4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972423 CCDS:CCDS16618.1 GeneID:271844 MGI:2685493
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVF product : cytosolic phospholipase A2 zeta protein_id : NP_001019316.1

name	Vps39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30578384 CCDS:CCDS16619.1 GeneID:269338 MGI:2443189
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Vam6/Vps39-like product : vacuolar protein sorting 39 isoform 2 protein_id : NP_849182.1

name	Vps39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164794 GeneID:269338 MGI:2443189
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Vam6/Vps39-like product : vacuolar protein sorting 39 isoform 1 protein_id : NP_671495.1

name	Tmem87a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424573 GeneID:211499 MGI:2441844
definition	codon_start : 1 product : hypothetical protein LOC211499 protein_id : NP_776095.1

name	Ganc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487339 GeneID:76051 MGI:1923301
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004558 - alpha-glucosidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0006006 - glucose metabolism [Evidence IC]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glucosidase, alpha; neutral C protein_id : NP_766260.2

name	Capn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680844 CCDS:CCDS16620.1 GeneID:12335 MGI:107437
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence IDA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030239 - myofibril assembly [Evidence IMP]; GO:0006508 - proteolysis [Evidence IDA]; GO:0006938 - sarcomere alignment [Evidence IMP]; GO:0045214 - sarcomere organization [Evidence IMP] codon_start : 1 exception : mismatches in translation function : intracellular calcium-dependant cysteine proteinase note : skeletal muscle specific calpain p94 product : calpain 3 protein_id : NP_031627.1

name	Zfp106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948269 CCDS:CCDS16621.1 GeneID:20402 MGI:1270153
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0001515 - opioid peptide activity [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SH3-domain binding protein 3 protein_id : NP_035873.2

name	Snap23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678049 CCDS:CCDS16622.1 GeneID:20619 MGI:109356
definition	GO_component : GO:0005792 - microsome [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : synaptosomal-associated protein, 23kD product : synaptosomal-associated protein 23 protein_id : NP_033248.1

name	LOC640461 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249962 GeneID:640461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to Eukaryotic translation initiation factor 5A-1 (eIF-5A-1) (eIF-5A1) (Eukaryotic initiation factor 5A isoform 1) (eIF-5A) (eIF-4D) pseudo : _no_value transcript_id : XR_034421.1

name	LOC545640 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250051 GeneID:545640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 523 ESTs, 1 Protein product : similar to Ribosomal protein S6 pseudo : _no_value transcript_id : XR_034631.1

name	LOC100043622 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250065 GeneID:100043622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 141 ESTs, 1 Protein product : hypothetical protein LOC100043622 pseudo : _no_value transcript_id : XR_034664.1

name	LOC625403 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250066 GeneID:625403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 7 Proteins product : similar to keratinocyate lipid-binding protein pseudo : _no_value transcript_id : XR_034672.1

clone name	MSMg01-520F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410I03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-414C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-162C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271P22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-258B17.b	B6Ng01-258B17.g
ACC	GA063631	GA063632
length	853	959
definition	B6Ng01-258B17.b	B6Ng01-258B17.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(119,413,571 - 119,414,423)	(124,739,674 - 124,739,937)
sequence	gaattcaaggccattctccaagtttgaggctagtttattctacaggagac cctgtttcaaaaactggggtttgaaattggcttagcagttaacatactgc ttttacagagaggatcagagttctgttctcagcatacatactgattggct catgatggctggctccagttcaagaggaatccagtgttctggcctctgct cacatgaacactcagattaacactctttacacacacacaaacctgtgcaa ttaaaaataaagtctaaatccaggagtggtggtgcacgcttttaacccca gcacttgggaggcagaggcaggtggatttctgagttcaaggccagcctgg tttacagagtgagttccaggacagccagggctacacagagaaaccctgtc ttgaaaaaacaaaaataaaataaaaaaataaatagataaagtctaaaaaa tttcaagattagccaggcaatggggcatacctttaatcccagcattcagg aggcagaggtaggaagatctctgaatttgaggccagcctgatcttcagag taagttcaggacagccagggctacacagagaaaccctgccttggaaaaac aaaaaaacattcaaggtctaaattgggttggtgcttataggcaataattc caatgaaaatctacattttcctggagatactaaaaaaagaaatttaatgt tattttatattattcagactgaatcatacctgaattgggctctgtgattc ctgtctgattttttgtatgaccttgaaatcagaaattttgttggtacaaa agcttctgagagtgtgcactgtgtgtgtgtgtgtgtgtgtgtgtatgtgt gta	gaattcaaaggcgcttcaggcccatagctcagaagcacagaaaaaaaaga ccctggatattcatgggaggactgagccctcaatttgtgcttagtattgg ctcagtggttgaattgaattatgagacacttagttggggtatggtataga atcagttgctagtttgccagtgggagaaattatcatactagggatcatgg aaacttgtgttaattgttgttaaacttgtaagaaactgaatttggggact ggagaaatggcccagtggttaagagaactggttactcttgcagaggatcc aggttcggttaccagtacccacacagtgggtcacacccatctataactat agttccaagggatctgatggaccaggtgcacagatatgtatagaaacaaa ctgtaattagtaacttaaaaaaaaaaaggatttgagtgtgatatgatgca gacctgtaatcccagagtatgtacatgtatcacatgcgtgcactaaccct cagaggccagaagaaggtactggatcctagacctggagttacttgtggtt gagagccactatgtggatactgggaatcaaacacaggtcctctagaacaa tagcaggtgctcttaagtgctgagtcagctctcctttcttcttacaattt tttatttaaaaagggtaatattcccatcaataggcaagtgagttttcaac aatgggtgttgaagccaggaagtggtggtacatgcctttaatcccagcac ttgggaggcagaggcaggtggatttctgagttcaaggcacgcctggtcta cagagtgagttccaggacagccaagactacacagagaaaccctgtctcaa aaaaaaaaagacatcagctggtgtggtggcgtatgtctttaatctcagca tctgggataagaggtgggcagatttctgtgagtctatgccagcttggtat acataatga
quality values	Open. Hide. 58 31 26 35 58 28 13 47 62 62 62 39 32 54 62 62 62 62 39 24 54 62 62 62 62 62 62 62 49 62 62 51 51 59 38 43 59 59 62 62 59 62 59 59 62 62 54 59 59 59 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 54 42 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 47 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 49 44 62 62 62 62 62 62 62 62 62 62 62 62 62 52 35 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 52 62 41 43 52 52 62 54 54 54 52 52 54 52 52 58 52 58 58 37 44 46 47 52 54 52 58 54 52 58 58 58 58 45 54 54 52 52 52 58 58 54 58 54 58 54 58 54 45 54 54 58 58 54 54 58 58 58 54 54 58 58 58 54 52 52 41 36 34 58 52 58 46 50 49 53 58 58 50 58 58 50 50 53 47 58 47 45 40 58 54 51 58 26 33 58 52 53 51 40 52 49 58 58 58 51 53 52 53 50 48 58 25 53 37 50 40 39 31 58 58 58 58 58 52 46 53 58 47 32 58 41 33 52 52 58 39 58 50 49 58 58 58 51 41 49 33 18 49 49 54 50 40 28 53 41 30 46 49 43 50 41 27 47 40 47 51 41 39 33 32 53 53 39 29 29 41 44 39 30 39 49 41 39 39 51 37 54 45 54 34 53 45 39 47 32 54 54 54 54 42 53 31 40 31 40 53 31 51 37 37 37 54 54 29 32 32 32 27 54 54 14 13 54 54 46 45 33 34 48 38 32 29 31 12 47 40 29 17 41 35 35 40 45 37 40 12 31 14 32 42 31 33 40 18 24 31 46 32 32 26 31 36 53 37 41 45 45 38 33 31 40 32 40 30 40 31 27 31 13 7 5 5 6 23 27 30 32 9 8	Open. Hide. 62 59 43 59 62 59 62 62 62 62 49 59 43 56 43 48 49 24 28 38 32 38 54 46 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 59 62 59 59 62 62 62 62 54 62 62 59 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 49 49 54 62 62 62 62 54 54 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 47 62 62 43 62 62 54 62 52 62 62 62 58 58 54 54 58 58 58 58 52 58 58 58 58 58 58 45 54 58 58 52 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 52 58 58 53 58 58 58 58 58 39 58 54 54 58 58 58 58 58 54 47 58 54 58 58 58 53 58 54 58 58 54 58 58 58 58 58 54 53 58 54 53 54 58 58 51 51 58 50 38 58 50 58 54 58 53 58 49 51 53 53 51 58 48 58 50 54 46 52 52 52 52 58 54 53 53 53 58 51 58 50 52 53 51 52 58 47 50 50 50 42 58 58 58 58 58 36 41 51 58 50 52 58 58 58 50 50 58 49 40 43 50 42 42 46 46 43 41 34 33 51 53 50 51 51 52 50 58 37 53 46 40 50 51 53 50 58 36 58 52 37 26 52 49 50 49 52 54 54 49 42 53 42 54 52 51 51 30 51 50 32 52 49 54 53 42 52 54 53 38 51 51 40 31 42 32 47 47 52 45 40 54 51 32 51 45 53 54 42 39 33 53 40 40 46 22 26 54 45 42 31 53 29 32 34 41 10 47 32 31 19 47 26 32 39 23 21 53 34 31 40 34 46 21 53 31 34 31 34 36 48 20 24 29 31 41 32 21 40 38 22 31 37 34 36 31 30 36 24 38 45 42 29 42 30 32 28 19 31 33 17 15 29 35 30 40 24 31 15 35 24 26 26 42 17 30 31 31 42 31 39 39 31 30 31 16 24 31 30 31 31 23 17 46 46 46 46 46 48 46 46 41 33 26 31 22 22 42 31 29 25 34 34 34 38 31 42 32 30 34 26 30 34 31 25 32 34 31 32 26 31 36 48 32 11 19 32 38 32 34 34 33 38 32 32 29 27 33 47 14 16 14 32 24 6 10 16 6 6 21 39 33 19 20 13 29 20 43 22 32 21 25 12 19 34 9 22 12 25 27 26 17 15 20 23 16 27 22 11 12 21 5 11 19 17 28 19 28 11 24 14 28 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_119413571_119414423
seq2: B6Ng01-258B17.b_42_894

seq1  GAATTCAAGGCCATTCTCCAAGTTTGAGGCTAGTTTATTCTACAGGAGAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGGCCATTCTCCAAGTTTGAGGCTAGTTTATTCTACAGGAGAC  50

seq1  CCTGTTTCAAAAACTGGGGTTTGAAATTGGCTTAGCAGTTAACATACTGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTTTCAAAAACTGGGGTTTGAAATTGGCTTAGCAGTTAACATACTGC  100

seq1  TTTTACAGAGAGGATCAGAGTTCTGTTCTCAGCATACATACTGATTGGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTACAGAGAGGATCAGAGTTCTGTTCTCAGCATACATACTGATTGGCT  150

seq1  CATGATGGCTGGCTCCAGTTCAAGAGGAATCCAGTGTTCTGGCCTCTGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGATGGCTGGCTCCAGTTCAAGAGGAATCCAGTGTTCTGGCCTCTGCT  200

seq1  CACATGAACACTCAGATTAACACTCTTTACACACACACAAACCTGTGCAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATGAACACTCAGATTAACACTCTTTACACACACACAAACCTGTGCAA  250

seq1  TTAAAAATAAAGTCTAAATCCAGGAGTGGTGGTGCACGCTTTTAACCCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAATAAAGTCTAAATCCAGGAGTGGTGGTGCACGCTTTTAACCCCA  300

seq1  GCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCCAGCCTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCCAGCCTGG  350

seq1  TTTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTC  400

seq1  TTGAAAAAACAAAAATAAAATAAAAAAATAAATAGATAAAGTCTAAAAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAAAACAAAAATAAAATAAAAAAATAAATAGATAAAGTCTAAAAAA  450

seq1  TTTCAAGATTAGCCAGGCAATGGGGCATACCTTTAATCCCAGCATTCAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAAGATTAGCCAGGCAATGGGGCATACCTTTAATCCCAGCATTCAGG  500

seq1  AGGCAGAGGTAGGAAGATCTCTGAATTTGAGGCCAGCCTGATCTTCAGAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGAGGTAGGAAGATCTCTGAATTTGAGGCCAGCCTGATCTTCAGAG  550

seq1  TAAGTTCAGGACAGCCAGGGCTACACAGAGAAACCCTGCCTTGGAAAAAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTTCAGGACAGCCAGGGCTACACAGAGAAACCCTGCCTTGGAAAAAC  600

seq1  AAAAAAACATTCAAGGTCTAAATTGGGTTGGTGCTTATAGGCAATAATTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAACATTCAAGGTCTAAATTGGGTTGGTGCTTATAGGCAATAATTC  650

seq1  CAATGAAAATCTACATTTTCCTGGAGATACTAAAAAAAGAAATTTAATGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGAAAATCTACATTTTCCTGGAGATACTAAAAAAAGAAATTTAATGT  700

seq1  TATTTTATATTATTCAGACTGAATCATACCTGAATTGGGCTCTGTGATTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTATATTATTCAGACTGAATCATACCTGAATTGGGCTCTGTGATTC  750

seq1  CTGTCTGATTTTTTGTATGACCTTGAAATCAGAAATTTTGTTGGTACAAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTGATTTTTTGTATGACCTTGAAATCAGAAATTTTGTTGGTACAAA  800

seq1  AGCTTCTGAGAGTGTGCACTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT  850
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  AGCTTCTGAGAGTGTGCACTGTGTGTGTGTGTGTGTGTGTGTGTATGTGT  850

seq1  GTA  853
      |||
seq2  GTA  853

seq1: chr5_124739674_124739937
seq2: B6Ng01-258B17.g_475_921

seq1  TAGTAAGACTTAAAAAAAAAAAG--TCAAACTAAGCTAGGCAGTGCATGC  48
      |||||  ||||||||||||||||  |   | |  | || |   ||||  |
seq2  TAGTA--ACTTAAAAAAAAAAAGGATTTGAGTGTGATATG--ATGCAGAC  46

seq1  CTTTAATCCCA-------------------------GCACT----CT-GG  68
      || ||||||||                         |||||    ||  |
seq2  CTGTAATCCCAGAGTATGTACATGTATCACATGCGTGCACTAACCCTCAG  96

seq1  AGGC------AGGGAAC----------------AGTT-----------GG  85
      ||||      | || ||                ||||            |
seq2  AGGCCAGAAGAAGGTACTGGATCCTAGACCTGGAGTTACTTGTGGTTGAG  146

seq1  GGCC---------ATACAGAG----AAACCCTG--CCTCAAAAA------  114
       |||         |||| | |    |||| | |  |||| | ||      
seq2  AGCCACTATGTGGATACTGGGAATCAAACACAGGTCCTCTAGAACAATAG  196

seq1  ----------------------------------------ACAA------  118
                                              ||||      
seq2  CAGGTGCTCTTAAGTGCTGAGTCAGCTCTCCTTTCTTCTTACAATTTTTT  246

seq1  ----AAAAAG--------------------------------------AC  126
          ||||||                                      | 
seq2  ATTTAAAAAGGGTAATATTCCCATCAATAGGCAAGTGAGTTTTCAACAAT  296

seq1  GGGCG-------------GTGGTGGCACATGCCTTTAATCCCAGCACTTG  163
      ||| |             ||||||| ||||||||||||||||||||||||
seq2  GGGTGTTGAAGCCAGGAAGTGGTGGTACATGCCTTTAATCCCAGCACTTG  346

seq1  GGAGGCAGAGGCAGGTGGATTTCTGAGTGCGAAGCCAGCCTGGTCTACAG  213
      |||||||||||||||||||||||||||| | | ||  |||||||||||||
seq2  GGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCACGCCTGGTCTACAG  396

seq1  AGTGAGCTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAAA  263
      |||||| ||||||||||||| | |||||||||||||||||||||| ||||
seq2  AGTGAGTTCCAGGACAGCCAAGACTACACAGAGAAACCCTGTCTCAAAAA  446

seq1  A  264
      |
seq2  A  447

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information