MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-293C24
Chromosome	2 (Build37)
Map Location	5,416,982 - 5,552,101
singlet/doublet	doublet
Overlap gene	Camk1d, LOC666599
Upstream gene	Frmd4a, Prpf18, LOC623483, E130319B15Rik, LOC666973, Sephs1, Phyh, LOC381346, LOC100040250, LOC100040426, 1110017I16Rik, Mcm10, Optn, Ccdc3, LOC100040292
Downstream gene	Cdc123, Nudt5, Sec61a2, Dhtkd1, Upf2, LOC100040343, 5430407P10Rik, LOC634939, Echdc3, 1700014B07Rik, Usp6nl, LOC100040387, Cugbp2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Frmd4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209630 MGI:1919850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67229 MGI:1914479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	E130319B15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209645 MGI:2443100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666973 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	Sephs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109079 MGI:1923580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phyh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16922 MGI:891978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC381346 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC100040250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100040426 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 488 ESTs, 2 Proteins

name	1110017I16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68527 MGI:1915777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcm10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70024 MGI:1917274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Optn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71648 MGI:1918898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74186 MGI:1921436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040292 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Camk1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227541 MGI:2442190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666599 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 7 Proteins pseudo : _no_value

name	Cdc123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98828 MGI:2138811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53893 MGI:1858232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec61a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57743 MGI:1931071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhtkd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209692 MGI:2445096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:326622 MGI:2449307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040343 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	5430407P10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227545 MGI:2442238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC634939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	Echdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67856 MGI:1915106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700014B07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72248 MGI:1919498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Usp6nl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98910 MGI:2138893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040387 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cugbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14007 MGI:1338822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frmd4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254209 GeneID:209630 MGI:1919850
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM domain containing 4A transcript_id : NM_172475.2

name	Prpf18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41053869 GeneID:67229 MGI:1914479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP18 pre-mRNA processing factor 18 homolog (yeast) transcript_id : NM_026045.3

name	LOC623483 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248847 GeneID:623483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : similar to ribosomal protein L22 transcript_id : XM_887942.3

name	E130319B15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803215 GeneID:209645 MGI:2443100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130319B15 gene transcript_id : NM_178663.3

name	Sephs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734497 GeneID:109079 MGI:1923580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenophosphate synthetase 1 transcript_id : NM_175400.5

name	Phyh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754563 GeneID:16922 MGI:891978
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phytanoyl-CoA hydroxylase transcript_id : NM_010726.1

name	LOC381346 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248852 GeneID:381346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : similar to ribosomal protein L36a transcript_id : XM_355309.6

name	LOC100040426 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248868 GeneID:100040426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 488 ESTs, 2 Proteins product : similar to ribosomal protein S28 transcript_id : XM_001474602.1

name	1110017I16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803179 GeneID:68527 MGI:1915777
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110017I16 gene transcript_id : NM_026754.2

name	Mcm10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369377 GeneID:70024 MGI:1917274
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : minichromosome maintenance deficient 10 (S. cerevisiae) transcript_id : NM_027290.2

name	Optn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893033 GeneID:71648 MGI:1918898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : optineurin transcript_id : NM_181848.4

name	Ccdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037350 GeneID:74186 MGI:1921436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 3 transcript_id : NM_028804.1

name	Camk1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750128 GeneID:227541 MGI:2442190
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase ID transcript_id : NM_177343.3

name	Cdc123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802547 GeneID:98828 MGI:2138811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 123 homolog (S. cerevisiae) transcript_id : NM_133837.3

name	Nudt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387406 GeneID:53893 MGI:1858232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 5 transcript_id : NM_016918.3

name	Sec61a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130500 GeneID:57743 MGI:1931071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sec61, alpha subunit 2 (S. cerevisiae) transcript_id : NM_021305.3

name	Dhtkd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487484 GeneID:209692 MGI:2445096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase E1 and transketolase domain containing 1 transcript_id : NM_001081131.1

name	Upf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487282 GeneID:326622 MGI:2449307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UPF2 regulator of nonsense transcripts homolog (yeast) transcript_id : NM_001081132.1

name	LOC100040343 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248861 GeneID:100040343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001474524.1

name	5430407P10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361075 GeneID:227545 MGI:2442238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430407P10 gene transcript_id : NM_144883.3

name	Echdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363495 GeneID:67856 MGI:1915106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enoyl Coenzyme A hydratase domain containing 3 transcript_id : NM_024208.4

name	1700014B07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366009 GeneID:72248 MGI:1919498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700014B07 gene transcript_id : XM_888419.2

name	Usp6nl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123173783 GeneID:98910 MGI:2138893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : USP6 N-terminal like transcript_id : NM_001080548.1

name	Usp6nl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123173768 GeneID:98910 MGI:2138893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : USP6 N-terminal like transcript_id : NM_181399.3

name	LOC100040387 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149248866 GeneID:100040387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040387 transcript_id : XM_001474591.1

name	Cugbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286790 GeneID:14007 MGI:1338822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUG triplet repeat, RNA binding protein 2 transcript_id : NM_010160.2

name	Frmd4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254210 CCDS:CCDS15656.1 GeneID:209630 MGI:1919850
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA] codon_start : 1 product : FERM domain containing 4A protein_id : NP_766063.2

name	Prpf18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254503 CCDS:CCDS15657.1 GeneID:67229 MGI:1914479
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : HPRP18 homolog product : PRP18 pre-mRNA processing factor 18 homolog protein_id : NP_080321.2

name	LOC623483 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248848 GeneID:623483
definition	codon_start : 1 product : similar to ribosomal protein L22 protein_id : XP_893035.2

name	E130319B15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542577 CCDS:CCDS15658.1 GeneID:209645 MGI:2443100
definition	codon_start : 1 product : hypothetical protein LOC209645 protein_id : NP_848778.1

name	Sephs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734498 CCDS:CCDS15659.1 GeneID:109079 MGI:1923580
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : selenophosphate synthetase 1 protein_id : NP_780609.3

name	Phyh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754564 CCDS:CCDS15660.1 GeneID:16922 MGI:891978
definition	GO_component : GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0003824 - catalytic activity [Evidence IDA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0048244 - phytanoyl-CoA dioxygenase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001561 - fatty acid alpha-oxidation [Evidence IDA] codon_start : 1 note : lupus nephritis-associated peptide 1 product : phytanoyl-CoA hydroxylase protein_id : NP_034856.1

name	LOC381346 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248853 GeneID:381346
definition	codon_start : 1 product : similar to ribosomal protein L36a protein_id : XP_355309.5

name	LOC100040426 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248869 GeneID:100040426
definition	codon_start : 1 product : similar to ribosomal protein S28 protein_id : XP_001474652.1

name	1110017I16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229068 CCDS:CCDS15661.1 GeneID:68527 MGI:1915777
definition	codon_start : 1 note : unique cartilage matrix-associated protein product : hypothetical protein LOC68527 protein_id : NP_081030.1

name	Mcm10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789189 CCDS:CCDS15662.1 GeneID:70024 MGI:1917274
definition	codon_start : 1 exception : mismatches in translation product : minichromosome maintenance complex component 10 protein_id : NP_081566.1

name	Optn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469491 CCDS:CCDS15663.1 GeneID:71648 MGI:1918898
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TFIIIA-INTP product : optineurin protein_id : NP_862896.1

name	Ccdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037351 CCDS:CCDS15664.1 GeneID:74186 MGI:1921436
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil domain containing 3 protein_id : NP_083080.1

name	Camk1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:79750129 CCDS:CCDS15665.1 GeneID:227541 MGI:2442190
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004685 - calcium- and calmodulin-dependent protein kinase activity [Evidence ISS]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IDA] codon_start : 1 product : calcium/calmodulin-dependent protein kinase 1D protein_id : NP_796317.2

name	Cdc123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527052 CCDS:CCDS15666.1 GeneID:98828 MGI:2138811
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000080 - G1 phase of mitotic cell cycle [Evidence ISS] codon_start : 1 note : novel protein similar to D123 gene product product : D123 gene product protein_id : NP_598598.1

name	Nudt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393853 CCDS:CCDS15667.1 GeneID:53893 MGI:1858232
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0047631 - ADP-ribose diphosphatase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IDA] codon_start : 1 product : nudix (nucleoside diphosphate linked moiety X)-type motif 5 protein_id : NP_058614.1

name	Sec61a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946604 CCDS:CCDS15668.1 GeneID:57743 MGI:1931071
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA] GO_process : GO:0009306 - protein secretion [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Sec61 alpha product : Sec61, alpha subunit 2 protein_id : NP_067280.1

name	Dhtkd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487485 GeneID:209692 MGI:2445096
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016624 - oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : dehydrogenase E1 and transketolase domain containing 1 protein_id : NP_001074600.1

name	Upf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487283 GeneID:326622 MGI:2449307
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006986 - response to unfolded protein [Evidence ISS] codon_start : 1 product : UPF2 regulator of nonsense transcripts homolog protein_id : NP_001074601.1

name	LOC100040343 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248862 GeneID:100040343
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474574.1

name	5430407P10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625904 CCDS:CCDS15671.1 GeneID:227545 MGI:2442238
definition	codon_start : 1 product : hypothetical protein LOC227545 protein_id : NP_659132.2

name	Echdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980955 CCDS:CCDS15672.1 GeneID:67856 MGI:1915106
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : enoyl Coenzyme A hydratase domain containing 3 protein_id : NP_077170.2

name	1700014B07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82796248 GeneID:72248 MGI:1919498
definition	codon_start : 1 product : hypothetical protein LOC72248 protein_id : XP_893512.1

name	Usp6nl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123173784 GeneID:98910 MGI:2138893
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; novel TBC domain containing protein product : USP6 N-terminal like isoform b protein_id : NP_001074017.1

name	Usp6nl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123173769 GeneID:98910 MGI:2138893
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; novel TBC domain containing protein product : USP6 N-terminal like isoform a protein_id : NP_852064.2

name	LOC100040387 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149248867 GeneID:100040387
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474641.1

name	Cugbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286791 GeneID:14007 MGI:1338822
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006376 - mRNA splice site selection [Evidence IDA] codon_start : 1 note : elav-type RNA-binding protein 3; CUG triplet repeat,RNA-binding protein 2; CUG triplet repeat,RNA binding protein 2 product : CUG triplet repeat, RNA binding protein 2 protein_id : NP_034290.2

name	LOC100040250 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040250
definition	number : 1 pseudo : _no_value

name	LOC100040292 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040292
definition	number : 1 pseudo : _no_value

name	LOC666973 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149248849 GeneID:666973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to Protein regulator of cytokinesis 1 pseudo : _no_value transcript_id : XR_031694.1

name	LOC666599 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149248871 GeneID:666599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 7 Proteins product : similar to Mus musculus ribosomal protein L19 pseudo : _no_value transcript_id : XR_031939.1

name	LOC634939 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149248863 GeneID:634939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to TRAF-interacting protein pseudo : _no_value transcript_id : XR_031822.1

clone name	MSMg01-068I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-330O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-068F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114C04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-293C24.b	B6Ng01-293C24.g
ACC	GA089630	GA089631
length	1,155	1,110
definition	B6Ng01-293C24.b	B6Ng01-293C24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(5,550,943 - 5,552,101)	(5,416,982 - 5,418,080)
sequence	gaattcttttcctggacgtttgctccctgtaaagatcactggatttgact gcctgaatgtggagtgtggcttggaagggaaggacttagggcgagtcaca cacagtgccgagcaccccttagtgctgtgggagctgggctgagggagttg cttaatctcccagtgtccctttatctgtgtaacggagacagtgttccttt tggatgctgtgctgataaactgaactcattcttagaaaagtgtctagtac atagaacatttatagctattatcctaagaatatacacaaattccatcatg cactgtgagtagtttgagattctggtttctgggtgcattgatataaactc tttgtaactcagaaggaagggaagctgatcttttggtttcttctgctcaa agctcagttttccacaccatacacatttggagcccctccaaagcagagtg gatgcagcctgaacagccatccgagatttcattgttacattgtgtagcta tgtctatgttgcgaatacagacatttggaaacagcttgggaagggaaaat gcttgctgctaactttcaacattcctaactagctctatctaccatgggcc aggccagctgtctctttatgcaattttgtccatttaaaaaaaaaatccta aggtaatttgctaagagaatagactcaagtgttctcactacaggcatatc acagtgtcaaacaatgaatatgtaagttgcttcaccgtgataatcatttc acaacttacatgtgtatttcagagtatcacagtatacaccctaatatata cagttttattagtcatacttcaatgagctacacaaaactcccaatccata tataaagtaaatttaaaggcatcttgacctttccacccctaataataata tgcgggatctctgttccctcaccaaagaaaggaggaaggagacagaaaaa ggaaaaaaggaagtagttctaccagtacatcttaacttagtaacacctta cttctagttcatgctgagatcgctgcagtgatggctggctcctgctgcat tcctagagccacagttgtatcgcccgaaagactaggaggccgatgaccca gatgatctcaagaatgcccgatgaagttgtgttgactggtgctagtccat gcttg	gaattcaactgtaatcaggcagagaagcagtcggtataatttttttgttt aaaatcactgggtacatgtgaacatgagggtttgtgtgtgtcagggtgca tattacagcctgcatgtggagatcagaggacaaacccaggcagcaatcct tgccttctaccttgtttgagatagggcctctttttgatcattttgtaccc caggttagctggcctagaagcctccagagagtctcttgtctctacctctc atttcgcagtgggcacaccaggattacagatgagtggtactgtgcccagc tttacatgggttctggggagattcaaactcaaggtctcactcttgtatgg caggcatgatacctactgagccaccatcgcagcctttcacacgacgtctc ccagcctgtgatgcatgctcagaagcatcaagcagaagcaaataccttct tccaggatcaatgcagatttgtctccaagaacccaagcagtcatggacgg gcagaggaactgaagaataggaatgttagaatttccaagtgggaaaaaga cgttaaacatttggaggatggtctgtgttgcgtcttccagggatgggcaa agggcacgtatgctagttatctttgcactgctgtgaccaaaataccgaac acaaagaatttaaagggaaagcattcattttggcttatggtttcaactca ccatgtcagggatggcatatcagtaaaaatgtatgatagaggacatgtat tcacataacagcaaaccagaagccggggctgggctataaccaatacctac ttctcatacctaagtgtgtctctgaagcacacatgctgctctggccactt cctgtatctttttctcctgtatcttcctgtatctctgccctcctggctgc tatgatgtgaactgctgtcttctggcacattcctccctgccatgggtgaa ctgattcccttgagaccatgagcccaagttaatgcaagctgtccctgtgt catattcagttacggacatctggaagctgggactgacggtgcaacaccaa ttaatcaatcttcaagcagtgagtttcagaatcaaggctagtcttgcaat ggtaagttac
quality values	Open. Hide. 58 36 27 28 58 58 58 58 58 62 62 62 54 62 62 41 31 62 62 62 62 62 62 62 62 62 62 62 62 47 29 24 24 20 21 22 21 22 23 28 33 49 25 35 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 51 62 34 33 43 31 49 54 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 54 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 58 58 58 54 58 52 52 58 52 52 58 58 58 58 58 58 58 54 58 54 52 54 58 54 58 58 58 58 54 54 58 58 58 58 58 52 47 58 58 58 58 58 58 58 58 58 54 48 54 58 58 58 58 54 35 54 54 54 58 58 58 49 58 58 58 58 58 42 51 58 58 50 49 49 58 54 48 48 22 24 50 58 58 54 54 47 44 50 47 58 50 58 51 51 58 58 58 58 51 58 53 58 58 43 50 49 54 44 44 58 49 58 58 58 51 50 42 42 50 54 58 47 50 58 58 58 58 58 58 58 58 42 50 46 50 52 53 50 50 58 46 50 50 39 58 51 51 44 43 39 51 42 51 29 58 50 39 52 52 47 33 58 53 49 39 51 53 58 51 41 52 53 50 39 49 47 31 46 21 40 58 40 34 51 52 51 50 50 42 44 49 42 53 35 49 29 54 49 37 49 47 47 49 41 41 39 35 39 39 31 27 39 40 52 50 44 37 49 53 37 37 50 42 42 37 39 38 40 40 42 47 42 39 35 54 52 37 37 38 29 51 40 51 45 37 40 36 45 41 34 51 40 35 30 54 51 37 33 17 53 29 42 33 33 41 32 41 32 31 29 34 34 31 34 32 32 46 40 45 53 32 52 40 32 34 45 32 52 29 53 36 51 52 29 33 23 32 45 31 37 40 35 40 35 34 28 30 31 25 33 31 37 42 26 36 36 33 31 21 27 28 51 51 30 29 42 26 33 24 28 30 31 23 18 17 42 31 36 34 31 18 51 31 30 31 32 48 24 31 48 43 29 48 32 30 42 25 18 31 31 21 28 42 15 15 14 7 40 26 25 31 19 30 40 36 16 19 21 32 30 25 23 27 21 41 23 15 30 36 26 25 33 25 21 24 19 30 23 17 28 17 20 16 36 24 19 17 11 17 29 20 26 27 19 30 48 21 20 20 32 20 23 28 25 14 28 28 29 21 16 10 25 31 41 41 44 21 8 10 25 43 43 43 44 24 18 25 18 30 34 23 31 21 33 34 38 25 24 25 33 17 13 21 17 31 18 14 11 8 30 11 17 30 24 32 34 28 27 34 10 21 12 13 30 13 16 19 21 34 17 9 29 7 6 25 11 15 21 28 34 27 23 27 28 19 23 32 19 16 31 29 23 31 14 7 5 9 16 24 10 21 8 10 11 17 12 12 7 27 23 7 3 4 16 28 24 23 18 10 15 10 17 7 10 4 12 8 5 18 19 6 16 5 6 11 24 28 20 20 21 27 19 4 17 18 16 10 9 15 19 17 15 6 13 4 5 15 12 8 19 4 5 18 3 18 10 6 4 21 7 7 7 6 14 20 12 18 7 5 15 21 16 7 17 9 23 7 6 12 11 9 3 1 2 8 5 3 4 7 9 11 10 10 5 4 10 9 5 2 5 6 5 2 1 4 6 10 9 11 8 8 7	Open. Hide. 62 47 42 44 62 47 39 62 62 62 59 43 28 28 33 44 20 28 38 48 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 54 62 62 59 62 62 62 62 62 62 59 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 58 58 58 58 58 48 49 54 58 58 58 58 58 58 58 58 52 58 54 49 58 51 58 58 54 54 58 54 58 58 54 58 48 45 58 58 58 45 35 58 58 58 58 58 58 58 58 58 58 58 52 58 34 54 58 58 52 54 58 52 52 58 58 58 58 58 58 34 58 45 41 58 58 58 58 58 58 52 58 58 58 58 45 49 51 53 58 54 50 58 40 40 58 58 45 41 49 58 58 54 58 58 58 26 58 43 50 42 40 58 58 50 51 58 58 58 50 53 58 41 50 50 58 51 58 58 58 51 50 53 54 54 51 54 58 40 39 36 34 38 46 49 58 39 54 50 47 58 50 58 58 50 58 46 46 58 58 49 58 44 40 58 50 50 58 44 58 58 58 43 49 58 50 58 43 50 58 51 31 46 58 58 51 13 12 6 7 9 16 53 54 49 29 54 52 41 23 51 52 53 39 52 47 54 30 41 44 51 51 40 28 54 44 34 31 51 51 27 31 52 34 51 37 37 35 53 45 54 49 54 31 42 54 37 37 42 41 49 37 40 40 46 34 54 31 21 27 52 42 31 37 31 20 31 30 44 30 36 33 40 45 40 26 28 32 52 34 31 32 45 19 44 34 28 41 37 34 46 49 40 32 32 35 49 36 32 42 32 31 36 53 31 18 16 40 34 30 33 32 36 43 33 34 31 31 31 26 30 31 36 36 30 30 28 46 29 31 31 24 45 30 31 30 32 27 27 31 25 16 27 30 32 31 31 9 20 30 30 32 31 31 32 25 31 20 27 16 46 31 35 31 41 34 31 15 36 23 37 23 28 30 47 47 47 27 39 25 31 42 26 44 29 32 31 41 32 31 41 41 20 46 21 29 31 31 31 31 29 31 20 46 16 23 31 33 21 22 19 32 31 31 31 24 35 26 32 25 21 37 31 31 31 19 21 34 31 29 22 29 18 31 23 24 26 16 11 14 22 33 14 14 16 10 16 30 28 29 48 33 14 21 33 17 27 15 9 44 19 14 31 37 18 15 32 33 23 15 11 32 32 23 20 21 11 18 5 19 17 18 21 20 9 14 8 14 27 14 18 12 19 19 24 8 25 14 32 15 7 15 19 32 29 19 30 28 37 18 12 14 9 9 9 13 13 27 20 24 28 10 10 13 21 18 13 14 15 10 26 24 11 24 18 19 14 24 15 26 7 10 9 7 28 9 21 20 8 21 25 18 22 20 4 8 9 8 7 11 8 22 14 9 6 21 6 21 7 27 17 18 13 10 7 7 9 16 24 10 11 22 9 5 6 7 8 8 13 27 10 9 13 4 10 11 11 11 9 6 11 3 1 1 7 10 9 9 7 9 11 9 8 8 8 10 13 3 7 23 6 11 4 4 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_5550943_5552101
seq2: B6Ng01-293C24.b_47_1201 (reverse)

seq1  CAAGCATGCACTAGCA-CAGTCAACACAACTCTCATCGGGGCATCTTTGA  49
      |||||||| ||||||| |||||||||||||| ||||| ||||||  ||||
seq2  CAAGCATGGACTAGCACCAGTCAACACAACT-TCATC-GGGCATTCTTGA  48

seq1  GATCATCTGGTTCATTCGGCTTCCTAGTCTCTCGGGCGATACAACTGTGG  99
      |||||||||| ||| ||||| ||||||||| |||||||||||||||||||
seq2  GATCATCTGGGTCA-TCGGCCTCCTAGTCTTTCGGGCGATACAACTGTGG  97

seq1  CTCTAGGAATGCAGCCAGGAGCCAGCCATCACTGCAGCGATCTCAGCATG  149
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  CTCTAGGAATGCAG-CAGGAGCCAGCCATCACTGCAGCGATCTCAGCATG  146

seq1  AACTAAGAAGTAAGGTGTTACTAAGTTAAGATGTACTGGTAGAACTTACT  199
      |||| |||||||||||||||||||||||||||||||||||||||| ||||
seq2  AACT-AGAAGTAAGGTGTTACTAAGTTAAGATGTACTGGTAGAAC-TACT  194

seq1  TCCTTTTTTCCTTTTTCTGTCTCCTTCCTCCTTTCTTTGGTGAGGGAACA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTTTTTCCTTTTTCTGTCTCCTTCCTCCTTTCTTTGGTGAGGGAACA  244

seq1  GAGATCCCGCATATTATTATTAGGGGTGG-AAGGTCAAGATGCCTTTAAA  298
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  GAGATCCCGCATATTATTATTAGGGGTGGAAAGGTCAAGATGCCTTTAAA  294

seq1  TTTACTTTATATATGGATTGGGAGTTTTGTGTAGCTCATTGAAGTATGAC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACTTTATATATGGATTGGGAGTTTTGTGTAGCTCATTGAAGTATGAC  344

seq1  TAATAAAACTGTATATATTAGGGTGTATACTGTGATACTCTGAAATACAC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATAAAACTGTATATATTAGGGTGTATACTGTGATACTCTGAAATACAC  394

seq1  ATGTAAGTTGTGAAATGATTATCACGGTGAAGCAACTTACATATTCATTG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTAAGTTGTGAAATGATTATCACGGTGAAGCAACTTACATATTCATTG  444

seq1  TTTGACACTGTGATATGCCTGTAGTGAGAACACTTGAGTCTATTCTCTTA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGACACTGTGATATGCCTGTAGTGAGAACACTTGAGTCTATTCTCTTA  494

seq1  GCAAATTACCTTAGGATTTTTTTTTTAAATGGACAAAATTGCATAAAGAG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAATTACCTTAGGATTTTTTTTTTAAATGGACAAAATTGCATAAAGAG  544

seq1  ACAGCTGGCCTGGCCCATGGTAGATAGAGCTAGTTAGGAATGTTGAAAGT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCTGGCCTGGCCCATGGTAGATAGAGCTAGTTAGGAATGTTGAAAGT  594

seq1  TAGCAGCAAGCATTTTCCCTTCCCAAGCTGTTTCCAAATGTCTGTATTCG  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCAGCAAGCATTTTCCCTTCCCAAGCTGTTTCCAAATGTCTGTATTCG  644

seq1  CAACATAGACATAGCTACACAATGTAACAATGAAATCTCGGATGGCTGTT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACATAGACATAGCTACACAATGTAACAATGAAATCTCGGATGGCTGTT  694

seq1  CAGGCTGCATCCACTCTGCTTTGGAGGGGCTCCAAATGTGTATGGTGTGG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTGCATCCACTCTGCTTTGGAGGGGCTCCAAATGTGTATGGTGTGG  744

seq1  AAAACTGAGCTTTGAGCAGAAGAAACCAAAAGATCAGCTTCCCTTCCTTC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTGAGCTTTGAGCAGAAGAAACCAAAAGATCAGCTTCCCTTCCTTC  794

seq1  TGAGTTACAAAGAGTTTATATCAATGCACCCAGAAACCAGAATCTCAAAC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTTACAAAGAGTTTATATCAATGCACCCAGAAACCAGAATCTCAAAC  844

seq1  TACTCACAGTGCATGATGGAATTTGTGTATATTCTTAGGATAATAGCTAT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTCACAGTGCATGATGGAATTTGTGTATATTCTTAGGATAATAGCTAT  894

seq1  AAATGTTCTATGTACTAGACACTTTTCTAAGAATGAGTTCAGTTTATCAG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTTCTATGTACTAGACACTTTTCTAAGAATGAGTTCAGTTTATCAG  944

seq1  CACAGCATCCAAAAGGAACACTGTCTCCGTTACACAGATAAAGGGACACT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGCATCCAAAAGGAACACTGTCTCCGTTACACAGATAAAGGGACACT  994

seq1  GGGAGATTAAGCAACTCCCTCAGCCCAGCTCCCACAGCACTAAGGGGTGC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGATTAAGCAACTCCCTCAGCCCAGCTCCCACAGCACTAAGGGGTGC  1044

seq1  TCGGCACTGTGTGTGACTCGCCCTAAGTCCTTCCCTTCCAAGCCACACTC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGCACTGTGTGTGACTCGCCCTAAGTCCTTCCCTTCCAAGCCACACTC  1094

seq1  CACATTCAGGCAGTCAAATCCAGTGATCTTTACAGGGAGCAAACGTCCAG  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATTCAGGCAGTCAAATCCAGTGATCTTTACAGGGAGCAAACGTCCAG  1144

seq1  GAAAAGAATTC  1159
      |||||||||||
seq2  GAAAAGAATTC  1155

seq1: chr2_5416982_5418080
seq2: B6Ng01-293C24.g_69_1178

seq1  GAATTCAACTGTAATCAGGCAGAGAAGCAGTCGGTATAATTTTTTTGTTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAACTGTAATCAGGCAGAGAAGCAGTCGGTATAATTTTTTTGTTT  50

seq1  AAAATCACTGGGTACATGTGAACATGAGGGTTTGTGTGTGTCAGGGTGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCACTGGGTACATGTGAACATGAGGGTTTGTGTGTGTCAGGGTGCA  100

seq1  TATTACAGCCTGCATGTGGAGATCAGAGGACAAACCCAGGCAGCAATCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTACAGCCTGCATGTGGAGATCAGAGGACAAACCCAGGCAGCAATCCT  150

seq1  TGCCTTCTACCTTGTTTGAGATAGGGCCTCTTTTTGATCATTTTGTACCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTTCTACCTTGTTTGAGATAGGGCCTCTTTTTGATCATTTTGTACCC  200

seq1  CAGGTTAGCTGGCCTAGAAGCCTCCAGAGAGTCTCTTGTCTCTACCTCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTTAGCTGGCCTAGAAGCCTCCAGAGAGTCTCTTGTCTCTACCTCTC  250

seq1  ATTTCGCAGTGGGCACACCAGGATTACAGATGAGTGGTACTGTGCCCAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCGCAGTGGGCACACCAGGATTACAGATGAGTGGTACTGTGCCCAGC  300

seq1  TTTACATGGGTTCTGGGGAGATTCAAACTCAAGGTCTCACTCTTGTATGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACATGGGTTCTGGGGAGATTCAAACTCAAGGTCTCACTCTTGTATGG  350

seq1  CAGGCATGATACCTACTGAGCCACCATCGCAGCCTTTCACACGACGTCTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCATGATACCTACTGAGCCACCATCGCAGCCTTTCACACGACGTCTC  400

seq1  CCAGCCTGTGATGCATGCTCAGAAGCATCAAGCAGAAGCAAATACCTTCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCTGTGATGCATGCTCAGAAGCATCAAGCAGAAGCAAATACCTTCT  450

seq1  TCCAGGATCAATGCAGATTTGTCTCCAAGAACCCAAGCAGTCATGGACGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGATCAATGCAGATTTGTCTCCAAGAACCCAAGCAGTCATGGACGG  500

seq1  GCAGAGGAACTGAAGAATAGGAATGTTAGAATTTCCAAGTGGGAAAAAGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAGGAACTGAAGAATAGGAATGTTAGAATTTCCAAGTGGGAAAAAGA  550

seq1  CGTTAAACATTTGGAGGATGGTCTGTGTTGCGTCTTCCAGGGATGGGCAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTAAACATTTGGAGGATGGTCTGTGTTGCGTCTTCCAGGGATGGGCAA  600

seq1  AGGGCACGTATGCTAGTTATCTTTGCACTGCTGTGACCAAAATACCGAAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCACGTATGCTAGTTATCTTTGCACTGCTGTGACCAAAATACCGAAC  650

seq1  ACAAAGAATTTAAAGGGAAAGCATTCATTTTGGCTTATGGTTTCAACTCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAGAATTTAAAGGGAAAGCATTCATTTTGGCTTATGGTTTCAACTCA  700

seq1  CCATGTCAGGGATGGCATATCAGTAAAAATGTATGATAGAGGACATGTAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGTCAGGGATGGCATATCAGTAAAAATGTATGATAGAGGACATGTAT  750

seq1  TCACATAACAGCAAACCAGAAGCCGGGGCTGGGCTATAACCAATACCTAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACATAACAGCAAACCAGAAGCCGGGGCTGGGCTATAACCAATACCTAC  800

seq1  TTCTCATACCTAAGTGTGTCTCTGAAGCACACATGCTGCTCTGGCCACTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCATACCTAAGTGTGTCTCTGAAGCACACATGCTGCTCTGGCCACTT  850

seq1  CCTGTATCTTTTTCTCCTGTATCTTCCTGTATCTCTG-CCTCCTGGCTGC  899
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  CCTGTATCTTTTTCTCCTGTATCTTCCTGTATCTCTGCCCTCCTGGCTGC  900

seq1  TATGATGTGAACTGCTGTCTTCTGGCACA-TCCTCCCTGCCAT-GGTGAA  947
      ||||||||||||||||||||||||||||| ||||||||||||| ||||||
seq2  TATGATGTGAACTGCTGTCTTCTGGCACATTCCTCCCTGCCATGGGTGAA  950

seq1  CTGA-TCCCTTGAGACCATGAG-CCAAGTTAATGCAAGCTGTCCCTGTGT  995
      |||| ||||||||||||||||| |||||||||||||||||||||||||||
seq2  CTGATTCCCTTGAGACCATGAGCCCAAGTTAATGCAAGCTGTCCCTGTGT  1000

seq1  CATATTCAGTTACGGACATCTGGAAGCTGGACCTGACGGTGC-ACACC-A  1043
      ||||||||||||||||||||||||||||||  |||||||||| ||||| |
seq2  CATATTCAGTTACGGACATCTGGAAGCTGGGACTGACGGTGCAACACCAA  1050

seq1  TTAATCAATCTCAAAGCAGTGAG-TTCAAGATC-AGGGTAGTC-TGC-AT  1089
      |||||||||||  |||||||||| ||||  ||| ||| ||||| ||| ||
seq2  TTAATCAATCTTCAAGCAGTGAGTTTCAGAATCAAGGCTAGTCTTGCAAT  1100

seq1  GGTAAGTTAC  1099
      ||||||||||
seq2  GGTAAGTTAC  1110

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information