MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-293E02
Chromosome	2 (Build37)
Map Location	86,354,716 - 86,355,244
singlet/doublet	singlet
Overlap gene	none
Upstream gene	4833423E24Rik, Olfr996, Olfr997-ps1, Olfr998, Olfr999-ps1, Olfr1000, Olfr1001-ps1, Olfr1002, GA_x5J8B7W531T-1558688-1559570, Olfr1004-ps1, Olfr154, GA_x5J8B7W531T-1577060-1577325, Olfr1006, GA_x5J8B7W531T-1588603-1588734, Olfr1008, Olfr1009, Olfr1010, Olfr1012, Olfr1013, Olfr1014, Olfr1015, Olfr1016, GA_x5J8B7W3KVV-518538-519236, Olfr1018, Olfr1019, Olfr1020, Olfr1021-ps1, Olfr1022, Olfr1023, Olfr1024, Olfr1025-ps1, Olfr1026, Olfr1027-ps1, Olfr1028, Olfr1029, Olfr1030, Olfr1031, Olfr1032, LOC100042075, Olfr1033, Olfr1034, Olfr1533-ps1, Olfr1035-ps1, Olfr1036, Olfr1037, LOC100041372, Olfr1038, Olfr1039, Olfr1040, GA_x5J8B7W3KVV-170014-170572, Olfr1042, Olfr1043, Olfr1044, Olfr52, Olfr1045, Olfr1046, Olfr1047, Olfr1048, Olfr1049, Olfr1050-ps1, Olfr1051, GA_x5J8B7W3KVV-25848-25992, Olfr1052, Olfr1053-ps1, Olfr1054, Olfr1055, Olfr1056, Olfr1057, GA_x5J8B7TRQ4E-1174-939, Olfr1058, Olfr1059-ps1, Olfr1515, Olfr1062, Olfr1063-ps1, Olfr1064-ps1, Olfr1065, Olfr1066, Olfr1069-ps1, Olfr1070-ps1, Olfr228, Olfr1073-ps1, Olfr1075-ps1, GA_x5J8B7W4CQV-104617-103730, Olfr1076
Downstream gene	LOC625853, Olfr1078-ps1, GA_x5J8B7W4CQV-78329-78805, Olfr1079, Olfr1080, Olfr1081-ps1, Olfr1082, GA_x5J8B7W4CQV-18360-18784, Olfr1083, Olfr1084, Olfr1085, Olfr1086, Olfr1087, Olfr1088-ps1, Olfr1089, Olfr1090, Olfr1091-ps1, GA_x5J8B7W3Y5M-123838-124302, Olfr1093, Olfr141, Olfr1094, Olfr1095, Olfr1096-ps1, Olfr1097, Olfr1098, Olfr1099, Olfr1100, Olfr1101, Olfr1102, Olfr1103-ps1, Olfr1104, Olfr1105, Olfr1106, Olfr1107, GA_x5J8B7W3Y5M-419033-418135, Olfr1109, Olfr259, LOC668402, Olfr1110, Olfr1111, Olfr1112, LOC228238, Olfr1113, Olfr1114-ps1, LOC546767, Olfr1115, Olfr1521-ps1, LOC100041923, Olfr1117-ps1, GA_x5J8B7TY7N2-4-429, LOC668424, Olfr1118, Olfr1119-ps1, Olfr1120, Olfr1121, Olfr1122, LOC668432, Olfr1123, Olfr1125, Olfr1126, Pramel7, Pramel6
Link	Open Mouse BAC browser

Click to get alignment info.

name	4833423E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228151 MGI:2687041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr996 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258429 MGI:3030830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr997-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257998 MGI:3030831
definition	gene_synonym : MOR175-8P note : olfactory receptor 997, pseudogene 1 pseudo : _no_value

name	Olfr998 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258428 MGI:3030832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr999-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258076 MGI:3030833
definition	gene_synonym : MOR175-7P note : olfactory receptor 999, pseudogene 1 pseudo : _no_value

name	Olfr1000 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257899 MGI:3030834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1001-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258078 MGI:3030835
definition	gene_synonym : MOR175-6 note : olfactory receptor 1001, pseudogene 1 pseudo : _no_value

name	Olfr1002 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258566 MGI:3030836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1558688-1559570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257814
definition	note : olfactory receptor GA_x5J8B7W531T-1558688-1559570 pseudo : _no_value

name	Olfr1004-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258244 MGI:3030838
definition	gene_synonym : GA_x5J8B7W2F7R-2521-3120; MOR213-8 note : olfactory receptor 1004, pseudogene 1 pseudo : _no_value

name	Olfr154 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27216 MGI:1351316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1577060-1577325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257813
definition	note : olfactory receptor GA_x5J8B7W531T-1577060-1577325 pseudo : _no_value

name	Olfr1006 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258563 MGI:3030840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W531T-1588603-1588734 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257812
definition	note : olfactory receptor GA_x5J8B7W531T-1588603-1588734 pseudo : _no_value

name	Olfr1008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258866 MGI:3030842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258565 MGI:3030843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1010 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258255 MGI:3030844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1012 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258561 MGI:3030846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1013 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258757 MGI:3030847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1014 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258562 MGI:3030848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1015 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258564 MGI:3030849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257915 MGI:3030850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3KVV-518538-519236 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257840
definition	note : olfactory receptor GA_x5J8B7W3KVV-518538-519236 pseudo : _no_value

name	Olfr1018 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258579 MGI:3030852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1019 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259017 MGI:3030853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1020 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258573 MGI:3030854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1021-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258574 MGI:3030855
definition	gene_synonym : MOR201-1 note : olfactory receptor 1021, pseudogene 1 pseudo : _no_value

name	Olfr1022 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258582 MGI:3030856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1023 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258580 MGI:3030857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1024 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257900 MGI:3030858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1025-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258083 MGI:3030859
definition	gene_synonym : MOR196-5P; MOR196-6_p note : olfactory receptor 1025, pseudogene 1 pseudo : _no_value

name	Olfr1026 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258577 MGI:3030860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1027-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258082 MGI:3030861
definition	gene_synonym : MOR198-2P; MOR198-5_p note : olfactory receptor 1027, pseudogene 1 pseudo : _no_value

name	Olfr1028 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257936 MGI:3030862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1029 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258154 MGI:3030863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1030 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258581 MGI:3030864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1031 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257916 MGI:3030865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1032 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258572 MGI:3030866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042075 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs

name	Olfr1033 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258571 MGI:3030867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1034 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258216 MGI:3030868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1533-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258080 MGI:3031367
definition	gene_synonym : MOR227-8P note : olfactory receptor 1533, pseudogene 1 pseudo : _no_value

name	Olfr1035-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258081 MGI:3030869
definition	gene_synonym : MOR171-31P note : olfactory receptor 1035, pseudogene 1 pseudo : _no_value

name	Olfr1036 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258245 MGI:3030870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1037 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259151 MGI:3030871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr1038 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259015 MGI:3030872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1039 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257950 MGI:3030873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr1040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404323 MGI:3030874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3KVV-170014-170572 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257843
definition	note : olfactory receptor GA_x5J8B7W3KVV-170014-170572 pseudo : _no_value

name	Olfr1042 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257941 MGI:3030876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1043 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258570 MGI:3030877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259013 MGI:3030878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18352 MGI:1333748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1045 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259019 MGI:3030879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258575 MGI:3030880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259014 MGI:3030881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1048 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259016 MGI:3030882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259018 MGI:3030883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1050-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404461 MGI:3030884
definition	gene_synonym : MOR194-2_p note : olfactory receptor 1050, pseudogene 1 pseudo : _no_value

name	Olfr1051 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404324 MGI:3030885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3KVV-25848-25992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257842
definition	note : olfactory receptor GA_x5J8B7W3KVV-25848-25992 pseudo : _no_value

name	Olfr1052 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259012 MGI:3030886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1053-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257974 MGI:3030887
definition	gene_synonym : MOR187-4 note : olfactory receptor 1053, pseudogene 1 pseudo : _no_value

name	Olfr1054 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259021 MGI:3030888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259023 MGI:3030889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1056 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259020 MGI:3030890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1057 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404325 MGI:3030891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7TRQ4E-1174-939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257867
definition	note : olfactory receptor GA_x5J8B7TRQ4E-1174-939 pseudo : _no_value

name	Olfr1058 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258386 MGI:3030892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1059-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404462 MGI:3030893
definition	gene_synonym : MOR190-6_p note : olfactory receptor 1059, pseudogene 1 pseudo : _no_value

name	Olfr1515 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259022 MGI:3031349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr1062 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259082 MGI:3030896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1063-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259140 MGI:3030897
definition	gene_synonym : MOR190-3P note : olfactory receptor 1063, pseudogene 1 pseudo : _no_value

name	Olfr1064-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404463 MGI:3030898
definition	note : olfactory receptor 1064, pseudogene 1 pseudo : _no_value

name	Olfr1065 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258403 MGI:3030899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1066 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257880 MGI:3030900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1069-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404465 MGI:3030903
definition	gene_synonym : MOR189-8_p note : olfactory receptor 1069, pseudogene 1 pseudo : _no_value

name	Olfr1070-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404466 MGI:3030904
definition	note : olfactory receptor 1070, pseudogene 1 pseudo : _no_value

name	Olfr228 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258400 MGI:3030062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1073-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257989 MGI:3030907
definition	gene_synonym : MOR188-6P note : olfactory receptor 1073, pseudogene 1 pseudo : _no_value

name	Olfr1075-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404470 MGI:3030909
definition	note : olfactory receptor 1075, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W4CQV-104617-103730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257829
definition	note : olfactory receptor GA_x5J8B7W4CQV-104617-103730 pseudo : _no_value

name	Olfr1076 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258401 MGI:3030910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625853 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	Olfr1078-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404471 MGI:3030912
definition	note : olfactory receptor 1078, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W4CQV-78329-78805 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257825
definition	note : olfactory receptor GA_x5J8B7W4CQV-78329-78805 pseudo : _no_value

name	Olfr1079 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258402 MGI:3030913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258404 MGI:3030914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1081-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404472 MGI:3030915
definition	gene_synonym : MOR191-4_p note : olfactory receptor 1081, pseudogene 1 pseudo : _no_value

name	Olfr1082 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404473 MGI:3030916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W4CQV-18360-18784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257826
definition	note : olfactory receptor GA_x5J8B7W4CQV-18360-18784 pseudo : _no_value

name	Olfr1083 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404326 MGI:3030917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1084 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258235 MGI:3030918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1085 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258583 MGI:3030919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1086 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258585 MGI:3030920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1087 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258843 MGI:3030921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1088-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404474 MGI:3030922
definition	note : olfactory receptor 1088, pseudogene 1 pseudo : _no_value

name	Olfr1089 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257933 MGI:3030923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1090 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258844 MGI:3030924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1091-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404475 MGI:3030925
definition	note : olfactory receptor 1091, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W3Y5M-123838-124302 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257832
definition	note : olfactory receptor GA_x5J8B7W3Y5M-123838-124302 pseudo : _no_value

name	Olfr1093 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258363 MGI:3030927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr141 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257913 MGI:2177524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1094 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258362 MGI:3030928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1095 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258725 MGI:3030929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1096-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257901 MGI:3030930
definition	gene_synonym : MOR206-6 note : olfactory receptor 1096, pseudogene 1 pseudo : _no_value

name	Olfr1097 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258840 MGI:3030931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1098 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258842 MGI:3030932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258764 MGI:3030933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1100 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258587 MGI:3030934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258584 MGI:3030935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228228 MGI:3030936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1103-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258084 MGI:3030937
definition	gene_synonym : MOR206-5P note : olfactory receptor 1103, pseudogene 1 pseudo : _no_value

name	Olfr1104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258763 MGI:3030938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258085 MGI:3030939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258747 MGI:3030940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258841 MGI:3030941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3Y5M-419033-418135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257831
definition	note : olfactory receptor GA_x5J8B7W3Y5M-419033-418135 pseudo : _no_value

name	Olfr1109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258762 MGI:3030943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258766 MGI:3030093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668402 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Olfr1110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258765 MGI:3030944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1111 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258586 MGI:3030945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258655 MGI:3030946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC228238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:228238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr1113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404327 MGI:3030947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1114-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404478 MGI:3030948
definition	note : olfactory receptor 1114, pseudogene 1 pseudo : _no_value

name	LOC546767 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Olfr1115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258294 MGI:3030949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1521-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258190 MGI:3031355
definition	gene_synonym : MOR264-8P note : olfactory receptor 1521, pseudogene 1 pseudo : _no_value

name	LOC100041923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr1117-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258110 MGI:3030951
definition	gene_synonym : MOR264-10P note : olfactory receptor 1117, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7TY7N2-4-429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257859
definition	note : olfactory receptor GA_x5J8B7TY7N2-4-429 pseudo : _no_value

name	LOC668424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr1118 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404328 MGI:3030952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1119-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258002 MGI:3030953
definition	gene_synonym : MOR264-15P note : olfactory receptor 1119, pseudogene 1 pseudo : _no_value

name	Olfr1120 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259031 MGI:3030954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258345 MGI:3030955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1122 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259033 MGI:3030956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 243 ESTs, 9 Proteins pseudo : _no_value

name	Olfr1123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258347 MGI:3030957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1125 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259030 MGI:3030959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258834 MGI:3030960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pramel7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:347712 MGI:2156391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pramel6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:347711 MGI:2156390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833423E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157489 GeneID:228151 MGI:2687041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833423E24 gene transcript_id : NM_001081664.1

name	Olfr996 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239183 GeneID:258429 MGI:3030830
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 996 transcript_id : NM_146437.1

name	Olfr998 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239185 GeneID:258428 MGI:3030832
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 998 transcript_id : NM_146436.1

name	Olfr1000 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58743311 GeneID:257899 MGI:3030834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1000 transcript_id : NM_001011695.1

name	Olfr1002 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583706 GeneID:258566 MGI:3030836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1002 transcript_id : NM_146573.2

name	Olfr154 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305340 GeneID:27216 MGI:1351316
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 154 transcript_id : NM_013728.1

name	Olfr1006 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983508 GeneID:258563 MGI:3030840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1006 transcript_id : NM_146570.2

name	Olfr1008 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129140 GeneID:258866 MGI:3030842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1008 transcript_id : NM_146866.1

name	Olfr1009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129498 GeneID:258565 MGI:3030843
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1009 transcript_id : NM_146572.1

name	Olfr1010 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821663 GeneID:258255 MGI:3030844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1010 transcript_id : NM_207149.2

name	Olfr1012 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129506 GeneID:258561 MGI:3030846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1012 transcript_id : NM_146568.1

name	Olfr1013 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583642 GeneID:258757 MGI:3030847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1013 transcript_id : NM_146762.2

name	Olfr1014 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582636 GeneID:258562 MGI:3030848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1014 transcript_id : NM_146569.2

name	Olfr1015 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129504 GeneID:258564 MGI:3030849
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1015 transcript_id : NM_146571.1

name	Olfr1016 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801303 GeneID:257915 MGI:3030850
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1016 transcript_id : NM_001011758.1

name	Olfr1018 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583728 GeneID:258579 MGI:3030852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1018 transcript_id : NM_146586.2

name	Olfr1019 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128910 GeneID:259017 MGI:3030853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1019 transcript_id : NM_147015.1

name	Olfr1020 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129488 GeneID:258573 MGI:3030854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1020 transcript_id : NM_146580.1

name	Olfr1022 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129468 GeneID:258582 MGI:3030856
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1022 transcript_id : NM_146589.1

name	Olfr1023 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195675 GeneID:258580 MGI:3030857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1023 transcript_id : NM_146587.2

name	Olfr1024 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421325 GeneID:257900 MGI:3030858
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1024 transcript_id : NM_001005230.1

name	Olfr1026 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583708 GeneID:258577 MGI:3030860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1026 transcript_id : NM_146584.2

name	Olfr1028 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801323 GeneID:257936 MGI:3030862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1028 transcript_id : NM_001011774.1

name	Olfr1029 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801461 GeneID:258154 MGI:3030863
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1029 transcript_id : NM_001011852.1

name	Olfr1030 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129472 GeneID:258581 MGI:3030864
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1030 transcript_id : NM_146588.1

name	Olfr1031 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801305 GeneID:257916 MGI:3030865
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1031 transcript_id : NM_001011759.1

name	Olfr1032 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129486 GeneID:258572 MGI:3030866
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1032 transcript_id : NM_146579.1

name	LOC100042075 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249883 GeneID:100042075
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs product : similar to gag protein transcript_id : XM_001477698.1

name	Olfr1033 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84697029 GeneID:258571 MGI:3030867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1033 transcript_id : NM_146578.2

name	Olfr1034 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801503 GeneID:258216 MGI:3030868
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1034 transcript_id : NM_001011872.1

name	Olfr1036 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369492 GeneID:258245 MGI:3030870
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1036 transcript_id : NM_207142.1

name	Olfr1037 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372135 GeneID:259151 MGI:3030871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1037 transcript_id : NM_001011532.1

name	Olfr1038 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983542 GeneID:259015 MGI:3030872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1038 transcript_id : NM_147013.2

name	Olfr1039 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801337 GeneID:257950 MGI:3030873
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 1039 transcript_id : NM_001011784.1

name	Olfr1040 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807190 GeneID:404323 MGI:3030874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1040 transcript_id : NM_207561.2

name	Olfr1042 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801329 GeneID:257941 MGI:3030876
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1042 transcript_id : NM_001011777.1

name	Olfr1043 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195668 GeneID:258570 MGI:3030877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1043 transcript_id : NM_146577.2

name	Olfr1044 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128918 GeneID:259013 MGI:3030878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1044 transcript_id : NM_147011.1

name	Olfr52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208857 GeneID:18352 MGI:1333748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 52 transcript_id : NM_146583.1

name	Olfr1045 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735413 GeneID:259019 MGI:3030879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1045 transcript_id : NM_147017.2

name	Olfr1046 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129484 GeneID:258575 MGI:3030880
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1046 transcript_id : NM_146582.1

name	Olfr1047 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128912 GeneID:259014 MGI:3030881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1047 transcript_id : NM_147012.1

name	Olfr1048 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128908 GeneID:259016 MGI:3030882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1048 transcript_id : NM_147014.1

name	Olfr1049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056730 GeneID:259018 MGI:3030883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1049 transcript_id : NM_147016.2

name	Olfr1051 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430575 GeneID:404324 MGI:3030885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1051 transcript_id : NM_207562.1

name	Olfr1052 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128916 GeneID:259012 MGI:3030886
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1052 transcript_id : NM_147010.1

name	Olfr1054 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128900 GeneID:259021 MGI:3030888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1054 transcript_id : NM_147019.1

name	Olfr1055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128896 GeneID:259023 MGI:3030889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1055 transcript_id : NM_147021.1

name	Olfr1056 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27544964 GeneID:259020 MGI:3030890
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1056 transcript_id : NM_147018.1

name	Olfr1057 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807187 GeneID:404325 MGI:3030891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1057 transcript_id : NM_207563.2

name	Olfr1058 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671316 GeneID:258386 MGI:3030892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1058 transcript_id : NM_146391.2

name	Olfr1515 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128902 GeneID:259022 MGI:3031349
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 1515 transcript_id : NM_147020.1

name	Olfr1062 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301220 GeneID:259082 MGI:3030896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1062 transcript_id : NM_147078.2

name	Olfr1065 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575925 GeneID:258403 MGI:3030899
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1065 transcript_id : NM_146408.1

name	Olfr1066 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801263 GeneID:257880 MGI:3030900
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1066 transcript_id : NM_001011735.1

name	Olfr228 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174771 GeneID:258400 MGI:3030062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 228 transcript_id : NM_146405.2

name	Olfr1076 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239151 GeneID:258401 MGI:3030910
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1076 transcript_id : NM_146406.1

name	LOC625853 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249879 GeneID:625853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : similar to olfactory receptor MOR189-2 transcript_id : XM_001476746.1

name	Olfr1079 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239157 GeneID:258402 MGI:3030913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1079 transcript_id : NM_146407.1

name	Olfr1080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665724 GeneID:258404 MGI:3030914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1080 transcript_id : NM_146409.2

name	Olfr1082 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112983510 GeneID:404473 MGI:3030916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1082 transcript_id : NM_207674.2

name	Olfr1083 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056732 GeneID:404326 MGI:3030917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1083 transcript_id : NM_207564.2

name	Olfr1084 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953201 GeneID:258235 MGI:3030918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1084 transcript_id : NM_207135.2

name	Olfr1085 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129470 GeneID:258583 MGI:3030919
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1085 transcript_id : NM_146590.1

name	Olfr1086 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129466 GeneID:258585 MGI:3030920
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1086 transcript_id : NM_146592.1

name	Olfr1087 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129174 GeneID:258843 MGI:3030921
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1087 transcript_id : NM_146846.1

name	Olfr1089 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801319 GeneID:257933 MGI:3030923
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1089 transcript_id : NM_001011771.1

name	Olfr1090 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129168 GeneID:258844 MGI:3030924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1090 transcript_id : NM_146847.1

name	Olfr1093 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129566 GeneID:258363 MGI:3030927
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1093 transcript_id : NM_146366.1

name	Olfr141 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444915 GeneID:257913 MGI:2177524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 141 transcript_id : NM_181818.2

name	Olfr1094 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129572 GeneID:258362 MGI:3030928
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1094 transcript_id : NM_146365.1

name	Olfr1095 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056734 GeneID:258725 MGI:3030929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1095 transcript_id : NM_146730.2

name	Olfr1097 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129176 GeneID:258840 MGI:3030931
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1097 transcript_id : NM_146843.1

name	Olfr1098 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174765 GeneID:258842 MGI:3030932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1098 transcript_id : NM_146845.2

name	Olfr1099 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129310 GeneID:258764 MGI:3030933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1099 transcript_id : NM_146768.1

name	Olfr1100 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129462 GeneID:258587 MGI:3030934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1100 transcript_id : NM_146594.1

name	Olfr1101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195673 GeneID:258584 MGI:3030935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1101 transcript_id : NM_146591.2

name	Olfr1102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47131204 GeneID:228228 MGI:3030936
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1102 transcript_id : NM_207154.1

name	Olfr1104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583684 GeneID:258763 MGI:3030938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1104 transcript_id : NM_146767.2

name	Olfr1105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801413 GeneID:258085 MGI:3030939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1105 transcript_id : NM_001011825.1

name	Olfr1106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129344 GeneID:258747 MGI:3030940
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1106 transcript_id : NM_146752.1

name	Olfr1107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129178 GeneID:258841 MGI:3030941
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1107 transcript_id : NM_146844.1

name	Olfr1109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671318 GeneID:258762 MGI:3030943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1109 transcript_id : NM_146766.2

name	Olfr259 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735417 GeneID:258766 MGI:3030093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 259 transcript_id : NM_146770.2

name	Olfr1110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129312 GeneID:258765 MGI:3030944
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1110 transcript_id : NM_146769.1

name	Olfr1111 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129460 GeneID:258586 MGI:3030945
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1111 transcript_id : NM_146593.1

name	Olfr1112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238903 GeneID:258655 MGI:3030946
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1112 transcript_id : NM_146661.1

name	Olfr1113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430589 GeneID:404327 MGI:3030947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1113 transcript_id : NM_207565.1

name	Olfr1115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129694 GeneID:258294 MGI:3030949
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1115 transcript_id : NM_146297.1

name	Olfr1118 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518533 GeneID:404328 MGI:3030952
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1118 transcript_id : NM_207632.1

name	Olfr1120 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128890 GeneID:259031 MGI:3030954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1120 transcript_id : NM_147029.1

name	Olfr1121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129605 GeneID:258345 MGI:3030955
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1121 transcript_id : NM_146348.1

name	Olfr1122 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128886 GeneID:259033 MGI:3030956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1122 transcript_id : NM_147031.1

name	Olfr1123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583710 GeneID:258347 MGI:3030957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1123 transcript_id : NM_146350.2

name	Olfr1125 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529457 GeneID:259030 MGI:3030959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1125 transcript_id : NM_147028.2

name	Olfr1126 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583682 GeneID:258834 MGI:3030960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1126 transcript_id : NM_146837.2

name	Pramel7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342428 GeneID:347712 MGI:2156391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma like 7 transcript_id : NM_178250.2

name	Pramel6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342427 GeneID:347711 MGI:2156390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma like 6 transcript_id : NM_178249.2

name	4833423E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157490 GeneID:228151 MGI:2687041
definition	codon_start : 1 product : hypothetical protein LOC228151 protein_id : NP_001075133.1

name	Olfr996 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239184 CCDS:CCDS16209.1 GeneID:258429 MGI:3030830
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47058060-47059004; olfactory receptor MOR175-4 product : olfactory receptor 996 protein_id : NP_666648.1

name	Olfr998 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239186 CCDS:CCDS16210.1 GeneID:258428 MGI:3030832
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47069356-47070300; olfactory receptor MOR175-5 product : olfactory receptor 998 protein_id : NP_666647.1

name	Olfr1000 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58743312 CCDS:CCDS16211.1 GeneID:257899 MGI:3030834
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47087719-47086775; olfactory receptor MOR175-9 product : olfactory receptor 1000 protein_id : NP_001011695.1

name	Olfr1002 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583707 CCDS:CCDS16212.1 GeneID:258566 MGI:3030836
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47127746-47126790; olfactory receptor MOR175-2 product : olfactory receptor 1002 protein_id : NP_666784.2

name	Olfr154 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305341 CCDS:CCDS16213.1 GeneID:27216 MGI:1351316
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR175-1; olfactory receptor 4 cluster, gene 3; GA_x6K02T2Q125-47143827-47142871 product : olfactory receptor 154 protein_id : NP_038756.1

name	Olfr1006 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983509 GeneID:258563 MGI:3030840
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47154544-47153606; olfactory receptor MOR213-4 product : olfactory receptor 1006 protein_id : NP_666781.2

name	Olfr1008 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129141 CCDS:CCDS16215.1 GeneID:258866 MGI:3030842
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47170431-47171372; olfactory receptor MOR187-3 product : olfactory receptor 1008 protein_id : NP_667077.1

name	Olfr1009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129499 CCDS:CCDS16216.1 GeneID:258565 MGI:3030843
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47195323-47196267; olfactory receptor MOR175-3 product : olfactory receptor 1009 protein_id : NP_666783.1

name	Olfr1010 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821664 GeneID:258255 MGI:3030844
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-47228321-47229256; olfactory receptor MOR213-1 product : olfactory receptor 1010 protein_id : NP_997032.2

name	Olfr1012 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129507 CCDS:CCDS16217.1 GeneID:258561 MGI:3030846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47239120-47238185; olfactory receptor MOR213-6 product : olfactory receptor 1012 protein_id : NP_666779.1

name	Olfr1013 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583643 CCDS:CCDS16218.1 GeneID:258757 MGI:3030847
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47248551-47249468; olfactory receptor MOR213-2 product : olfactory receptor 1013 protein_id : NP_666973.2

name	Olfr1014 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582637 CCDS:CCDS16219.1 GeneID:258562 MGI:3030848
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47255337-47256254; olfactory receptor MOR213-5 product : olfactory receptor 1014 protein_id : NP_666780.2

name	Olfr1015 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129505 CCDS:CCDS16220.1 GeneID:258564 MGI:3030849
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47264151-47265089; olfactory receptor MOR213-3 product : olfactory receptor 1015 protein_id : NP_666782.1

name	Olfr1016 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801304 CCDS:CCDS16221.1 GeneID:257915 MGI:3030850
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47278889-47277960; olfactory receptor MOR213-9 product : olfactory receptor 1016 protein_id : NP_001011758.1

name	Olfr1018 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583729 CCDS:CCDS16222.1 GeneID:258579 MGI:3030852
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47301584-47302519; olfactory receptor MOR260-5 product : olfactory receptor 1018 protein_id : NP_666797.2

name	Olfr1019 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128911 CCDS:CCDS16223.1 GeneID:259017 MGI:3030853
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47320309-47319377; olfactory receptor MOR180-1 product : olfactory receptor 1019 protein_id : NP_667226.1

name	Olfr1020 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129489 CCDS:CCDS16224.1 GeneID:258573 MGI:3030854
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47327964-47328917; olfactory receptor MOR201-2 product : olfactory receptor 1020 protein_id : NP_666791.1

name	Olfr1022 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129469 CCDS:CCDS16225.1 GeneID:258582 MGI:3030856
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47347069-47348016; olfactory receptor MOR196-1 product : olfactory receptor 1022 protein_id : NP_666800.1

name	Olfr1023 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195676 CCDS:CCDS16226.1 GeneID:258580 MGI:3030857
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47363965-47364900; olfactory receptor MOR196-3 product : olfactory receptor 1023 protein_id : NP_666798.2

name	Olfr1024 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421326 CCDS:CCDS16227.1 GeneID:257900 MGI:3030858
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47384320-47383337; olfactory receptor MOR197-1 product : olfactory receptor 1024 protein_id : NP_001005230.1

name	Olfr1026 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583709 CCDS:CCDS16228.1 GeneID:258577 MGI:3030860
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47402610-47403533; olfactory receptor MOR196-4 product : olfactory receptor 1026 protein_id : NP_666795.2

name	Olfr1028 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801324 CCDS:CCDS16229.1 GeneID:257936 MGI:3030862
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47430129-47431103; olfactory receptor MOR198-4 product : olfactory receptor 1028 protein_id : NP_001011774.1

name	Olfr1029 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801462 CCDS:CCDS16230.1 GeneID:258154 MGI:3030863
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47454152-47455126; olfactory receptor MOR198-1P product : olfactory receptor 1029 protein_id : NP_001011852.1

name	Olfr1030 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129473 CCDS:CCDS16231.1 GeneID:258581 MGI:3030864
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47462755-47463693; olfactory receptor MOR196-2 product : olfactory receptor 1030 protein_id : NP_666799.1

name	Olfr1031 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801306 CCDS:CCDS16232.1 GeneID:257916 MGI:3030865
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47470765-47471775; olfactory receptor MOR200-1 product : olfactory receptor 1031 protein_id : NP_001011759.1

name	Olfr1032 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129487 CCDS:CCDS16233.1 GeneID:258572 MGI:3030866
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47485813-47486745; olfactory receptor MOR199-1 product : olfactory receptor 1032 protein_id : NP_666790.1

name	LOC100042075 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249884 GeneID:100042075
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001477748.1

name	Olfr1033 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129493 CCDS:CCDS16234.1 GeneID:258571 MGI:3030867
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47516301-47517233; olfactory receptor MOR199-2 product : olfactory receptor 1033 protein_id : NP_666789.1

name	Olfr1034 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801504 CCDS:CCDS16235.1 GeneID:258216 MGI:3030868
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47521463-47522395; olfactory receptor MOR245-14P product : olfactory receptor 1034 protein_id : NP_001011872.1

name	Olfr1036 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369493 CCDS:CCDS16236.1 GeneID:258245 MGI:3030870
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47549689-47550621; olfactory receptor MOR262-13 product : olfactory receptor 1036 protein_id : NP_997025.1

name	Olfr1037 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372136 CCDS:CCDS16237.1 GeneID:259151 MGI:3030871
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47560740-47559775; olfactory receptor MOR256-34P product : olfactory receptor 1037 protein_id : NP_001011532.1

name	Olfr1038 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128915 GeneID:259015 MGI:3030872
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-47591072-47592031; olfactory receptor MOR185-3 product : olfactory receptor 1038 protein_id : NP_667224.1

name	Olfr1039 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801338 CCDS:CCDS16238.1 GeneID:257950 MGI:3030873
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47600809-47599850; olfactory receptor MOR185-9P product : olfactory receptor 1039 protein_id : NP_001011784.1

name	Olfr1040 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807191 CCDS:CCDS16239.1 GeneID:404323 MGI:3030874
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47615732-47614791 product : olfactory receptor 1040 protein_id : NP_997444.2

name	Olfr1042 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801330 CCDS:CCDS16240.1 GeneID:257941 MGI:3030876
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47629317-47628376; olfactory receptor MOR185-10 product : olfactory receptor 1042 protein_id : NP_001011777.1

name	Olfr1043 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129491 CCDS:CCDS16241.1 GeneID:258570 MGI:3030877
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47631900-47630956; olfactory receptor MOR185-7 product : olfactory receptor 1043 protein_id : NP_666788.1

name	Olfr1044 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128919 CCDS:CCDS16242.1 GeneID:259013 MGI:3030878
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47640742-47639798; olfactory receptor MOR185-4 product : olfactory receptor 1044 protein_id : NP_667222.1

name	Olfr52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208858 CCDS:CCDS16243.1 GeneID:18352 MGI:1333748
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47650922-47649963 product : olfactory receptor 52 protein_id : NP_666794.1

name	Olfr1045 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735414 CCDS:CCDS16244.1 GeneID:259019 MGI:3030879
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47672825-47671878; olfactory receptor MOR185-2 product : olfactory receptor 1045 protein_id : NP_667228.2

name	Olfr1046 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129485 CCDS:CCDS16245.1 GeneID:258575 MGI:3030880
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47692494-47691544; olfactory receptor MOR194-1 product : olfactory receptor 1046 protein_id : NP_666793.1

name	Olfr1047 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128913 CCDS:CCDS16246.1 GeneID:259014 MGI:3030881
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47703682-47702723; olfactory receptor MOR188-3 product : olfactory receptor 1047 protein_id : NP_667223.1

name	Olfr1048 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128909 CCDS:CCDS16247.1 GeneID:259016 MGI:3030882
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47716657-47715716; olfactory receptor MOR187-2 product : olfactory receptor 1048 protein_id : NP_667225.1

name	Olfr1049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056731 CCDS:CCDS16248.1 GeneID:259018 MGI:3030883
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47735396-47734470; olfactory receptor MOR187-1 product : olfactory receptor 1049 protein_id : NP_667227.2

name	Olfr1051 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430576 CCDS:CCDS16249.1 GeneID:404324 MGI:3030885
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47756192-47755266 product : olfactory receptor 1051 protein_id : NP_997445.1

name	Olfr1052 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128917 CCDS:CCDS16250.1 GeneID:259012 MGI:3030886
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47777498-47778436; olfactory receptor MOR172-1 product : olfactory receptor 1052 protein_id : NP_667221.1

name	Olfr1054 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128901 CCDS:CCDS16251.1 GeneID:259021 MGI:3030888
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47811880-47810942; olfactory receptor MOR188-2 product : olfactory receptor 1054 protein_id : NP_667230.1

name	Olfr1055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128897 GeneID:259023 MGI:3030889
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-47819205-47818258; olfactory receptor MOR186-1 product : olfactory receptor 1055 protein_id : NP_667232.1

name	Olfr1056 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27544965 CCDS:CCDS16252.1 GeneID:259020 MGI:3030890
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47827833-47826892; olfactory receptor MOR186-2 product : olfactory receptor 1056 protein_id : NP_667229.1

name	Olfr1057 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430586 CCDS:CCDS16253.1 GeneID:404325 MGI:3030891
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47844843-47843896 product : olfactory receptor 1057 protein_id : NP_997446.1

name	Olfr1058 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671317 CCDS:CCDS16254.1 GeneID:258386 MGI:3030892
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47855818-47854868; olfactory receptor MOR190-2 product : olfactory receptor 1058 protein_id : NP_666503.2

name	Olfr1515 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128903 GeneID:259022 MGI:3031349
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : olfactory receptor MOR188-1 product : olfactory receptor 1515 protein_id : NP_667231.1

name	Olfr1062 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301221 GeneID:259082 MGI:3030896
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-47892992-47892045; olfactory receptor MOR185-1 product : olfactory receptor 1062 protein_id : NP_667289.2

name	Olfr1065 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575926 CCDS:CCDS16256.1 GeneID:258403 MGI:3030899
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47915274-47914333; olfactory receptor MOR190-1; odorant receptor B1 product : olfactory receptor 1065 protein_id : NP_666520.1

name	Olfr1066 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801264 CCDS:CCDS16257.1 GeneID:257880 MGI:3030900
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47925557-47924616; olfactory receptor MOR256-52P product : olfactory receptor 1066 protein_id : NP_001011735.1

name	Olfr228 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174772 CCDS:CCDS16258.1 GeneID:258400 MGI:3030062
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T0101M-139-669 product : olfactory receptor 228 protein_id : NP_666517.2

name	Olfr1076 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239152 CCDS:CCDS16259.1 GeneID:258401 MGI:3030910
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-47993761-47994702; olfactory receptor MOR189-2 product : olfactory receptor 1076 protein_id : NP_666518.1

name	LOC625853 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249880 GeneID:625853
definition	codon_start : 1 product : similar to olfactory receptor MOR189-2 protein_id : XP_001476796.1

name	Olfr1079 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239158 CCDS:CCDS16260.1 GeneID:258402 MGI:3030913
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48024195-48023254; olfactory receptor MOR189-1 product : olfactory receptor 1079 protein_id : NP_666519.1

name	Olfr1080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665725 CCDS:CCDS16261.1 GeneID:258404 MGI:3030914
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48039418-48038477; olfactory receptor MOR192-1 product : olfactory receptor 1080 protein_id : NP_666521.2

name	Olfr1082 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112983511 GeneID:404473 MGI:3030916
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48079993-48079157; olfactory receptor 1082, pseudogene 1 product : olfactory receptor 1082 protein_id : NP_997557.2

name	Olfr1083 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056733 GeneID:404326 MGI:3030917
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2Q125-48092599-48091658 product : olfactory receptor 1083 protein_id : NP_997447.2

name	Olfr1084 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953202 GeneID:258235 MGI:3030918
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48121788-48120847; olfactory receptor MOR192-2 product : olfactory receptor 1084 protein_id : NP_997018.2

name	Olfr1085 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129471 CCDS:CCDS16263.1 GeneID:258583 MGI:3030919
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48147264-48146323; olfactory receptor MOR191-1 product : olfactory receptor 1085 protein_id : NP_666801.1

name	Olfr1086 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129467 CCDS:CCDS16264.1 GeneID:258585 MGI:3030920
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48168771-48167839; olfactory receptor MOR179-2 product : olfactory receptor 1086 protein_id : NP_666803.1

name	Olfr1087 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129175 CCDS:CCDS16265.1 GeneID:258843 MGI:3030921
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48182406-48181465; olfactory receptor MOR188-5 product : olfactory receptor 1087 protein_id : NP_667057.1

name	Olfr1089 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801320 CCDS:CCDS16266.1 GeneID:257933 MGI:3030923
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48226321-48225386; olfactory receptor MOR193-1 product : olfactory receptor 1089 protein_id : NP_001011771.1

name	Olfr1090 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129169 CCDS:CCDS16267.1 GeneID:258844 MGI:3030924
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48247345-48246404; olfactory receptor MOR188-4 product : olfactory receptor 1090 protein_id : NP_667058.1

name	Olfr1093 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129567 CCDS:CCDS16268.1 GeneID:258363 MGI:3030927
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48278396-48279364; olfactory receptor MOR179-6 product : olfactory receptor 1093 protein_id : NP_666478.1

name	Olfr141 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444916 GeneID:257913 MGI:2177524
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48299679-48298702 product : olfactory receptor 141 protein_id : NP_861539.2

name	Olfr1094 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129573 CCDS:CCDS16269.1 GeneID:258362 MGI:3030928
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48321457-48322449; olfactory receptor MOR179-7 product : olfactory receptor 1094 protein_id : NP_666477.1

name	Olfr1095 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056735 CCDS:CCDS16270.1 GeneID:258725 MGI:3030929
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48336843-48335917; olfactory receptor MOR179-1 product : olfactory receptor 1095 protein_id : NP_666941.2

name	Olfr1097 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129177 CCDS:CCDS16271.1 GeneID:258840 MGI:3030931
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48376288-48375341; olfactory receptor MOR206-2 product : olfactory receptor 1097 protein_id : NP_667054.1

name	Olfr1098 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174766 GeneID:258842 MGI:3030932
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48410458-48409511; olfactory receptor MOR206-1 product : olfactory receptor 1098 protein_id : NP_667056.2

name	Olfr1099 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129311 CCDS:CCDS16272.1 GeneID:258764 MGI:3030933
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48446067-48445129; olfactory receptor MOR206-3 product : olfactory receptor 1099 protein_id : NP_666979.1

name	Olfr1100 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129463 CCDS:CCDS16273.1 GeneID:258587 MGI:3030934
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48465387-48464422; olfactory receptor MOR206-4 product : olfactory receptor 1100 protein_id : NP_666805.1

name	Olfr1101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195674 CCDS:CCDS16274.1 GeneID:258584 MGI:3030935
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48475870-48474938; olfactory receptor MOR179-3 product : olfactory receptor 1101 protein_id : NP_666802.2

name	Olfr1102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47131205 CCDS:CCDS16275.1 GeneID:228228 MGI:3030936
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48487992-48488966 product : olfactory receptor 1102 protein_id : NP_997037.1

name	Olfr1104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583685 CCDS:CCDS16276.1 GeneID:258763 MGI:3030938
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48508763-48507833; olfactory receptor MOR207-1 product : olfactory receptor 1104 protein_id : NP_666978.2

name	Olfr1105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801414 CCDS:CCDS16277.1 GeneID:258085 MGI:3030939
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48521031-48520093; olfactory receptor MOR0-6P product : olfactory receptor 1105 protein_id : NP_001011825.1

name	Olfr1106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129345 CCDS:CCDS16278.1 GeneID:258747 MGI:3030940
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48541463-48540525; olfactory receptor MOR172-6 product : olfactory receptor 1106 protein_id : NP_666963.1

name	Olfr1107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129179 CCDS:CCDS16279.1 GeneID:258841 MGI:3030941
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48565383-48564445; olfactory receptor MOR172-2 product : olfactory receptor 1107 protein_id : NP_667055.1

name	Olfr1109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110671319 CCDS:CCDS16280.1 GeneID:258762 MGI:3030943
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48586461-48585523; olfactory receptor MOR172-5 product : olfactory receptor 1109 protein_id : NP_666977.2

name	Olfr259 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735418 CCDS:CCDS16281.1 GeneID:258766 MGI:3030093
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2N869-1820-882; olfactory receptor MOR172-3 product : olfactory receptor 259 protein_id : NP_666981.2

name	Olfr1110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129313 CCDS:CCDS16282.1 GeneID:258765 MGI:3030944
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48621299-48620361; olfactory receptor MOR172-4 product : olfactory receptor 1110 protein_id : NP_666980.1

name	Olfr1111 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129461 CCDS:CCDS16283.1 GeneID:258586 MGI:3030945
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48635468-48634530; olfactory receptor MOR181-2 product : olfactory receptor 1111 protein_id : NP_666804.1

name	Olfr1112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238904 CCDS:CCDS16284.1 GeneID:258655 MGI:3030946
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48676316-48677272; olfactory receptor MOR264-6 product : olfactory receptor 1112 protein_id : NP_666872.1

name	Olfr1113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430590 CCDS:CCDS16285.1 GeneID:404327 MGI:3030947
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48697747-48698727 product : olfactory receptor 1113 protein_id : NP_997448.1

name	Olfr1115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129695 CCDS:CCDS16286.1 GeneID:258294 MGI:3030949
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48736906-48737886; olfactory receptor MOR264-20 product : olfactory receptor 1115 protein_id : NP_666409.1

name	Olfr1118 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518534 GeneID:404328 MGI:3030952
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48795705-48796673; GA_x5J8B7TRNDT-725-75 product : olfactory receptor 1118 protein_id : NP_997515.1

name	Olfr1120 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128891 CCDS:CCDS16287.1 GeneID:259031 MGI:3030954
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48849180-48850100; olfactory receptor MOR264-2 product : olfactory receptor 1120 protein_id : NP_667240.1

name	Olfr1121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129606 CCDS:CCDS16288.1 GeneID:258345 MGI:3030955
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2Q125-48863863-48864807; olfactory receptor MOR264-18 product : olfactory receptor 1121 protein_id : NP_666460.1

name	Olfr1122 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128887 CCDS:CCDS16289.1 GeneID:259033 MGI:3030956
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48880078-48881058; olfactory receptor MOR264-1 product : olfactory receptor 1122 protein_id : NP_667242.1

name	Olfr1123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583711 CCDS:CCDS16290.1 GeneID:258347 MGI:3030957
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48917235-48918206; olfactory receptor MOR264-17 product : olfactory receptor 1123 protein_id : NP_666462.2

name	Olfr1125 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529458 CCDS:CCDS16291.1 GeneID:259030 MGI:3030959
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48936945-48937901; olfactory receptor MOR264-3 product : olfactory receptor 1125 protein_id : NP_667239.2

name	Olfr1126 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583683 CCDS:CCDS16292.1 GeneID:258834 MGI:3030960
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q125-48959068-48960012; olfactory receptor MOR264-5 product : olfactory receptor 1126 protein_id : NP_667048.2

name	Pramel7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142697 CCDS:CCDS16293.1 GeneID:347712 MGI:2156391
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 7 protein_id : NP_839981.1

name	Pramel6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142695 CCDS:CCDS16294.1 GeneID:347711 MGI:2156390
definition	codon_start : 1 product : preferentially expressed antigen in melanoma like 6 protein_id : NP_839980.1

name	LOC100041372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041372
definition	number : 3 pseudo : _no_value

name	LOC100041372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041372
definition	number : 2 pseudo : _no_value

name	LOC100041372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041372
definition	number : 1 pseudo : _no_value

name	LOC668402 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668402
definition	number : 1 pseudo : _no_value

name	LOC228238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:228238
definition	number : 1 pseudo : _no_value

name	LOC546767 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546767
definition	number : 1 pseudo : _no_value

name	LOC100041923 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041923
definition	number : 1 pseudo : _no_value

name	LOC100041923 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041923
definition	number : 2 pseudo : _no_value

name	LOC668424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668424
definition	number : 1 pseudo : _no_value

name	LOC668424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668424
definition	number : 2 pseudo : _no_value

name	LOC668432 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249881 GeneID:668432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 243 ESTs, 9 Proteins product : similar to Ss18 protein pseudo : _no_value transcript_id : XR_033170.1

clone name	MSMg01-327E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405D20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433H10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145P09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-530A18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-537H04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-336F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364I01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-337D13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-386P09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-527A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-268N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-407O08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-502M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-114O09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-189E02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454D06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-396J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-199B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326C21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455M01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477F15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318H06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367J08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-455D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421A04
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-167D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114F01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-293E02.b	B6Ng01-293E02.g
ACC	GA089682	GA089683
length	1,145	1,174
definition	B6Ng01-293E02.b	B6Ng01-293E02.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctcttccattgataaacctgcctggctctttatcaatatcataca attttttgtcactattgctctatagtacagtttgaagtcagggatgttga ttccccagaaattcttttattgttgaaaataatttttgctatcctgggtt ttttgttattccaaatgaatttgagaattgctttctctaactctacaaag aattgatttggaatttcatttgagactatactgaatctgtagattttttt ttccggcaagatggcaaatttactacattaatcctgccaatctatggagc atgggagatttttccatcttctaaggtcttcttcaatttctttcttcaga gttttaaattgatgtcgtacagatcttttacttctttggttagagacaaa tcaagatattttatgttgtttgtgactattttgaatgtcatcctttccct aatttcttcctcagcccttttatcctctgcatgtaagaagatgacaggct tgttttagttaatattttatccagccactttgctgaagttgtttatcagc ttaggagttctctggtggaatttttgtggtcatttaagtatactatcata ttatctgcaaatagtcatattttgacttctaccttttcattttgtatcaa tttgacttccttttgttgtctaattggtctagctagaacttcaagtacta tattgagtagatagggagagagagggcagtcttgtctagtccccgatttt agtgggaatgcttcaagtttctctccaattattttgatgcagttactggt tttctatatattgcttttactatgtttgggtatgggccttgaattcctga tcattctaagacttttaacatgaaaggatgttgaattttgtcaaatgaat tttaagcatctactaaattgatcatgtggttttttttctttgaggttatg tagtgaattatgttgatgtattccatatatagaatatatattccagatat atccctgcatccctggtgtgaagcctacttgatcatggtgatgaacattt gatgtgtatgcctccgtacctcattattatagatgcttcattcataacca attaggttaatgaccatgttttaatataacatggtataccttata	gaattcttttcttcttaaaagattgttgctcgctcttttgcaatattttg tgattgagccttagatgcaagatttgttttggaggtttaaggtctagaac tagggtccaaaatcctgccattagattgattgtaggtttctgtaatgctc accgttgattgcaaataatatttttatgagatgtgtggattacaaatatc tgtgggtataaagccacatatgtagaaggatcgaagtatctacactttag tcttcctgcttctttagtttcatgtgttttgcaaattgtatcttgggtat tctgagcttctgggctagtatccacttatcagtgagtgcatatcatgtgt gttcttttgtaattgggtaaccttacttaggatgatatccaaccattagt ctaagaatttcaaattcattgtttttagtagctgtgtagtactccattgt ataaatgtacctcattttctgtatccatttctctgttgaaggacatctag gttctttcaggcttctagctataataaataatgctgctatgaacacagtg gagcatgtgtccttattacatattggagaatcttctgggtatatgcacag gagtggtattgctggaacttcccatattactatgtccaattatctaagga accgtcaaactgattttcagagtggttgtaccagcttgcaatacaaccag caatggaggagtgttcctctttctccacatcctcaccagcatctgatgtc atgtgaatttttgatctttgccattctgactggcatgaggtagaatctca ggactgttttaatttgcatttccctgatgacttagggctttgaacatttt ttaggtgtttctcagtcatttggtatttcctcagttgagaattcctttgt ttagttctgtgcccgcattatttaataaggttattttgttttctgggagt ccaacttatttgagttctttgtaatataattgaataaatagcccttctat ctgattttaggactggataaagatattttccaatctgtggtagccctttt tttatctttattgaacgtgttcccttgcttacagaggctttgcattttta gttgtcccaatgtttatattggatcttacagcacaggccattatggtttc gtgtctaggaatttttctcacccg
quality values	Open. Hide. 62 47 23 38 62 62 54 62 62 62 62 26 15 62 62 62 44 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 43 43 50 54 35 46 49 59 62 59 59 54 62 62 59 62 62 62 62 62 62 54 62 59 62 59 62 59 59 59 62 62 62 62 62 62 54 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 49 59 54 54 54 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 58 58 58 58 58 52 58 58 58 58 58 58 54 58 58 54 54 58 58 54 54 47 58 58 54 58 58 58 58 58 58 40 38 52 58 39 58 54 41 58 58 58 58 58 54 58 58 52 58 54 58 58 54 54 58 58 58 58 52 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 51 58 58 51 58 58 58 51 54 58 53 53 58 58 58 58 58 48 54 58 58 51 50 49 58 58 58 58 58 46 40 49 58 58 58 58 51 52 51 52 50 51 58 58 58 58 47 53 58 58 54 58 51 58 58 49 58 39 58 58 52 58 47 50 51 53 51 58 41 32 54 49 51 50 58 58 51 50 58 49 50 58 58 53 53 46 47 52 53 53 49 43 52 53 53 58 58 58 51 58 58 58 53 54 40 50 41 41 54 46 58 54 58 53 54 44 33 33 40 53 53 43 54 53 49 54 37 51 47 50 52 37 39 54 54 54 40 50 37 54 54 37 52 37 52 44 50 47 52 41 29 46 33 53 43 41 31 39 42 52 54 40 41 39 51 37 38 45 23 45 45 47 42 29 54 54 37 37 39 34 43 35 6 7 8 39 35 34 31 53 52 32 49 49 52 42 31 32 35 45 40 32 35 27 40 31 47 51 49 31 31 34 31 32 31 47 27 31 32 40 33 40 32 32 31 42 51 28 21 51 30 31 32 32 34 31 45 34 45 31 30 30 26 33 28 31 51 43 32 36 42 26 42 28 45 51 51 30 19 33 31 28 32 31 31 47 43 31 42 34 22 42 30 32 25 42 36 29 46 46 26 36 25 38 37 48 31 31 31 35 38 31 46 46 28 26 27 17 38 32 31 31 31 27 31 32 37 46 27 19 22 31 32 31 31 30 34 41 32 32 34 28 48 46 47 48 46 46 31 38 32 48 31 20 27 25 16 16 14 20 33 31 21 27 27 32 33 13 28 33 32 24 17 36 22 24 20 25 21 38 24 20 25 19 16 32 15 21 22 26 24 32 31 32 34 19 15 13 13 23 14 18 11 19 7 18 23 21 31 18 14 20 9 31 32 48 17 14 32 32 24 31 31 48 19 11 29 28 5 20 19 27 14 28 16 21 15 6 10 19 14 15 23 18 16 23 11 13 18 17 16 11 31 4 8 20 8 16 7 15 40 15 13 26 9 11 15 8 5 3 8 26 24 28 14 7 18 9 5 10 11 10 6 10 5 3 5 16 7 8 6 4 5 3 3 8 11 7 3 3 3 5 14 8 8 11 6 7 14 14 12 7 3 6 6 18 5 12 9 6 3 4 4 8 10 5 7 15 9 18 6 17 28 10 13 6 4 7 5 3 6 10 5 5 14 9 4 4 4 6 5 7 14 5 6 3 1	Open. Hide. 62 47 42 41 62 62 62 62 62 56 56 46 32 32 56 37 38 46 46 62 56 47 31 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 49 56 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 62 62 47 62 62 62 62 62 56 62 62 62 62 62 62 62 62 56 41 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 58 58 46 58 54 42 58 58 58 54 54 58 54 54 58 47 54 52 54 54 54 54 54 58 58 44 58 52 58 58 52 54 52 58 52 58 58 58 58 58 54 54 52 54 54 54 52 54 52 41 58 54 37 58 58 58 52 39 39 58 54 41 46 44 52 52 52 49 54 54 39 54 48 40 54 52 51 49 46 54 54 49 54 58 58 51 34 27 58 51 32 41 51 54 45 51 47 37 58 48 28 23 58 51 50 53 32 58 58 41 47 58 45 30 58 58 53 52 45 52 58 50 52 58 49 46 52 58 29 32 51 52 39 39 53 49 58 58 46 40 38 29 47 50 40 40 51 50 50 46 37 49 54 50 58 50 33 17 58 41 31 39 58 41 32 41 46 39 45 53 58 32 39 29 21 51 40 52 37 51 50 54 40 50 38 39 52 39 32 51 49 45 39 35 54 49 27 49 39 53 45 35 53 49 49 54 18 17 54 54 54 53 39 33 29 32 29 54 31 37 31 39 40 53 53 53 39 52 40 40 31 35 51 32 38 34 40 47 18 46 32 42 32 51 32 30 41 34 37 25 13 38 18 23 32 44 27 49 49 34 28 34 31 49 22 32 24 24 35 53 53 45 53 15 18 40 31 21 31 45 30 26 21 31 11 46 46 30 51 46 8 12 38 32 32 9 10 41 40 45 42 23 30 30 46 24 45 25 46 32 51 24 25 24 10 37 35 31 29 36 33 30 46 25 26 7 46 8 9 22 26 31 19 23 21 29 30 30 9 46 46 25 16 9 18 8 42 25 38 22 33 21 20 19 21 32 37 33 36 15 31 15 37 13 18 33 26 22 31 31 32 41 29 39 16 11 25 23 26 29 16 10 31 22 44 33 26 9 17 38 44 25 21 24 18 44 12 28 16 29 21 27 21 28 24 19 34 22 11 38 11 10 17 11 10 28 30 16 36 32 16 7 5 10 23 13 9 7 14 28 20 32 23 25 11 9 33 14 6 4 7 33 39 34 10 21 17 16 19 22 30 22 17 22 8 37 37 17 20 15 7 37 10 11 11 9 9 6 19 40 15 12 25 5 5 13 11 30 17 30 22 5 21 21 16 28 18 5 3 3 5 11 6 7 29 9 21 32 21 11 28 31 15 14 8 8 15 28 11 20 6 20 14 8 12 6 2 1 3 5 4 6 12 17 14 19 8 4 2 8 15 5 2 5 12 4 7 14 25 30 13 7 10 6 4 8 30 16 6 5 4 9 7 2 1 3 23 6 4 13 9 5 4 4 5 6 3 4 16 17 5 6 14 6 5 11 8 4 11 4 4 5 5 15 10 4 4 22 18 5 7 6 6 3 4 18 19 14 7 6 6 4 7 2 1 2 3 4 4 3 6 9 8 17 24 15 4 5 3 2 3 3 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_86354716_86355244
seq2: B6Ng01-293E02.b_675_1189

seq1  ACCTTTTCATTTTGTATCAATTTGACTTCCTTTTGTTGTCTAATTGGTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTTTCATTTTGTATCAATTTGACTTCCTTTTGTTGTCTAATTGGTCT  50

seq1  AGCTAGAACTTCAAGTACTATATTGAGTAGATAGGGAGAGAGAGGGCAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAGAACTTCAAGTACTATATTGAGTAGATAGGGAGAGAGAGGGCAGT  100

seq1  CTTGTCTAGTCCCCGATTTTAGTGGGAATGCTTCAAGTTTCTCTCCAATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTCTAGTCCCCGATTTTAGTGGGAATGCTTCAAGTTTCTCTCCAATT  150

seq1  ATTTTGATGCAGGTTACTGGTTTTCTATATATTGCTTTTACTATGTTTGG  200
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  ATTTTGATGCA-GTTACTGGTTTTCTATATATTGCTTTTACTATGTTTGG  199

seq1  GTATGGGCCTTGAATTCCTGATCATTCTAAGACTTTTAACATGAAAGGAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGGGCCTTGAATTCCTGATCATTCTAAGACTTTTAACATGAAAGGAT  249

seq1  GTTGAATTTTGTCAAATGAATTTTAAGCATCTACTAAATTGATCATGTGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGAATTTTGTCAAATGAATTTTAAGCATCTACTAAATTGATCATGTGG  299

seq1  TTTTTTTTCTTTGAGGTTATGTAGTGAATTATGTTGATGTATTTCCATAT  350
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  TTTTTTTTCTTTGAGGTTATGTAGTGAATTATGTTGATGTA-TTCCATAT  348

seq1  ATAGAATATATATTCCAGATATATCCCTGCATCCCTGGTGTGAAGCCTAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGAATATATATTCCAGATATATCCCTGCATCCCTGGTGTGAAGCCTAC  398

seq1  TTGATCATGGTGAATGAACATTTTGATGTGTTATGCCTCCGTACTCCAAT  450
      |||||||||||| ||||||| ||||||||| |||||||||||||  ||  
seq2  TTGATCATGGTG-ATGAACA-TTTGATGTG-TATGCCTCCGTACCTCA--  443

seq1  TAATTATAAGGATTGCTTTTCATTCAATAACCAAAATTAAGTATAATGAA  500
      | ||||||  || |||  ||||||| ||||||  ||||| || |||||| 
seq2  TTATTATA--GA-TGC--TTCATTC-ATAACC--AATTAGGT-TAATGAC  484

seq1  CATGTTTTAATATAACAT-GTATA-CTTATA  529
      |||||||||||||||||| ||||| ||||||
seq2  CATGTTTTAATATAACATGGTATACCTTATA  515

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information