MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-296I14
Chromosome	2 (Build37)
Map Location	121,526,625 - 121,682,052
singlet/doublet	doublet
Overlap gene	Frmd5
Upstream gene	Stard9, Cdan1, Ttbk2, Ubr1, Tmem62, Rnu3b-ps2, Ccndbp1, Epb4.2, Tgm5, LOC640543, Lcmt2, Adal, Zscan29, D2Ertd435e, Trp53bp1, Mtap1a, Hisppd2a, Ckmt1, Strc, Catsper2, Pdia3, Ell3, Serf2, LOC574418, 2310003F16Rik, Mfap1b, Wdr76p, Mfap1a, Wdr76
Downstream gene	Casc4, Mageb3, Ctdspl2, Eif3s1, 4930424G05Rik, B2m, Trim69, 4933406J08Rik, LOC433468, LOC670832, Sord, Duox2, Duoxa2, Duoxa1, Duox1, Shf, Slc28a2, Bambi-ps1, Rp23-357i14.1, Gatm, Spata5l1, AA467197, Slc30a4, Pldn, Sqrdl
Link	Open Mouse BAC browser

Click to get alignment info.

name	Stard9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668880 MGI:3045258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 46 ESTs, 4 Proteins

name	Cdan1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68968 MGI:1916218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttbk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ubr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22222 MGI:1277977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:96957 MGI:2139461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu3b-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19853 MGI:97980
definition	note : U3B small nuclear RNA pseudogene 2 pseudo : _no_value

name	Ccndbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17151 MGI:109595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epb4.2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13828 MGI:95402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74176 MGI:1921426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC640543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	Lcmt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329504 MGI:1353659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 41 ESTs, 5 Proteins

name	Adal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75894 MGI:1923144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99334 MGI:2139317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 10 Proteins

name	D2Ertd435e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51885 MGI:1196293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp53bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27223 MGI:1351320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17754 MGI:1306776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hisppd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327655 MGI:2443281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ckmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12716 MGI:99441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Strc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140476 MGI:2153816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Catsper2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212670 MGI:2387404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdia3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14827 MGI:95834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ell3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269344 MGI:2673679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378702 MGI:1337041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC574418 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:574418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310003F16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67693 MGI:1914943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfap1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100034361 MGI:3694697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr76p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100008564
definition	note : WD repeat domain 76 pseudogene pseudo : _no_value

name	Mfap1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67532 MGI:1914782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr76 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241627 MGI:1926186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frmd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228564 MGI:2442557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319996 MGI:2443129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mageb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17147 MGI:105109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctdspl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329506 MGI:1196405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78655 MGI:1925905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930424G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67578 MGI:1914828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B2m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12010 MGI:88127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim69 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70928 MGI:1918178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933406J08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74401 MGI:1921651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	LOC433468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433468
definition	note : similar to developmental pluripotency associated 4 pseudo : _no_value

name	LOC670832 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1046 ESTs, 7 Proteins

name	Sord (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20322 MGI:98266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Duox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214593 MGI:3036280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Duoxa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66811 MGI:1914061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Duoxa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213696 MGI:2384861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Duox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99439 MGI:2139422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 7 Proteins

name	Shf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435684 MGI:3613669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc28a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269346 MGI:1913105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bambi-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81913 MGI:1932402
definition	note : BMP and activin membrane-bound inhibitor, pseudogene (Xenopus laevis) pseudo : _no_value

name	Rp23-357i14.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381417
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs, 7 Proteins

name	Gatm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67092 MGI:1914342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spata5l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214616 MGI:3036261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins

name	AA467197 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433470 MGI:3034182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc30a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22785 MGI:1345282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pldn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18457 MGI:1927580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sqrdl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59010 MGI:1929899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stard9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249974 GeneID:668880 MGI:3045258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 46 ESTs, 4 Proteins product : START domain containing 9 transcript_id : XM_001004201.2

name	Cdan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430552 GeneID:68968 MGI:1916218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : congenital dyserythropoietic anemia, type I (human) transcript_id : NM_026891.2

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326518 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_080788.3

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326517 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_001024857.2

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326516 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_001024856.2

name	Ubr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678490 GeneID:22222 MGI:1277977
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin protein ligase E3 component n-recognin 1 transcript_id : NM_009461.1

name	Tmem62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271525 GeneID:96957 MGI:2139461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 62 transcript_id : NM_175285.3

name	Ccndbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955252 GeneID:17151 MGI:109595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D-type binding-protein 1 transcript_id : NM_010761.2

name	Epb4.2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129920 GeneID:13828 MGI:95402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.2 transcript_id : NM_013513.2

name	Tgm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368844 GeneID:74176 MGI:1921426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 5 transcript_id : NM_028799.2

name	LOC640543 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249976 GeneID:640543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : similar to transglutaminase 7 transcript_id : XM_001479973.1

name	Lcmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367205 GeneID:329504 MGI:1353659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 41 ESTs, 5 Proteins product : leucine carboxyl methyltransferase 2 transcript_id : XM_141327.6

name	Adal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626055 GeneID:75894 MGI:1923144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase-like transcript_id : NM_029475.1

name	Zscan29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250076 GeneID:99334 MGI:2139317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 10 Proteins product : zinc finger SCAN domains 29 transcript_id : XM_001480554.1

name	D2Ertd435e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130151 GeneID:51885 MGI:1196293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, ERATO Doi 435, expressed transcript_id : NM_153387.2

name	Trp53bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34852026 GeneID:27223 MGI:1351320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 binding protein 1 transcript_id : NM_013735.2

name	Mtap1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244032 GeneID:17754 MGI:1306776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 1 A transcript_id : NM_032393.1

name	Hisppd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328430 GeneID:327655 MGI:2443281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidine acid phosphatase domain containing 2A transcript_id : NM_178795.3

name	Ckmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129846 GeneID:12716 MGI:99441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : creatine kinase, mitochondrial 1, ubiquitous transcript_id : NM_009897.2

name	Strc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300984 GeneID:140476 MGI:2153816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stereocilin transcript_id : NM_080459.2

name	Catsper2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001553 GeneID:212670 MGI:2387404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cation channel, sperm associated 2 transcript_id : NM_153075.2

name	Pdia3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293263 GeneID:14827 MGI:95834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein disulfide isomerase associated 3 transcript_id : NM_007952.2

name	Ell3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:35901197 GeneID:269344 MGI:2673679
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation factor RNA polymerase II-like 3 transcript_id : NM_145973.2

name	Serf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875510 GeneID:378702 MGI:1337041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small EDRK-rich factor 2 transcript_id : NM_011354.2

name	LOC574418 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:70778957 GeneID:574418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC574418 transcript_id : NM_001025371.1

name	2310003F16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388228 GeneID:67693 MGI:1914943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310003F16 gene transcript_id : NM_026318.2

name	Mfap1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802334 GeneID:100034361 MGI:3694697
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar-associated protein 1B transcript_id : NM_001081975.2

name	Mfap1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802646 GeneID:67532 MGI:1914782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar-associated protein 1A transcript_id : NM_026220.4

name	Wdr76 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487320 GeneID:241627 MGI:1926186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 76 transcript_id : NM_030234.2

name	Frmd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115298679 GeneID:228564 MGI:2442557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM domain containing 5 transcript_id : NM_172673.3

name	Casc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386893 GeneID:319996 MGI:2443129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cancer susceptibility candidate 4 transcript_id : NM_177054.4

name	Casc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803515 GeneID:319996 MGI:2443129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cancer susceptibility candidate 4 transcript_id : NM_199038.2

name	Mageb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543227 GeneID:17147 MGI:105109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family B, 3 transcript_id : NM_008545.2

name	Ctdspl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803336 GeneID:329506 MGI:1196405
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 transcript_id : NM_212450.2

name	Eif3s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244039 GeneID:78655 MGI:1925905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 1 alpha transcript_id : NM_144545.2

name	4930424G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158686 GeneID:67578 MGI:1914828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930424G05 gene transcript_id : NM_026251.2

name	B2m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227219 GeneID:12010 MGI:88127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-2 microglobulin transcript_id : NM_009735.3

name	Trim69 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17985998 GeneID:70928 MGI:1918178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 69 transcript_id : NM_080510.1

name	4933406J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367219 GeneID:74401 MGI:1921651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : RIKEN cDNA 4933406J08 gene transcript_id : XM_130426.4

name	LOC670832 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250090 GeneID:670832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1046 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12 transcript_id : XM_001480637.1

name	Sord (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347537 GeneID:20322 MGI:98266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorbitol dehydrogenase transcript_id : NM_146126.2

name	Duox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628639 GeneID:214593 MGI:3036280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual oxidase 2 transcript_id : NM_177610.2

name	Duoxa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368810 GeneID:66811 MGI:1914061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual oxidase maturation factor 2 transcript_id : NM_025777.2

name	Duoxa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430554 GeneID:213696 MGI:2384861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual oxidase maturation factor 1 transcript_id : NM_145395.2

name	Duox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250092 GeneID:99439 MGI:2139422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 7 Proteins product : dual oxidase 1 transcript_id : XM_130483.7

name	Shf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185923 GeneID:435684 MGI:3613669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Src homology 2 domain containing F transcript_id : NM_001013829.2

name	Slc28a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365483 GeneID:269346 MGI:1913105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 transcript_id : NM_172980.2

name	Rp23-357i14.1 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367193 GeneID:381417
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs, 4 Proteins product : novel protein similar to solute carrier family 28 (sodium-coupled nucleoside transporter) member 2 (Slc28a2), transcript variant 1 transcript_id : XM_355381.5

name	Rp23-357i14.1 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250094 GeneID:381417
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 36 ESTs, 6 Proteins product : novel protein similar to solute carrier family 28 (sodium-coupled nucleoside transporter) member 2 (Slc28a2) transcript_id : XM_001480663.1

name	Gatm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354911 GeneID:67092 MGI:1914342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine amidinotransferase (L-arginine:glycine amidinotransferase) transcript_id : NM_025961.3

name	Spata5l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249980 GeneID:214616 MGI:3036261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : spermatogenesis associated 5-like 1 transcript_id : XM_001479997.1

name	AA467197 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921340 GeneID:433470 MGI:3034182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA467197 transcript_id : NM_001004174.1

name	Slc30a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52630420 GeneID:22785 MGI:1345282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 30 (zinc transporter), member 4 transcript_id : NM_011774.2

name	Pldn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110578650 GeneID:18457 MGI:1927580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pallidin transcript_id : NM_019788.3

name	Sqrdl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981548 GeneID:59010 MGI:1929899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfide quinone reductase-like (yeast) transcript_id : NM_021507.4

name	Stard9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249975 GeneID:668880 MGI:3045258
definition	codon_start : 1 product : START domain containing 9 protein_id : XP_001004201.2

name	Cdan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430553 GeneID:68968 MGI:1916218
definition	GO_process : GO:0006998 - nuclear membrane organization and biogenesis [Evidence TAS] codon_start : 1 product : congenital dyserythropoietic anemia, type I protein_id : NP_081167.2

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906805 CCDS:CCDS16626.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : tau tubulin kinase 2 isoform 1 protein_id : NP_542966.2

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906807 CCDS:CCDS16627.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tau tubulin kinase 2 isoform 2 protein_id : NP_001020027.1

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906809 CCDS:CCDS16627.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3 product : tau tubulin kinase 2 isoform 2 protein_id : NP_001020028.1

name	Ubr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678491 CCDS:CCDS16628.1 GeneID:22222 MGI:1277977
definition	GO_component : GO:0000502 - proteasome complex (sensu Eukaryota) [Evidence IGI]; GO:0000151 - ubiquitin ligase complex [Evidence IGI] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IGI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IGI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IGI]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IMP] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : E3 alpha; ubiquitin-protein ligase e3 componen n-recognin product : ubiquitin protein ligase E3 component n-recognin 1 protein_id : NP_033487.1

name	Tmem62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424948 CCDS:CCDS16629.1 GeneID:96957 MGI:2139461
definition	codon_start : 1 product : transmembrane protein 62 protein_id : NP_780494.1

name	Ccndbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955253 GeneID:17151 MGI:109595
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence TAS] codon_start : 1 note : maternal inhibition of differentiation; stage specific embryonic cDNA-8 product : cyclin D-type binding-protein 1 protein_id : NP_034891.2

name	Epb4.2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305035 CCDS:CCDS16631.1 GeneID:13828 MGI:95402
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0043249 - erythrocyte maturation [Evidence IEA]; GO:0018149 - peptide cross-linking [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 product : erythrocyte protein band 4.2 protein_id : NP_038541.1

name	Tgm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229194 CCDS:CCDS16632.1 GeneID:74176 MGI:1921426
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0018149 - peptide cross-linking [Evidence IEA] codon_start : 1 product : transglutaminase 5 protein_id : NP_083075.1

name	LOC640543 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249977 GeneID:640543
definition	codon_start : 1 product : similar to transglutaminase 7 protein_id : XP_001480023.1

name	Lcmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886834 GeneID:329504 MGI:1353659
definition	codon_start : 1 product : leucine carboxyl methyltransferase 2 protein_id : XP_141327.5

name	Adal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626056 CCDS:CCDS16633.1 GeneID:75894 MGI:1923144
definition	GO_function : GO:0019239 - deaminase activity [Evidence IEA] GO_process : GO:0009168 - purine ribonucleoside monophosphate biosynthesis [Evidence IEA] codon_start : 1 product : adenosine deaminase-like protein_id : NP_083751.1

name	Zscan29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250077 GeneID:99334 MGI:2139317
definition	codon_start : 1 product : zinc finger protein 690 protein_id : XP_001480604.1

name	D2Ertd435e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943924 CCDS:CCDS16637.1 GeneID:51885 MGI:1196293
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence IEA]; GO:0000922 - spindle pole [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : gamma tubulin ring complex protein protein_id : NP_700436.1

name	Trp53bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34852027 GeneID:27223 MGI:1351320
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0006281 - DNA repair [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : murine p53-binding protein; transformation related protein 53 binding-protein 1 product : transformation related protein 53 binding protein 1 protein_id : NP_038763.2

name	Mtap1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244033 GeneID:17754 MGI:1306776
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007605 - sensory perception of sound [Evidence IDA] codon_start : 1 note : modifier of tubby hearing 1 product : microtubule-associated protein 1 A protein_id : NP_115769.1

name	Hisppd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328431 CCDS:CCDS16639.1 GeneID:327655 MGI:2443281
definition	codon_start : 1 exception : mismatches in translation note : KIAA0377-like product : histidine acid phosphatase domain containing 2A protein_id : NP_848910.2

name	Ckmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753428 CCDS:CCDS16640.1 GeneID:12716 MGI:99441
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0004111 - creatine kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] codon_start : 1 note : creatine kinase mitochondrial 1 ubiquitous product : creatine kinase, mitochondrial 1, ubiquitous protein_id : NP_034027.1

name	Strc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300985 CCDS:CCDS16641.1 GeneID:140476 MGI:2153816
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007605 - sensory perception of sound [Evidence ISS] codon_start : 1 product : stereocilin protein_id : NP_536707.2

name	Catsper2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001554 GeneID:212670 MGI:2387404
definition	GO_component : GO:0019861 - flagellum [Evidence IDA] codon_start : 1 product : sperm-associated cation channel 2 protein_id : NP_694715.2

name	Pdia3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293264 CCDS:CCDS16643.1 GeneID:14827 MGI:95834
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003756 - protein disulfide isomerase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0043065 - positive regulation of apoptosis [Evidence IMP] codon_start : 1 note : endoplasmic reticulum protein; glucose regulated protein, 58 kDa; phospholipase C, alpha product : protein disulfide isomerase associated 3 protein_id : NP_031978.2

name	Ell3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:35901198 CCDS:CCDS16644.1 GeneID:269344 MGI:2673679
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : elongation factor RNA polymerase II-like 3 protein_id : NP_666085.2

name	Serf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755472 CCDS:CCDS16645.1 GeneID:378702 MGI:1337041
definition	codon_start : 1 note : modifier of spinal muscular atrophy candidate 1-like; 4F5rel (4F5 related) product : small EDRK-rich factor 2 protein_id : NP_035484.1

name	LOC574418 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:70778958 CCDS:CCDS16646.1 GeneID:574418
definition	codon_start : 1 product : hypothetical protein LOC574418 protein_id : NP_001020542.1

name	2310003F16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229055 CCDS:CCDS16647.1 GeneID:67693 MGI:1914943
definition	codon_start : 1 product : Huntingtin interacting protein K protein_id : NP_080594.2

name	Mfap1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517472 GeneID:100034361 MGI:3694697
definition	codon_start : 1 product : microfibrillar-associated protein 1B protein_id : NP_001075444.1

name	Mfap1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385728 CCDS:CCDS16648.1 GeneID:67532 MGI:1914782
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 note : microfibrillar-associated protein 1 product : microfibrillar-associated protein 1A protein_id : NP_080496.1

name	Wdr76 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487321 GeneID:241627 MGI:1926186
definition	codon_start : 1 product : WD repeat domain 76 protein_id : NP_084510.2

name	Frmd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51036627 CCDS:CCDS16649.1 GeneID:228564 MGI:2442557
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] codon_start : 1 product : FERM domain containing 5 protein_id : NP_766261.2

name	Casc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930597 CCDS:CCDS16650.1 GeneID:319996 MGI:2443129
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cancer susceptibility candidate 4 isoform 1 protein_id : NP_796028.2

name	Casc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930616 GeneID:319996 MGI:2443129
definition	codon_start : 1 exception : unclassified translation discrepancy note : isoform 2 is encoded by transcript variant 2 product : cancer susceptibility candidate 4 isoform 2 protein_id : NP_950239.1

name	Mageb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543228 CCDS:CCDS16651.1 GeneID:17147 MGI:105109
definition	codon_start : 1 note : melanoma antigen family B 3 product : melanoma antigen, family B, 3 protein_id : NP_032571.2

name	Ctdspl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059059 CCDS:CCDS16652.1 GeneID:329506 MGI:1196405
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : CTD (carboxy-terminal domain RNA polymerase II polypeptide A) small phosphatase like 2 product : CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 protein_id : NP_997615.1

name	Eif3s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244040 GeneID:78655 MGI:1925905
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 3, subunit 1 alpha protein_id : NP_653128.2

name	4930424G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158687 CCDS:CCDS16653.1 GeneID:67578 MGI:1914828
definition	codon_start : 1 product : hypothetical protein LOC67578 protein_id : NP_080527.2

name	B2m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981890 CCDS:CCDS16654.1 GeneID:12010 MGI:88127
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0030106 - MHC class I receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019883 - antigen processing and presentation of endogenous antigen [Evidence IEA]; GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA]; GO:0006968 - cellular defense response [Evidence TAS]; GO:0006952 - defense response [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : beta 2 microglobulin product : beta-2-microglobulin protein_id : NP_033865.2

name	Trim69 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17985999 CCDS:CCDS16655.1 GeneID:70928 MGI:1918178
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RFP-like (B30.2) domain protein; ring finger protein 36 product : tripartite motif-containing 69 protein_id : NP_536771.1

name	4933406J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20911573 GeneID:74401 MGI:1921651
definition	codon_start : 1 product : hypothetical protein LOC74401 protein_id : XP_130426.1

name	LOC670832 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250091 GeneID:670832
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_001480687.1

name	Sord (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128627 CCDS:CCDS16657.1 GeneID:20322 MGI:98266
definition	GO_function : GO:0003939 - L-iditol 2-dehydrogenase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : sorbitol dehydrogenase 1 protein_id : NP_666238.1

name	Duox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628640 GeneID:214593 MGI:3036280
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : dual oxidase 2 protein_id : NP_808278.2

name	Duoxa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385246 CCDS:CCDS16660.1 GeneID:66811 MGI:1914061
definition	codon_start : 1 product : Numb-interacting protein 2 protein_id : NP_080053.1

name	Duoxa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430555 CCDS:CCDS16661.1 GeneID:213696 MGI:2384861
definition	codon_start : 1 product : Numb-interacting protein 1 protein_id : NP_663370.2

name	Duox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250093 GeneID:99439 MGI:2139422
definition	codon_start : 1 product : dual oxidase 1 protein_id : XP_130483.6

name	Shf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185924 CCDS:CCDS16662.1 GeneID:435684 MGI:3613669
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : Src homology 2 domain containing F protein_id : NP_001013851.2

name	Slc28a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370488 CCDS:CCDS16663.1 GeneID:269346 MGI:1913105
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001882 - nucleoside binding [Evidence IEA]; GO:0005415 - nucleoside:sodium symporter activity [Evidence IEA]; GO:0015211 - purine nucleoside transporter activity [Evidence IDA] GO_process : GO:0015860 - purine nucleoside transport [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : purine-selective Na+ nucleoside cotransporter; solute carrier family 28 (sodium-coupled nucleoside transporter) member 2 product : solute carrier family 28 (sodium-coupled nucleoside transporter), member 2 protein_id : NP_766568.1

name	Rp23-357i14.1 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886766 GeneID:381417
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_355381.4

name	Rp23-357i14.1 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250095 GeneID:381417
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480713.1

name	Gatm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385454 CCDS:CCDS16665.1 GeneID:67092 MGI:1914342
definition	GO_component : GO:0005758 - mitochondrial intermembrane space [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0015068 - glycine amidinotransferase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006601 - creatine biosynthesis [Evidence ISS] codon_start : 1 product : L-arginine:glycine amidinotransferase protein_id : NP_080237.1

name	Spata5l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249981 GeneID:214616 MGI:3036261
definition	codon_start : 1 product : spermatogenesis associated 5-like 1 protein_id : XP_001480047.1

name	AA467197 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921341 GeneID:433470 MGI:3034182
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] codon_start : 1 note : normal mucosa of esophagus specific gene 1 product : hypothetical protein LOC433470 protein_id : NP_001004174.1

name	Slc30a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52630421 CCDS:CCDS16667.1 GeneID:22785 MGI:1345282
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IEA] codon_start : 1 note : zinc transporter 4; lethal milk; solute carrier family 30 (zinc transporter) member 4 product : solute carrier family 30 (zinc transporter), member 4 protein_id : NP_035904.2

name	Pldn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790039 CCDS:CCDS16668.1 GeneID:18457 MGI:1927580
definition	GO_component : GO:0005768 - endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006944 - membrane fusion [Evidence IPI]; GO:0006904 - vesicle docking during exocytosis [Evidence TAS]; GO:0006906 - vesicle fusion [Evidence TAS] codon_start : 1 note : syntaxin 13-interacting protein pallid; syntaxin 13 binding protein 1 product : pallidin protein_id : NP_062762.1

name	Sqrdl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981549 CCDS:CCDS16669.1 GeneID:59010 MGI:1929899
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : flavo-binding protein; sulfide dehydrogenase-like product : sulfide quinone reductase-like protein_id : NP_067482.3

clone name	MSMg01-363J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548G19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-191L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353L16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-476M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092N10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-336O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-436G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487H05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-457M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081C09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-452P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-486H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-435F19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-105N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-296I14.b	B6Ng01-296I14.g
ACC	GA092124	GA092125
length	1,167	532
definition	B6Ng01-296I14.b	B6Ng01-296I14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(121,526,625 - 121,527,804)	(121,681,524 - 121,682,052)
sequence	gaattcctgttctctgctccccacagtctcccttcagcctttgggaacct actcaacctaggggaaggtcctgggttacttcctgggggttctacatgtt aacggtgagaatgattcacagttcagaaagccacggtttctgggtttcca acatccacaacaccccacgggcagaggcgggcagaggtgacctttgacct tggcttggtttttatcaactagtttgataaaaccagaaaaaaatgagacc ctggccttaagaagcctagcctgctctttaaaatcttcatctggttctgc ttcaggtaagtggtagattttgatgtttcatgctccgtttcacccagaat cccattctccagctgctcaggttcccacggagtgaaaaatgtcggctttc ccagtgacaggcctgtcattcagctcgttgtatatcactttcataaatgc agcatccaagggcttctacccatgtgcaccctgttatcagtgatgtgccc tctcatcgtgcagggagcattcaaactgctcagcagggtaggagacaact attcaagcggtccttgtagtggctggcgtctccataaataggtgtccact accatctgaggccccagggacaatctgagtggagatcagtcaggaacagg gtgtttatgagagctgattttcctagacctgagtcaccaagcaccatcag gtgtgaactggaatcccaaactactgtggtttctctctctttttcttttt tttttgagcttcattgggaaaatttgcaagaccaacataggtagaagttt ctggatttacaaactgagttggctgttgcttagacatcgtcttgattttt gtttgtttgtttgtttgttttggtcaatacaccaacaccagtcaagtagt caaacgttaagctatattctcagacacccttctcttttaaactcttggtg tgtggggtgttgtttgttatgaattacttttaatattcgtgtttcttttt taaaaactaatggaataggtttcgttttcataggaagtacttttacattg gtattcctttaaaaaaaaaacttttgatgtttgaagtccatttaacgagt tgctggagctacattgacaccttgactaatggtaagcttaagcttaccat gtggcttttcttaaaaa	gaattcaaggccagcctgggctacatagcaagcttcaggccagcaagagc taattagtgagatcctgtaagaaaagaaaagaaaagaaaagaaaagaaaa gaaaagaaaaggaaaggaaaggaaaggaaaggaaaggaaaggaaaggaaa ggaaaggaaaggaaaggaaaggaaaggaaaggaaagaaaagaaaagaaaa gaaaagaaaagaaaagaaaagaaaagaccagatcagataaaacctattca aattgcctcaaggaaaaggggcgtatattctacaaatgttgacaggttga aacttgatccaggagtctatcatgatcaaagctctgaaaatcgtgcccct ctcccggtgcccctctttctctgtgttcctcacattctcccttcttcctc atagttcttgcctcctcttaactctgcgtcacttactctgggcctgactc attctgttggtctcttactcttggttagtataagcttacgaccatgttgt gaggatgatattgtgcatcgtacacattgctt
quality values	Open. Hide. 58 33 38 24 62 62 62 47 49 62 62 62 62 62 62 62 62 62 62 62 62 45 32 56 54 59 49 62 62 62 62 43 39 34 43 16 18 28 32 28 28 33 54 48 62 59 62 59 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 51 51 36 34 48 56 59 56 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 59 59 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 59 59 59 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 56 62 62 62 62 62 62 62 62 62 38 47 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 47 62 54 42 62 62 62 62 42 62 62 62 54 52 41 62 62 62 62 62 62 62 52 62 54 62 52 48 38 46 46 52 47 62 58 58 54 54 58 54 54 58 58 54 45 58 58 54 58 54 54 39 58 42 58 58 54 54 54 45 58 58 54 54 58 52 54 54 54 48 45 39 58 58 58 58 54 24 38 34 43 52 48 54 41 54 58 42 42 54 52 58 58 58 58 58 52 54 58 54 58 29 42 40 54 58 50 51 51 50 28 58 58 41 48 51 53 51 49 38 51 58 58 47 50 51 50 58 19 58 40 49 58 58 51 40 51 58 48 50 49 54 51 46 53 50 50 48 49 46 25 48 52 52 48 49 46 53 51 52 50 49 47 39 51 50 50 39 58 52 54 49 46 33 29 43 49 58 50 51 27 40 37 50 42 31 37 54 42 50 50 49 52 54 40 51 35 32 58 37 42 45 53 51 39 49 50 44 54 54 54 52 39 49 54 54 54 54 54 54 54 54 49 35 52 33 52 53 52 35 32 35 35 41 54 34 49 54 54 42 42 54 51 41 27 18 32 32 33 13 28 27 34 39 31 41 23 7 54 33 37 36 34 41 23 52 54 44 38 32 51 38 38 29 52 32 29 35 31 53 35 32 32 31 32 14 33 31 23 27 24 40 34 29 42 34 32 31 32 32 22 34 33 32 32 34 14 16 31 32 30 51 31 22 51 51 46 29 33 26 45 27 35 24 51 41 37 23 51 35 51 31 51 31 46 27 48 46 35 46 31 21 31 29 31 31 31 31 29 32 22 21 25 31 16 30 32 29 22 11 26 31 31 31 27 34 28 31 32 32 41 15 18 31 32 31 24 9 20 30 31 24 31 30 30 20 35 31 31 30 22 29 15 11 24 46 25 9 27 31 31 19 8 44 44 33 22 47 29 22 22 29 17 16 30 26 24 31 18 30 18 31 44 44 44 11 17 21 30 22 44 43 25 29 12 13 13 8 12 21 26 11 19 21 11 25 47 36 25 30 24 11 8 9 10 27 10 17 33 25 43 5 5 8 39 39 36 26 29 10 34 36 37 23 18 24 16 6 15 19 21 8 5 6 11 9 17 12 32 27 6 20 13 21 34 10 8 5 10 9 18 6 21 18 22 28 7 6 18 40 30 18 28 7 5 10 3 7 8 7 8 12 20 3 8 6 18 21 6 25 24 27 25 29 19 28 25 13 7 14 28 25 18 13 14 4 7 15 15 3 1 11 5 1 8 4 5 9 4 20 8 6 10 15 5 22 5 4 4 4 4 6 10 10 8 15 8 15 11 11 7 14 3 3 3 2 1 2 4 10 5 10 4 17 11 8 11 5 15 8 1 4 11 4 5 2 4 6 19 2 2 2 1 4 11 17 5 1 2 4 9 5 2 3 20 22 14 3 1 2 7 21 21 12 3	Open. Hide. 62 59 56 46 62 59 39 59 62 62 15 17 9 10 25 23 23 23 18 25 32 24 32 50 36 59 62 59 59 62 62 62 62 62 62 59 59 62 62 62 59 46 62 62 62 62 62 59 62 62 59 62 62 62 59 39 24 34 45 27 24 43 44 45 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 62 62 58 58 58 58 58 58 58 40 47 52 52 46 38 52 52 58 58 43 58 52 52 58 58 58 58 58 58 58 58 58 58 58 58 41 41 47 41 38 47 58 58 58 58 47 54 41 31 38 41 47 47 58 58 47 47 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 43 58 58 58 58 58 58 58 58 58 58 33 28 40 13 19 19 9 19 10 9 9 6 13 12 10 15 13 25 10 9 5 5 9 6 18 15 10 9 9 9 9 5 30 19 10 13 9 14 9 11 12 6 9 17 10 9 9 11 9 21 15 23 13 9 21 11 9 10 13 9 9 6 6 9 6 9 10 13 21 13 11 9 10 11 6 9 19 10 11 15 25 17 14 25 12 6 10 11 16 12 9 8 6 9 21 11 18 19 16 9 9 12 9 8 15 23 28 30 11 9 16 18 8 12 14 11 9 12 9 9 9 9 13 12 6 13 11 6 6 10 8 11 8 11 6 11 12 16 9 15 11 12 9 8 13 15 13 10 6 6 6 6 6 14 6 12 8 7 9 9 9 9 12 8 6 10 6 9 6 6 6 11 7 5 10 10 7 7 5 15 8 7 6 8 6 13 9 11 6 11 14 13 13 12 16 14 15 25 24 10 7 8 8 12 8 8 9 4 7 8 10 9 9 12 9 9 10 10 10 6 5 6 6 6 8 9 8 5 6 6 10 10 16 11 13 15 11 12 8 5 8 9 11 10 13 8 7 7 8 10 9 5 3 3 8 7 4 7 10 6 6 5 6 7 6 6 6 6 15 15 6 6 6 8 10 10 8 5 4 8 5 5 4 7 11 14 7 10 18 9 4 6 5 11 16 9 13 9 10 9 5 5 14 6 5 4 5 7 8 7 7 6 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_121526625_121527804
seq2: B6Ng01-296I14.b_44_1210

seq1  GAATTCCTGTTCTCTGCTCCCCACAGTCTCCCTTCAGCCTTTGGGAACCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGTTCTCTGCTCCCCACAGTCTCCCTTCAGCCTTTGGGAACCT  50

seq1  ACTCAACCTAGGGGAAGGTCCTGGGTTACTTCCTGGGGGTTCTACATGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAACCTAGGGGAAGGTCCTGGGTTACTTCCTGGGGGTTCTACATGTT  100

seq1  AACGGTGAGAATGATTCACAGTTCAGAAAGCCACGGTTTCTGGGTTTCCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACGGTGAGAATGATTCACAGTTCAGAAAGCCACGGTTTCTGGGTTTCCA  150

seq1  ACATCCACAACACCCCACGGGCAGAGGCGGGCAGAGGTGACCTTTGACCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCCACAACACCCCACGGGCAGAGGCGGGCAGAGGTGACCTTTGACCT  200

seq1  TGGCTTGGTTTTTATCAACTAGTTTGATAAAACCAGAAAAAAATGAGACC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTTGGTTTTTATCAACTAGTTTGATAAAACCAGAAAAAAATGAGACC  250

seq1  CTGGCCTTAAGAAGCCTAGCCTGCTCTTTAAAATCTTCATCTGGTTCTGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCCTTAAGAAGCCTAGCCTGCTCTTTAAAATCTTCATCTGGTTCTGC  300

seq1  TTCAGGTAAGTGGTAGATTTTGATGTTTCATGCTCCGTTTCACCCAGAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGGTAAGTGGTAGATTTTGATGTTTCATGCTCCGTTTCACCCAGAAT  350

seq1  CCCATTCTCCAGCTGCTCAGGTTCCCACGGAGTGAAAAATGTCGGCTTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATTCTCCAGCTGCTCAGGTTCCCACGGAGTGAAAAATGTCGGCTTTC  400

seq1  CCAGTGACAGGCCTGTCATTCAGCTCGTTGTATATCACTTTCATAAATGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTGACAGGCCTGTCATTCAGCTCGTTGTATATCACTTTCATAAATGC  450

seq1  AGCATCCAAGGGCTTCTACCCATGTGCACCCTGTTATCAGTGATGTGCCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATCCAAGGGCTTCTACCCATGTGCACCCTGTTATCAGTGATGTGCCC  500

seq1  TCTCATCGTGCAGGGAGCATTCAAACTGCTCAGCAGGGTAGGAGACAACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCATCGTGCAGGGAGCATTCAAACTGCTCAGCAGGGTAGGAGACAACT  550

seq1  ATTCAAGCGGTCCTTGTAGTGGCTGGCGTCTCCATAAATAGGTGTCCACT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCAAGCGGTCCTTGTAGTGGCTGGCGTCTCCATAAATAGGTGTCCACT  600

seq1  ACCATCTGAGGCCCCAGGGACAATCTGAGTGGAGATCAGTCAGGAACAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATCTGAGGCCCCAGGGACAATCTGAGTGGAGATCAGTCAGGAACAGG  650

seq1  GTGTTTATGAGAGCTGATTTTCCTAGACCTGAGTCACCAAGCACCATCAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTTATGAGAGCTGATTTTCCTAGACCTGAGTCACCAAGCACCATCAG  700

seq1  GTGTGAACTGGAATCCCAAACTACTGTGGTTTCTCTCTCTTTTTCTTTTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGAACTGGAATCCCAAACTACTGTGGTTTCTCTCTCTTTTTCTTTTT  750

seq1  TTTTTGAGCTTCATTGGGAAAATTTGCAAGACCAACATAGGTAGAAGTTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTGAGCTTCATTGGGAAAATTTGCAAGACCAACATAGGTAGAAGTTT  800

seq1  CTGGATTTACAAACTGAGTTGGCTGTTGCTTAGACATCGTCTTGATTTTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGATTTACAAACTGAGTTGGCTGTTGCTTAGACATCGTCTTGATTTTT  850

seq1  GTTTGTTTGTTTGTTTGTTTTGGTCAATACACCAACACCAGTCAAGTAGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGTTTGTTTGTTTGTTTTGGTCAATACACCAACACCAGTCAAGTAGT  900

seq1  CAAACGTTAAGCTATATTCTCAGACACCCTTCTCTTTTAAACTCTTGGTG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAACGTTAAGCTATATTCTCAGACACCCTTCTCTTTTAAACTCTTGGTG  950

seq1  TGTGGGGTGTTTGTTTTGTTATGAATTACTTTTAATATTCGTGTTTCTTT  1000
      |||||||||||   ||||||||||||||||||||||||||||||||||||
seq2  TGTGGGGTGTT--GTTTGTTATGAATTACTTTTAATATTCGTGTTTCTTT  998

seq1  TTTAAAAACTTAATGG-ATAGGTTTGTTTTTCATAGGAAGTACTTTTAAC  1049
      ||||||||| |||||| ||||||||  |||||||||||||||||||| ||
seq2  TTTAAAAAC-TAATGGAATAGGTTTCGTTTTCATAGGAAGTACTTTT-AC  1046

seq1  ATTTGTATTTCCTTTAAAAAAAAACTTTTGATGTTTTAAATTCAATTTAA  1099
      ||| ||||| | || |||||||||||||||||| ||| || || ||||||
seq2  ATTGGTATTCCTTTAAAAAAAAAACTTTTGATG-TTTGAAGTCCATTTAA  1095

seq1  CGAAGTGTCTGAGGCTACATTTTAACACCTTGCCTTATGGTAAGCTTATA  1149
      || |||  |||  ||||||  || |||||||| || |||||||||||| |
seq2  CG-AGTTGCTGGAGCTACA--TTGACACCTTGACTAATGGTAAGCTTA-A  1141

seq1  GTTTATACCATGTGGGTCTTTTCTTATAAAA  1180
      | |  ||||||||||  ||||||||| ||| 
seq2  GCT--TACCATGTGG--CTTTTCTTAAAAA-  1167

seq1: chr2_121681524_121682052
seq2: B6Ng01-296I14.g_67_598 (reverse)

seq1  AAGCAATGTGTACGATGTACAAGATCATCCTCTGAACACGGATGTAAACT  50
      ||||||||||||||||| |||| |||||||||  |||| ||  |||| ||
seq2  AAGCAATGTGTACGATGCACAATATCATCCTCACAACATGGTCGTAAGCT  50

seq1  TCTACTAACCAAGAGTAAGAGACAAACAGAATATTTAAAGGCCCAGAGTA  100
      | ||||||||||||||||||||| ||||||||   |  ||||||||||||
seq2  TATACTAACCAAGAGTAAGAGACCAACAGAATGAGT-CAGGCCCAGAGTA  99

seq1  AGTTATGCAAAAGTTAAGAGGAGGCAAGAACTCTGAGGAAGAAGGGAGAA  150
      ||| | || | ||||||||||||||||||||| |||||||||||||||||
seq2  AGTGACGC-AGAGTTAAGAGGAGGCAAGAACTATGAGGAAGAAGGGAGAA  148

seq1  TCTGAGGAACACAGAGAAAGAGGGGCACCGGGAGAAATGGCTGATTTTCA  200
      | |||||||||||||||||||||||||||||||||   |   ||||||||
seq2  TGTGAGGAACACAGAGAAAGAGGGGCACCGGGAGAGGGGCACGATTTTCA  198

seq1  GAGCTTTGATCATGATAGACTCCTGGATCAAGTTTCAACCTGTTAACATT  250
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  GAGCTTTGATCATGATAGACTCCTGGATCAAGTTTCAACCTGTCAACATT  248

seq1  TGTAGAATATATGCCCCTTTTCCTTGAGGCAATCTGAATAGGTTTT----  296
      ||||||||||| ||||||||||||||||||||| ||||||||||||    
seq2  TGTAGAATATACGCCCCTTTTCCTTGAGGCAATTTGAATAGGTTTTATCT  298

seq1  -CTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCT  345
        |||  |||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTGGTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCTTTTCT  348

seq1  TTTCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCT  395
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCTTTCCT  398

seq1  TTCCTTTCCTTTCCTTTCCTTTCCTTTTCTTTTCTTTTCTTTTCTTTTCT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTTCCTTTCCTTTCCTTTCCTTTTCTTTTCTTTTCTTTTCTTTTCT  448

seq1  TTTCTTTTCTTTTCTTACAGGATCTCACTAATTAGCTCTTGCTGGCCTGA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTTTCTTTTCTTACAGGATCTCACTAATTAGCTCTTGCTGGCCTGA  498

seq1  AGCTTGCTATGTAGCCCAGGCTGGCCTTGAATTC  529
      ||||||||||||||||||||||||||||||||||
seq2  AGCTTGCTATGTAGCCCAGGCTGGCCTTGAATTC  532

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information