MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-308I02
Chromosome	2 (Build37)
Map Location	103,809,086 - 103,952,042
singlet/doublet	doublet
Overlap gene	Lmo2, Fbxo3, Cd59b, Cd59a
Upstream gene	Pdhx, Apip, Ehf, Elf5, Cat, Abtb2, Nat10, Caprin1, LOC433458, LOC100042961, LOC100042965
Downstream gene	A930018P22Rik, D430041D05Rik, LOC100043349, Hipk3, LOC383735, LOC668733, Cstf3, Tcp11l1, EG622282, OTTMUSG00000014964, Depdc7, Qser1, LOC100042995, 2310047K21Rik, LOC668744, Prrg4, Ccdc73, Ga17, 2210415I11Rik, LOC622356
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pdhx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27402 MGI:1351627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56369 MGI:1926788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ehf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13661 MGI:1270840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13711 MGI:1335079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12359 MGI:88271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abtb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99382 MGI:2139365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nat10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98956 MGI:2138939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Caprin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53872 MGI:1858234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433458 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs, 8 Proteins

name	LOC100042961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042965 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Lmo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16909 MGI:102811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57443 MGI:1929084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cd59b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333883 MGI:1888996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd59a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12509 MGI:109177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930018P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68243 MGI:1915493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430041D05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241589 MGI:2181743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043349 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 mRNAs, 3432 ESTs, 23 Proteins

name	Hipk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15259 MGI:1314882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668733 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668733
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs, 1 Protein pseudo : _no_value

name	Cstf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228410 MGI:1351825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Tcp11l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320554 MGI:2444263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622282 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622282 MGI:3646938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	OTTMUSG00000014964 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241593 MGI:3649546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Depdc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211896 MGI:2139258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qser1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99003 MGI:2138986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 121 ESTs, 2 Proteins

name	LOC100042995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2310047K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71928 MGI:1919178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs

name	LOC668744 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	Prrg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228413 MGI:2442211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc73 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211936 MGI:3606488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ga17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98221 MGI:1351744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210415I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78320 MGI:1925570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC622356 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Pdhx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802665 GeneID:27402 MGI:1351627
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate dehydrogenase complex, component X transcript_id : NM_175094.3

name	Apip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803057 GeneID:56369 MGI:1926788
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : APAF1 interacting protein transcript_id : NM_019735.3

name	Ehf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76096376 GeneID:13661 MGI:1270840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ets homologous factor transcript_id : NM_007914.3

name	Elf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802240 GeneID:13711 MGI:1335079
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E74-like factor 5 transcript_id : NM_010125.2

name	Cat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753271 GeneID:12359 MGI:88271
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catalase transcript_id : NM_009804.1

name	Abtb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49402266 GeneID:99382 MGI:2139365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and BTB (POZ) domain containing 2 transcript_id : NM_178890.3

name	Nat10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130147 GeneID:98956 MGI:2138939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetyltransferase 10 transcript_id : NM_153126.2

name	Caprin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42558247 GeneID:53872 MGI:1858234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell cycle associated protein 1 transcript_id : NM_016739.2

name	LOC433458 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249978 GeneID:433458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 2 Proteins product : similar to trafficking protein particle complex 6B, transcript variant 1 transcript_id : XM_485041.5

name	Lmo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254347 GeneID:16909 MGI:102811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain only 2 transcript_id : NM_008505.3

name	Fbxo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877054 GeneID:57443 MGI:1929084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 3 transcript_id : NM_212433.1

name	Fbxo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877053 GeneID:57443 MGI:1929084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 3 transcript_id : NM_020593.2

name	Cd59b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32469506 GeneID:333883 MGI:1888996
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD59b antigen transcript_id : NM_181858.1

name	Cd59a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371898 GeneID:12509 MGI:109177
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD59a antigen transcript_id : NM_007652.3

name	A930018P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386934 GeneID:68243 MGI:1915493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930018P22 gene transcript_id : NM_026634.2

name	D430041D05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358960 GeneID:241589 MGI:2181743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430041D05 gene transcript_id : NM_001033347.2

name	LOC100043349 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249982 GeneID:100043349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 mRNAs, 3432 ESTs, 23 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase transcript_id : XM_001479851.1

name	Hipk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754199 GeneID:15259 MGI:1314882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeodomain interacting protein kinase 3 transcript_id : NM_010434.1

name	Cstf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892648 GeneID:228410 MGI:1351825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage stimulation factor, 3' pre-RNA, subunit 3 transcript_id : NM_145529.2

name	Cstf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371724 GeneID:228410 MGI:1351825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage stimulation factor, 3' pre-RNA, subunit 3 transcript_id : NM_177253.2

name	Cstf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82617561 GeneID:228410 MGI:1351825
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage stimulation factor, 3' pre-RNA, subunit 3 transcript_id : NM_001037326.1

name	Tcp11l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366983 GeneID:320554 MGI:2444263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex 11 like 1 transcript_id : NM_177190.3

name	EG622282 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367123 GeneID:622282 MGI:3646938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG622282 transcript_id : XM_886707.2

name	OTTMUSG00000014964 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343868 GeneID:241593 MGI:3649546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000014964 transcript_id : NM_001033768.2

name	Depdc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450164 GeneID:211896 MGI:2139258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEP domain containing 7 transcript_id : NM_144804.1

name	Qser1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249911 GeneID:99003 MGI:2138986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 121 ESTs, 2 Proteins product : glutamine and serine rich 1 transcript_id : XM_001479246.1

name	LOC100042995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249913 GeneID:100042995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to glutamine and serine rich 1 transcript_id : XM_001479250.1

name	2310047K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249915 GeneID:71928 MGI:1919178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs product : RIKEN cDNA 2310047K21 gene transcript_id : XM_001479258.1

name	Prrg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384247 GeneID:228413 MGI:2442211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) transcript_id : NM_178695.4

name	Ccdc73 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286864 GeneID:211936 MGI:3606488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 73 transcript_id : NM_177600.3

name	Ga17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130110 GeneID:98221 MGI:1351744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dendritic cell protein GA17 transcript_id : NM_145380.2

name	2210415I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249918 GeneID:78320 MGI:1925570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 2210415I11 gene transcript_id : XM_001479287.1

name	LOC622356 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249920 GeneID:622356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 transcript_id : XM_001479293.1

name	Pdhx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201978 CCDS:CCDS16473.1 GeneID:27402 MGI:1351627
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0031405 - lipoic acid binding [Evidence IEA] codon_start : 1 note : dihydrolipoamide dehydrogenase-binding protein of pyruvate dehydrogenase complex (E3-binding protein) (proX) product : pyruvate dehydrogenase complex, component X protein_id : NP_780303.1

name	Apip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981004 CCDS:CCDS16474.1 GeneID:56369 MGI:1926788
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : monocyte macrophage 19 product : APAF1 interacting protein protein_id : NP_062709.2

name	Ehf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681287 CCDS:CCDS16475.1 GeneID:13661 MGI:1270840
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0030855 - epithelial cell differentiation [Evidence ISS]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : ets homologous factor protein_id : NP_031940.1

name	Elf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753744 CCDS:CCDS16477.1 GeneID:13711 MGI:1335079
definition	GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0007398 - ectoderm development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : E74-like factor 5 protein_id : NP_034255.1

name	Cat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753272 CCDS:CCDS16478.1 GeneID:12359 MGI:88271
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005778 - peroxisomal membrane [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0004096 - catalase activity [Evidence IDA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016684 - oxidoreductase activity, acting on peroxide as acceptor [Evidence IDA]; GO:0004601 - peroxidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0042744 - hydrogen peroxide catabolism [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 exception : mismatches in translation note : catalase 1 product : catalase protein_id : NP_033934.1

name	Abtb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49402267 CCDS:CCDS16479.1 GeneID:99382 MGI:2139365
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : ankyrin repeat and BTB (POZ) domain containing 2 protein_id : NP_849221.2

name	Nat10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346561 CCDS:CCDS16480.1 GeneID:98956 MGI:2138939
definition	GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel putative ATPase domain containing protein product : N-acetyltransferase 10 protein_id : NP_694766.1

name	Caprin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42558248 CCDS:CCDS16481.1 GeneID:53872 MGI:1858234
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 note : cytoplasmic activation/proliferation-associated protein 1; caprin 1; GPI-anchored membrane protein 1 product : cell cycle associated protein 1 protein_id : NP_058019.2

name	LOC433458 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249979 GeneID:433458
definition	codon_start : 1 product : similar to trafficking protein particle complex 6B isoform 1 protein_id : XP_485041.2

name	Lmo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678702 CCDS:CCDS16482.1 GeneID:16909 MGI:102811
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : LIM only 2 product : LIM domain only 2 protein_id : NP_032531.1

name	Fbxo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877055 CCDS:CCDS16484.1 GeneID:57443 MGI:1929084
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; F-box protein FBA; F-box only protein 3 product : F-box only protein 3 isoform 1 protein_id : NP_997598.1

name	Fbxo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181216 CCDS:CCDS16485.1 GeneID:57443 MGI:1929084
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; F-box protein FBA; F-box only protein 3 product : F-box only protein 3 isoform 2 protein_id : NP_065618.1

name	Cd59b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469507 CCDS:CCDS16486.1 GeneID:333883 MGI:1888996
definition	GO_component : GO:0009986 - cell surface [Evidence IDA] GO_process : GO:0001971 - negative regulation of activation of membrane attack complex [Evidence IDA]; GO:0045916 - negative regulation of complement activation [Evidence IDA]; GO:0045918 - negative regulation of cytolysis [Evidence IDA] codon_start : 1 product : CD59b antigen protein_id : NP_862906.1

name	Cd59a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671714 CCDS:CCDS16487.1 GeneID:12509 MGI:109177
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 note : CD59 antigen product : CD59a antigen protein_id : NP_031678.1

name	A930018P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386126 CCDS:CCDS16488.1 GeneID:68243 MGI:1915493
definition	codon_start : 1 product : hypothetical protein LOC68243 protein_id : NP_080910.1

name	D430041D05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358961 GeneID:241589 MGI:2181743
definition	codon_start : 1 product : hypothetical protein LOC241589 protein_id : NP_001028519.2

name	LOC100043349 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249983 GeneID:100043349
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479901.1

name	Hipk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754200 CCDS:CCDS16489.1 GeneID:15259 MGI:1314882
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0019901 - protein kinase binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0043508 - negative regulation of JNK activity [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0018107 - peptidyl-threonine phosphorylation [Evidence IDA]; GO:0043388 - positive regulation of DNA binding [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : phosphorylates homeodomain transcription factors note : HCMV-interacting protein product : homeodomain interacting protein kinase 3 protein_id : NP_034564.1

name	Cstf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704042 CCDS:CCDS16490.1 GeneID:228410 MGI:1351825
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cleavage stimulation factor subunit 3 isoform 1 protein_id : NP_663504.1

name	Cstf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617610 GeneID:228410 MGI:1351825
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cleavage stimulation factor subunit 3 isoform 2 protein_id : NP_796227.1

name	Cstf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617562 GeneID:228410 MGI:1351825
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : cleavage stimulation factor subunit 3 isoform 3 protein_id : NP_001032403.1

name	Tcp11l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893201 CCDS:CCDS16491.1 GeneID:320554 MGI:2444263
definition	codon_start : 1 product : t-complex 11 like 1 protein_id : NP_796164.1

name	EG622282 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886612 GeneID:622282 MGI:3646938
definition	codon_start : 1 product : hypothetical protein protein_id : XP_891800.1

name	OTTMUSG00000014964 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702071 GeneID:241593 MGI:3649546
definition	codon_start : 1 product : hypothetical protein LOC241593 protein_id : NP_001028940.1

name	Depdc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450165 CCDS:CCDS16492.1 GeneID:211896 MGI:2139258
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : DEP domain containing 7 protein_id : NP_659053.1

name	Qser1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249912 GeneID:99003 MGI:2138986
definition	codon_start : 1 product : glutamine and serine rich 1 protein_id : XP_001479296.1

name	LOC100042995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249914 GeneID:100042995
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479300.1

name	2310047K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249916 GeneID:71928 MGI:1919178
definition	codon_start : 1 product : hypothetical protein LOC71928 protein_id : XP_001479308.1

name	Prrg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559846 CCDS:CCDS16493.1 GeneID:228413 MGI:2442211
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transmembrane gamma-carboxyglutamic acid protein 4 protein_id : NP_848810.2

name	Ccdc73 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243964 CCDS:CCDS16494.1 GeneID:211936 MGI:3606488
definition	codon_start : 1 product : coiled-coil domain containing 73 protein_id : NP_808268.1

name	Ga17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703762 CCDS:CCDS16495.1 GeneID:98221 MGI:1351744
definition	codon_start : 1 product : dendritic cell protein GA17 protein_id : NP_663355.1

name	2210415I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249919 GeneID:78320 MGI:1925570
definition	codon_start : 1 product : hypothetical protein LOC78320 protein_id : XP_001479337.1

name	LOC622356 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249921 GeneID:622356
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479343.1

name	LOC100042961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042961
definition	number : 2 pseudo : _no_value

name	LOC100042961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042961
definition	number : 1 pseudo : _no_value

name	LOC100042965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042965
definition	number : 3 pseudo : _no_value

name	LOC100042965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042965
definition	number : 2 pseudo : _no_value

name	LOC100042965 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042965
definition	number : 1 pseudo : _no_value

name	LOC383735 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383735
definition	number : 1 pseudo : _no_value

name	LOC668733 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249908 GeneID:668733
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs, 1 Protein product : similar to 2310047B19Rik protein pseudo : _no_value transcript_id : XR_034108.1

name	LOC668744 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249917 GeneID:668744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to Tardbp protein pseudo : _no_value transcript_id : XR_034128.1

clone name	MSMg01-486O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377G16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-448C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165J17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-339M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546N18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-061D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384K11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-192C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408M18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-416N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521D23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-234N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085M05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-308I02.b	B6Ng01-308I02.g
ACC	GA100990	GA100991
length	1,184	1,042
definition	B6Ng01-308I02.b	B6Ng01-308I02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(103,950,847 - 103,952,042)	(103,809,086 - 103,810,141)
sequence	gaattcacatgctcttcaatgtgcctcctctgccccatggaacccaacac tttgaacagaaagcctagattttcagctacacaccaggaatttacataga aatcatcagatactcctatttttaaaacaattttctctactggtccttac ttaactgaaaggtttctcctttctaccgtggaagacagcttttatggtta tctcttaggaagggtttggtctcatattgcagactacactgaaatggtca tctctccttgtatcattaatcattaacatgtatatcttagagctataacc actaaaaacaaagggcacagctgctggcttcttccctgtctaccatttgc taagttcttacatggagattccaagtccagctgacttgtgaagcagatga tatggattgtgcatattatactccttctcttctcaaaaaggcctcactct ctgaggccactgtcctaggcatctgcagtgtggctttgcaaatgactaat tttccttattagtcatgtgacatttagtatcctctgagctcatctcaggt cccctcaggactccatgtgtactagataggtgacagatttataaacagtc atttgaaacaggcaaacaggccatggccaaagtttggacaaatacccttt cttcatctttgcatctctatctcagaccctggtacactggaggctcccag aagtttgggaggcaggcacattatcactactaagaagcccgagttttgga tcagatgaatttccaaattccaaactctatgttggctgcttgacctttgc ctgctgtgttatctgatcctgcattttctcatctgtcacgcagatgattg ccccacggttatgtgggaagtgccatttttgtataaagtatatagaaaat gcttagtgcccagtacttggtgaccaactggtgttaacaaagggcagcca ttacttggtggacaactgagtaaggtttggagaggtccatgtttcccagg ttctcatccctgaccacacagaaaaccagagcttcttaccgctacagcat agagacagaatcctggtcagagagcagtgctgttcatatgcatgagaacc accgttggaacagtgttagcatgtgaagctaacgctgattggaaagagat tcgttaacaggcagggtgctcttagacacccttg	gaattcatttctgactatcatcttccggggtgagctggtctaggttatta aagcaatctttaaattggggctgaaatgcctatgtctttgatccgggctg ttcttactaaacaatggattctgagagcactcgggactttcctctttaca aacctgaagactgtcatcatcataagctaacgggccttgaacgatcattt ctggactcagtttcaaggaactcaaggcccagggggacctaggtttttct cctgaaaagtagctagctggaatccatctcttcccttctgtatttctttc tccttctagaacttgtcttcaagcttgaaggagaaacctgcccttttctt tgttttatataagacaaaataatagtaagtaataactgaaagtcttttta tcgggaaggaacttcctccggtccaagcaagtattgctgctgatacttta cagagagggccagcctcaccgctggagttcgctctttgaaagaggctagg ggagggaattctgccgccagcagatggagaggagacccggacaacgtggt ccctcccagacaccctccctgcgggattagctgcccccagctctgctcag gcgcacctagcgcgtgaggttcctggtcacacagcttgcgcccctctctg gagagcagtcgcagctactagcttgccgccagcagagccgcactgtctcg ggcatcgcagagcaccacgactgtggacttgggacctcgaacccgagacg agcgcgcgctagccagccattagcaacgcttgcatttctgcaggtgctta tttcacattcttgtcttttctttcctgctggaacgggcgagtggttactt tcagcctgaggccaaagggaaaaggcagaagaagggaactctgaaaaaga cagtttagtggcagcgggattcttgccccaggagagggctcagggagact ctcggtctctgccgcgggcccttttagagccaagtcaggcctgcgctgtc gcgtgctgctgctgcgctgccgcgcgcgccgcgcgcgctatt
quality values	Open. Hide. 62 31 23 29 62 37 23 56 42 62 62 62 62 62 62 62 44 35 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 46 38 43 42 49 32 49 62 62 59 62 62 62 62 62 62 62 54 54 54 62 62 59 62 62 62 54 62 62 62 62 62 62 59 62 62 54 62 54 59 51 59 54 43 54 50 62 59 62 59 59 59 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 54 49 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 49 54 62 62 62 62 62 62 62 54 49 62 62 59 62 62 62 62 62 54 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 43 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 54 58 58 58 52 58 58 58 58 54 54 58 58 54 41 31 31 58 58 58 42 58 58 43 58 58 58 52 58 58 58 58 58 58 54 58 58 54 58 54 58 54 58 54 58 58 39 58 54 51 49 58 58 49 58 58 58 58 58 49 58 51 54 52 58 58 58 58 58 58 58 53 51 58 58 49 48 41 48 50 50 58 58 50 58 49 58 58 58 50 54 46 58 58 50 58 58 58 58 37 58 40 53 58 48 51 51 47 58 58 58 58 54 51 54 58 53 42 53 53 51 58 54 58 54 39 58 51 54 52 54 58 51 58 58 53 40 42 58 32 42 37 42 46 49 49 38 38 50 41 51 54 50 38 18 44 38 54 50 34 42 40 37 54 51 37 53 49 54 46 49 44 51 27 54 23 37 11 54 24 30 44 38 51 41 45 45 45 40 38 53 45 53 45 39 51 32 49 42 27 47 54 54 40 51 22 53 54 54 34 31 28 32 31 31 34 25 37 31 45 53 31 41 52 47 31 45 30 53 52 39 37 31 31 29 53 53 32 42 37 34 34 32 34 33 30 29 28 32 45 42 31 31 33 30 27 24 51 31 51 31 43 31 38 31 41 31 40 37 31 51 32 33 33 31 30 30 30 45 34 32 42 30 42 30 31 31 48 46 42 43 31 31 31 43 43 38 42 31 38 31 31 31 42 32 21 29 23 31 30 24 31 31 21 36 33 16 18 27 32 35 31 30 23 27 31 31 31 46 31 38 41 33 36 31 25 31 23 36 48 48 46 30 22 19 19 27 27 48 36 27 31 32 29 31 31 36 24 37 48 48 31 25 32 23 32 32 31 18 26 29 25 41 26 21 27 20 23 27 22 26 24 44 22 25 28 21 35 18 34 31 29 23 29 9 31 23 31 22 22 22 28 39 11 24 40 16 24 32 21 18 8 16 20 33 21 19 18 21 12 26 10 16 20 31 11 10 16 4 19 33 33 24 34 20 25 26 30 13 48 26 17 21 33 22 37 13 27 24 16 14 21 24 27 27 47 16 14 30 15 16 12 13 26 24 20 28 27 20 28 18 28 17 20 27 27 19 7 9 9 13 22 11 13 22 34 30 26 6 18 16 11 20 11 10 17 5 4 5 18 18 15 8 4 4 14 20 28 20 27 28 20 22 10 9 22 7 16 17 4 3 2 8 23 10 15 11 15 17 3 9 7 11 3 1 9 5 9 9 2 6 7 13 17 18 5 18 15 16 21 6 20 12 17 16 8 6 22 5 17 17 6 9 9 9 11 3 2 2 5 9 5 8 11 6 8 7 10 3 5 6 5 17 16 7 5 6 6 6 4 18 7 16 16 10 5 11 12 5 3 5 3 7 11 7 10 18 9 4 4 5 6 2 3 8 7 4 3 5 3 3 3 4 4 7 4 4 10 6 4 2 1 4 5 4 11 3 5 12 6 10 8 14 14 3 6 5	Open. Hide. 62 59 43 59 62 59 59 59 62 43 34 24 28 24 26 26 23 28 23 23 42 49 43 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 54 62 62 62 62 59 56 51 59 49 43 56 59 62 62 62 54 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 54 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 49 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 43 43 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 49 62 62 47 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 48 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 54 58 58 58 54 58 58 54 58 58 50 54 58 54 47 54 48 58 58 58 54 58 54 58 58 41 54 39 58 58 58 58 49 52 54 58 58 58 58 58 54 54 54 54 54 58 58 58 54 54 53 58 50 52 54 52 41 54 54 52 52 54 58 58 51 58 58 23 22 46 49 58 58 58 58 58 54 47 54 58 51 49 54 58 51 58 58 58 58 52 53 39 58 52 51 58 46 47 58 58 58 54 58 58 51 58 51 58 29 29 51 42 48 44 58 49 58 49 48 52 50 49 50 53 51 49 58 58 41 58 58 53 53 58 58 43 44 51 47 50 40 58 58 54 39 46 29 50 51 42 52 51 50 51 53 37 58 53 50 53 53 53 42 58 58 52 51 50 54 41 51 49 39 42 53 53 35 51 21 49 54 46 49 42 41 51 54 42 54 51 45 51 44 54 40 41 52 42 52 52 47 31 46 12 47 31 40 47 32 49 37 33 39 40 54 41 39 51 31 29 51 37 52 51 53 42 31 46 45 52 32 34 41 41 46 35 32 53 31 34 31 29 53 26 42 36 52 52 52 52 42 41 31 29 33 37 31 43 32 51 26 51 31 31 31 41 31 32 37 31 45 33 21 29 30 30 45 51 45 30 37 31 30 22 6 46 30 41 31 42 51 31 31 48 33 26 31 31 31 27 27 30 33 29 40 22 31 29 46 46 40 31 29 47 31 31 31 31 43 23 31 31 37 31 36 29 37 46 38 29 29 30 19 28 31 39 31 27 26 30 21 46 39 31 32 34 37 22 29 29 30 18 27 17 21 17 32 33 25 48 34 18 48 44 18 24 31 16 37 31 33 29 16 31 9 10 23 29 27 29 31 36 35 36 20 25 48 48 48 30 13 20 10 18 22 32 48 26 8 9 20 17 19 20 33 31 32 32 43 33 26 16 25 32 14 14 19 19 17 24 13 21 14 12 18 6 12 18 40 31 27 24 24 10 22 40 20 14 6 11 11 28 18 13 10 17 12 18 27 27 27 11 10 12 8 9 16 13 18 12 3 10 18 19 34 34 19 16 9 25 8 18 10 14 20 24 28 27 7 18 21 6 9 28 6 31 5 9 15 10 15 17 5 19 5 14 10 21 21 18 19 18 21 23 9 7 15 4 10 21 8 13 17 7 12 5 17 7 12 7 15 16 12 18 5 12 3 3 5 13 6 4 18 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_103950847_103952042
seq2: B6Ng01-308I02.b_45_1228 (reverse)

seq1  CAAGG--GTCTAAG---ACACTGCTGGTTTTAACAGAATCTCTTTCTCAT  45
      |||||  |||||||   || ||||   | ||||| ||||||||||| || 
seq2  CAAGGGTGTCTAAGAGCACCCTGC--CTGTTAAC-GAATCTCTTTC-CAA  46

seq1  TCTAGCTGTTAGCCTCACATGCTACCACTGTTTCCAACCGGTGGTTTCTT  95
      || ||| |||||| |||||||||| ||||| |||||| ||||||||   |
seq2  TC-AGC-GTTAGCTTCACATGCTAACACTG-TTCCAA-CGGTGGTT--CT  90

seq1  CATGCAATATGAACAGCACTTGCTCTCCTGACCAGGATTCCTGTCTCTAT  145
      ||||| ||||||||||||| |||||| |||||||||||| ||||||||||
seq2  CATGC-ATATGAACAGCAC-TGCTCT-CTGACCAGGATT-CTGTCTCTAT  136

seq1  GCTGTAGCCGGTAAGAGCCTCTGGTTTTTCTGTGTGGTCAGGGATGAGAA  195
      ||||||| ||||||||  |||||| |||||||||||||||||||||||||
seq2  GCTGTAG-CGGTAAGAAGCTCTGG-TTTTCTGTGTGGTCAGGGATGAGAA  184

seq1  CCTGGGAAACATGGACCTCTCCAAACCTTACTCAGTTTGTCCACCAAGTA  245
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  CCTGGGAAACATGGACCTCTCCAAACCTTACTCAG-TTGTCCACCAAGTA  233

seq1  ATGGCTGCCCTTTGTTAACACCAGTTGGTCACCAAGTACTGGGCACTAAG  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCTGCCCTTTGTTAACACCAGTTGGTCACCAAGTACTGGGCACTAAG  283

seq1  CATTTTCTATATACTTTATACAAAAATGGCACTTCCCACATAACCGTGGG  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTTCTATATACTTTATACAAAAATGGCACTTCCCACATAACCGTGGG  333

seq1  GCAATCATCTGCGTGACAGATGAGAAAATGCAGGATCAGATAACACAGCA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATCATCTGCGTGACAGATGAGAAAATGCAGGATCAGATAACACAGCA  383

seq1  GGCAAAGGTCAAGCAGCCAACATAGAGTTTGGAATTTGGAAATTCATCTG  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAAGGTCAAGCAGCCAACATAGAGTTTGGAATTTGGAAATTCATCTG  433

seq1  ATCCAAAACTCGGGCTTCTTAGTAGTGATAATGTGCCTGCCTCCCAAACT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCAAAACTCGGGCTTCTTAGTAGTGATAATGTGCCTGCCTCCCAAACT  483

seq1  TCTGGGAGCCTCCAGTGTACCAGGGTCTGAGATAGAGATGCAAAGATGAA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGAGCCTCCAGTGTACCAGGGTCTGAGATAGAGATGCAAAGATGAA  533

seq1  GAAAGGGTATTTGTCCAAACTTTGGCCATGGCCTGTTTGCCTGTTTCAAA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGGTATTTGTCCAAACTTTGGCCATGGCCTGTTTGCCTGTTTCAAA  583

seq1  TGACTGTTTATAAATCTGTCACCTATCTAGTACACATGGAGTCCTGAGGG  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGTTTATAAATCTGTCACCTATCTAGTACACATGGAGTCCTGAGGG  633

seq1  GACCTGAGATGAGCTCAGAGGATACTAAATGTCACATGACTAATAAGGAA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTGAGATGAGCTCAGAGGATACTAAATGTCACATGACTAATAAGGAA  683

seq1  AATTAGTCATTTGCAAAGCCACACTGCAGATGCCTAGGACAGTGGCCTCA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTAGTCATTTGCAAAGCCACACTGCAGATGCCTAGGACAGTGGCCTCA  733

seq1  GAGAGTGAGGCCTTTTTGAGAAGAGAAGGAGTATAATATGCACAATCCAT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGTGAGGCCTTTTTGAGAAGAGAAGGAGTATAATATGCACAATCCAT  783

seq1  ATCATCTGCTTCACAAGTCAGCTGGACTTGGAATCTCCATGTAAGAACTT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCTGCTTCACAAGTCAGCTGGACTTGGAATCTCCATGTAAGAACTT  833

seq1  AGCAAATGGTAGACAGGGAAGAAGCCAGCAGCTGTGCCCTTTGTTTTTAG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAAATGGTAGACAGGGAAGAAGCCAGCAGCTGTGCCCTTTGTTTTTAG  883

seq1  TGGTTATAGCTCTAAGATATACATGTTAATGATTAATGATACAAGGAGAG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTATAGCTCTAAGATATACATGTTAATGATTAATGATACAAGGAGAG  933

seq1  ATGACCATTTCAGTGTAGTCTGCAATATGAGACCAAACCCTTCCTAAGAG  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACCATTTCAGTGTAGTCTGCAATATGAGACCAAACCCTTCCTAAGAG  983

seq1  ATAACCATAAAAGCTGTCTTCCACGGTAGAAAGGAGAAACCTTTCAGTTA  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACCATAAAAGCTGTCTTCCACGGTAGAAAGGAGAAACCTTTCAGTTA  1033

seq1  AGTAAGGACCAGTAGAGAAAATTGTTTTAAAAATAGGAGTATCTGATGAT  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAAGGACCAGTAGAGAAAATTGTTTTAAAAATAGGAGTATCTGATGAT  1083

seq1  TTCTATGTAAATTCCTGGTGTGTAGCTGAAAATCTAGGCTTTCTGTTCAA  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTATGTAAATTCCTGGTGTGTAGCTGAAAATCTAGGCTTTCTGTTCAA  1133

seq1  AGTGTTGGGTTCCATGGGGCAGAGGAGGCACATTGAAGAGCATGTGAATT  1195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTTGGGTTCCATGGGGCAGAGGAGGCACATTGAAGAGCATGTGAATT  1183

seq1  C  1196
      |
seq2  C  1184

seq1: chr2_103809086_103810141
seq2: B6Ng01-308I02.g_67_1108

seq1  GAATTCATTTCTGACTATCATCTTCCGGGGTGAGCTGGTCTAGGTTATTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTTCTGACTATCATCTTCCGGGGTGAGCTGGTCTAGGTTATTA  50

seq1  AAGCAATCTTTAAATTGGGGCTGAAATGCCTATGTCTTTGATCCGGGCTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAATCTTTAAATTGGGGCTGAAATGCCTATGTCTTTGATCCGGGCTG  100

seq1  TTCTTACTAAACAATGGATTCTGAGAGCACTCGGGACTTTCCTCTTTACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTACTAAACAATGGATTCTGAGAGCACTCGGGACTTTCCTCTTTACA  150

seq1  AACCTGAAGACTGTCATCATCATAAGCTAACGGGCCTTGAACGATCATTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTGAAGACTGTCATCATCATAAGCTAACGGGCCTTGAACGATCATTT  200

seq1  CTGGACTCAGTTTCAAGGAACTCAAGGCCCAGGGGGACCTAGGTTTTTCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGACTCAGTTTCAAGGAACTCAAGGCCCAGGGGGACCTAGGTTTTTCT  250

seq1  CCTGAAAAGTAGCTAGCTGGAATCCATCTCTTCCCTTCTGTATTTCTTTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAAAAGTAGCTAGCTGGAATCCATCTCTTCCCTTCTGTATTTCTTTC  300

seq1  TCCTTCTAGAACTTGTCTTCAAGCTTGAAGGAGAAACCTGCCCTTTTCTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTCTAGAACTTGTCTTCAAGCTTGAAGGAGAAACCTGCCCTTTTCTT  350

seq1  TGTTTTATATAAGACAAAATAATAGTAAGTAATAACTGAAAGTCTTTTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTATATAAGACAAAATAATAGTAAGTAATAACTGAAAGTCTTTTTA  400

seq1  TCGGGAAGGAACTTCCTCCGGTCCAAGCAAGTATTGCTGCTGATACTTTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGGAAGGAACTTCCTCCGGTCCAAGCAAGTATTGCTGCTGATACTTTA  450

seq1  CAGAGAGGGCCAGCCTCACCGCTGGAGTTCGCTCTTTGAAAGAGGCTAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGAGGGCCAGCCTCACCGCTGGAGTTCGCTCTTTGAAAGAGGCTAGG  500

seq1  GGAGGGAATTCTGCCGCCAGCAGATGGAGAGGAGACCCGGACAACGTGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGGAATTCTGCCGCCAGCAGATGGAGAGGAGACCCGGACAACGTGGT  550

seq1  CCCTCCCAGACACCCTCCCTGCGGGATTAGCTGCCCCCAGCTCTGCTCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCCAGACACCCTCCCTGCGGGATTAGCTGCCCCCAGCTCTGCTCAG  600

seq1  GCGCACCTAGCGCGTGAGGTTCCTGGTCACACAGCTTGCGCCCCTCTCTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCACCTAGCGCGTGAGGTTCCTGGTCACACAGCTTGCGCCCCTCTCTG  650

seq1  GAGAGCAGTCGCAGCTACTAGCTTGCCGCCAGCAGAGCCGCACTGTCTCG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGCAGTCGCAGCTACTAGCTTGCCGCCAGCAGAGCCGCACTGTCTCG  700

seq1  GGCATCGCAGAGCACCACGACTGTGGACTTGGGACCTCGAACCCGAGACG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATCGCAGAGCACCACGACTGTGGACTTGGGACCTCGAACCCGAGACG  750

seq1  AGCGCGCGCTAGCCAGCCATTAGCAACGCTTGCATTTCTGCAGGTGCTTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGCGCGCTAGCCAGCCATTAGCAACGCTTGCATTTCTGCAGGTGCTTA  800

seq1  TTTCACATTCTTGTCTTTTCTTTCCTGCTGGAACGGGCGAGTGGTTACTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCACATTCTTGTCTTTTCTTTCCTGCTGGAACGGGCGAGTGGTTACTT  850

seq1  TCAGCCTGAGGCCAAAGGG-AAAGGCAGAAGAAGGGGAACTCTGAAAAAG  899
      ||||||||||||||||||| ||||||||||||| ||||||||||||||||
seq2  TCAGCCTGAGGCCAAAGGGAAAAGGCAGAAGAA-GGGAACTCTGAAAAAG  899

seq1  ACAGTTTAGTGGCAGCGGGATTCTTGCCCCAGGAGAGGGGCTCAGGGGAG  949
      |||||||||||||||||||||||||||||||||||| ||||||| |||||
seq2  ACAGTTTAGTGGCAGCGGGATTCTTGCCCCAGGAGA-GGGCTCA-GGGAG  947

seq1  ACTCTCGGTCTCTGCCGCGGGCCCTTTTAAGAAGCCAAGTCAGGGCTGCC  999
      |||||||||||||||||||||||||||||   |||||||||||| ||| |
seq2  ACTCTCGGTCTCTGCCGCGGGCCCTTTTA--GAGCCAAGTCAGGCCTG-C  994

seq1  GCTGTCGCCGTTGCTGCTGCTGCCGCTGCCGCCGCCGCCGCCGCCGCCGC  1049
      ||||||||   ||||||||||| ||||||||    |||   ||||||   
seq2  GCTGTCGC--GTGCTGCTGCTG-CGCTGCCG----CGC--GCGCCGCGCG  1035

seq1  CGCTATT  1056
      |||||||
seq2  CGCTATT  1042

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information