MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-326O20
Chromosome	2 (Build37)
Map Location	23,645,741 - 23,743,746
singlet/doublet	doublet
Overlap gene	none
Upstream gene	Apbb1ip, Pdss1, Abi1, 1200016E24Rik, Acbd5, Mastl, Yme1l1, 4931423N10Rik, LOC664835, Nxph2, LOC664822, 4921517N04Rik, LOC100039149, Sh3d2c-ps1
Downstream gene	Hnmt, Tbpl2, Il1f8, LOC215253, Il1f9, Il1f6, LOC620156, Il1f5, Il1f10, Il1rn, Psd4, Pax8, LOC433410, LOC664938, Cacna1b, Ehmt1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Apbb1ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54519 MGI:1861354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56075 MGI:1889278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	1200016E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319202 MGI:2441660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 40 ESTs

name	Acbd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74159 MGI:1921409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mastl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67121 MGI:1914371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yme1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27377 MGI:1351651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931423N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70981 MGI:1918231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 4 Proteins

name	LOC664835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 134 ESTs, 8 Proteins pseudo : _no_value

name	Nxph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18232 MGI:107491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 126 ESTs, 26 Proteins pseudo : _no_value

name	4921517N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76857 MGI:1924107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039149 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Sh3d2c-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20406 MGI:1313300
definition	note : SH3 domain protein 2C, pseudogene 1 pseudo : _no_value

name	Hnmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140483 MGI:2153181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbpl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227606 MGI:2684058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1f8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69677 MGI:1916927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC215253 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:215253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins pseudo : _no_value

name	Il1f9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215257 MGI:2449929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1f6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54448 MGI:1859324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Il1f5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54450 MGI:1859325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1f10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215274 MGI:2652548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1rn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16181 MGI:96547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Psd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215632 MGI:2674093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pax8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18510 MGI:97492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 13 Proteins pseudo : _no_value

name	LOC664938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 39 ESTs, 4 Proteins pseudo : _no_value

name	Cacna1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ehmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77683 MGI:1924933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Apbb1ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328064 GeneID:54519 MGI:1861354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein transcript_id : NM_019456.1

name	Pdss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90577180 GeneID:56075 MGI:1889278
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prenyl (solanesyl) diphosphate synthase, subunit 1 transcript_id : NM_019501.3

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089350 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_001077193.1

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089342 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_001077192.1

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089346 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_007380.2

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089344 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_145994.1

name	Abi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089340 GeneID:11308 MGI:104913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abl-interactor 1 transcript_id : NM_001077190.1

name	1200016E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249214 GeneID:319202 MGI:2441660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 40 ESTs product : RIKEN cDNA 1200016E24 gene transcript_id : XM_001472371.1

name	Acbd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892632 GeneID:74159 MGI:1921409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A binding domain containing 5 transcript_id : NM_028793.2

name	Mastl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383836 GeneID:67121 MGI:1914371
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule associated serine/threonine kinase-like transcript_id : NM_025979.3

name	Yme1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383574 GeneID:27377 MGI:1351651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YME1-like 1 (S. cerevisiae) transcript_id : NM_013771.3

name	4931423N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366275 GeneID:70981 MGI:1918231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 4 Proteins product : RIKEN cDNA 4931423N10 gene transcript_id : XM_130063.4

name	Nxph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379890 GeneID:18232 MGI:107491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexophilin 2 transcript_id : NM_008752.2

name	4921517N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63079700 GeneID:76857 MGI:1924107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921517N04 gene transcript_id : NM_029773.1

name	LOC100039149 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249219 GeneID:100039149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039149 transcript_id : XM_001472660.1

name	Hnmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922616 GeneID:140483 MGI:2153181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histamine N-methyltransferase transcript_id : NM_080462.2

name	Tbpl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39979629 GeneID:227606 MGI:2684058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TATA box binding protein like 2 transcript_id : NM_199059.1

name	Il1f8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382420 GeneID:69677 MGI:1916927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 8 transcript_id : NM_027163.3

name	Il1f9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375036 GeneID:215257 MGI:2449929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 9 transcript_id : NM_153511.2

name	Il1f6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892651 GeneID:54448 MGI:1859324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 6 transcript_id : NM_019450.3

name	Il1f5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506806 GeneID:54450 MGI:1859325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 5 (delta) transcript_id : NM_019451.1

name	Il1f10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130161 GeneID:215274 MGI:2652548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 family, member 10 transcript_id : NM_153077.2

name	Il1rn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560856 GeneID:16181 MGI:96547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 receptor antagonist transcript_id : NM_031167.3

name	Il1rn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386158 GeneID:16181 MGI:96547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 receptor antagonist transcript_id : NM_001039701.2

name	Psd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402517 GeneID:215632 MGI:2674093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin and Sec7 domain containing 4 transcript_id : NM_177611.3

name	Pax8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130210 GeneID:18510 MGI:97492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired box gene 8 transcript_id : NM_011040.3

name	Cacna1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225365 GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, N type, alpha 1B subunit transcript_id : NM_007579.2

name	Cacna1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225367 GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, N type, alpha 1B subunit transcript_id : NM_001042528.1

name	Ehmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369397 GeneID:77683 MGI:1924933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : euchromatic histone methyltransferase 1 transcript_id : NM_172545.2

name	Ehmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60302889 GeneID:77683 MGI:1924933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : euchromatic histone methyltransferase 1 transcript_id : NM_001012518.1

name	Apbb1ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328065 GeneID:54519 MGI:1861354
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : proline-rich protein 48 product : amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein protein_id : NP_062329.1

name	Pdss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90577181 GeneID:56075 MGI:1889278
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046982 - protein heterodimerization activity [Evidence IDA]; GO:0000010 - trans-hexaprenyltranstransferase activity [Evidence IDA]; GO:0050347 - trans-octaprenyltranstransferase activity [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008299 - isoprenoid biosynthesis [Evidence IEA] [Evidence IDA]; GO:0051290 - protein heterotetramerization [Evidence IPI]; GO:0006744 - ubiquinone biosynthesis [Evidence IDA] [Evidence IPI] codon_start : 1 note : subunit 1 of solanesyl diphosphate synthase; trans-prenyltransferase product : prenyl diphosphate synthase, subunit 1 protein_id : NP_062374.2

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089351 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 5 protein_id : NP_001070661.1

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089343 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 4 protein_id : NP_001070660.1

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089347 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 3 protein_id : NP_031406.2

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089345 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 2 protein_id : NP_666106.1

name	Abi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089341 GeneID:11308 MGI:104913
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030296 - protein tyrosine kinase activator activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA] [Evidence IPI]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ablphilin-1; eps8 binding protein; spectrin SH3 domain binding protein 1; abelson interactor 1 product : spectrin SH3 domain binding protein 1 isoform 1 protein_id : NP_001070658.1

name	1200016E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249215 GeneID:319202 MGI:2441660
definition	codon_start : 1 product : hypothetical protein LOC319202 protein_id : XP_001472421.1

name	Acbd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229192 GeneID:74159 MGI:1921409
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0000062 - acyl-CoA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : acyl-Coenzyme A binding domain containing 5 protein_id : NP_083069.1

name	Mastl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29568088 CCDS:CCDS15727.1 GeneID:67121 MGI:1914371
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : microtubule associated serine/threonine kinase-like protein_id : NP_080255.2

name	Yme1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305635 CCDS:CCDS15728.1 GeneID:27377 MGI:1351651
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA] codon_start : 1 note : ATP-dependent metalloprotease FtsH1 product : YME1-like 1 protein_id : NP_038799.1

name	4931423N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249216 GeneID:70981 MGI:1918231
definition	codon_start : 1 product : hypothetical protein LOC70981 protein_id : XP_130063.5

name	Nxph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468865 CCDS:CCDS15729.1 GeneID:18232 MGI:107491
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS] codon_start : 1 product : neurexophilin 2 protein_id : NP_032778.1

name	4921517N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63079701 CCDS:CCDS15730.1 GeneID:76857 MGI:1924107
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76857 protein_id : NP_084049.1

name	LOC100039149 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249220 GeneID:100039149
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472710.1

name	Hnmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978276 CCDS:CCDS15731.1 GeneID:140483 MGI:2153181
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046539 - histamine N-methyltransferase activity [Evidence IEA]; GO:0008170 - N-methyltransferase activity [Evidence IDA] GO_process : GO:0001505 - regulation of neurotransmitter levels [Evidence TAS] codon_start : 1 product : histamine N-methyltransferase protein_id : NP_536710.1

name	Tbpl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979630 CCDS:CCDS15732.1 GeneID:227606 MGI:2684058
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IEA] codon_start : 1 note : TBP-related factor 3 (Trf3) product : TBP-related factor 3 protein_id : NP_951014.1

name	Il1f8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601193 GeneID:69677 MGI:1916927
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : interleukin 1 family, member 8 protein_id : NP_081439.1

name	Il1f9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943830 GeneID:215257 MGI:2449929
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : IL-1F9 product : interleukin 1 family, member 9 protein_id : NP_705731.1

name	Il1f6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506601 CCDS:CCDS15734.1 GeneID:54448 MGI:1859324
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence ISS] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence TAS] codon_start : 1 note : Fil1epsilon; interleukin 1 family, member 6 (epsilon); interleukin 1 family, member 9 product : interleukin 1 family, member 6 protein_id : NP_062323.1

name	Il1f5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506807 GeneID:54450 MGI:1859325
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : interleukin 1 receptor antagonist homolog 1 product : interleukin 1 family, member 5 protein_id : NP_062324.1

name	Il1f10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346487 CCDS:CCDS15735.1 GeneID:215274 MGI:2652548
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : IL-1F10; interleukin 1 family, member 7 product : interleukin 1 family, member 10 protein_id : NP_694717.1

name	Il1rn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624317 CCDS:CCDS15736.1 GeneID:16181 MGI:96547
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : interleukin 1 receptor antagonist isoform 1 protein_id : NP_112444.1

name	Il1rn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89257344 GeneID:16181 MGI:96547
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005152 - interleukin-1 receptor antagonist activity [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : interleukin 1 receptor antagonist isoform 2 protein_id : NP_001034790.1

name	Psd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243984 CCDS:CCDS15737.1 GeneID:215632 MGI:2674093
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 note : SEC7 homolog product : pleckstrin and Sec7 domain containing 4 protein_id : NP_808279.1

name	Pax8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754990 CCDS:CCDS15738.1 GeneID:18510 MGI:97492
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0001656 - metanephros development [Evidence IGI]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 product : paired box gene 8 protein_id : NP_035170.1

name	Cacna1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225366 CCDS:CCDS15739.1 GeneID:12287 MGI:88296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IMP]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007269 - neurotransmitter secretion [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; calcium channel, voltage-dependent, L type, alpha 1B subunit; brain calcium channel III product : calcium channel, voltage-dependent, N type, alpha 1B subunit isoform 2 protein_id : NP_031605.2

name	Cacna1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225368 GeneID:12287 MGI:88296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IMP]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007269 - neurotransmitter secretion [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; calcium channel, voltage-dependent, L type, alpha 1B subunit; brain calcium channel III product : calcium channel, voltage-dependent, N type, alpha 1B subunit isoform 1 protein_id : NP_001035993.1

name	Ehmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60302890 CCDS:CCDS15740.1 GeneID:77683 MGI:1924933
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence ISS]; GO:0016571 - histone methylation [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : euchromatic histone methyltransferase 1 isoform 1 protein_id : NP_001012536.1

name	Ehmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369762 GeneID:77683 MGI:1924933
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence ISS]; GO:0016571 - histone methylation [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : euchromatic histone methyltransferase 1 isoform 2 protein_id : NP_766133.1

name	LOC620156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620156
definition	number : 4 pseudo : _no_value

name	LOC620156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620156
definition	number : 3 pseudo : _no_value

name	LOC620156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620156
definition	number : 2 pseudo : _no_value

name	LOC620156 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620156
definition	number : 1 pseudo : _no_value

name	LOC664835 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249217 GeneID:664835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 134 ESTs, 8 Proteins product : similar to protein-tyrosine phosphatase pseudo : _no_value transcript_id : XR_030736.1

name	LOC664822 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249218 GeneID:664822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 126 ESTs, 26 Proteins product : similar to ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) pseudo : _no_value transcript_id : XR_030808.1

name	LOC215253 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249221 GeneID:215253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins product : similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 pseudo : _no_value transcript_id : XR_030867.1

name	LOC433410 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249224 GeneID:433410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 13 Proteins product : similar to Heterogeneous nuclear ribonucleoprotein A1 pseudo : _no_value transcript_id : XR_031006.1

name	LOC664938 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249225 GeneID:664938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 39 ESTs, 4 Proteins product : similar to Wwp1 protein pseudo : _no_value transcript_id : XR_002289.2

clone name	MSMg01-477L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-468E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396O04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-516D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165O11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-326O20.b	B6Ng01-326O20.g
ACC	GA114608	GA114609
length	552	896
definition	B6Ng01-326O20.b	B6Ng01-326O20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(23,743,193 - 23,743,746)	(23,645,741 - 23,646,578)
sequence	tgagagtgtctgtcataagagctataacactgccagggaaaagaacttct ctcccactgcttgtgccctttccccctcacttgaatccttctacctggcc tggacagagagctctgtggctagcttccagaacactggactacagaagag aaaatattaggcattgaactgatgataaaagaaactgatataatgatcaa tgaacatattaaatctaaaaagttgctatcacaaatcctccaggagaact ggaatacaatgaaaagacaaaatataagaataatatgaatagaaggagaa gattcccagctcaaaggcccagaaaacattttcaataaaatcatagaaga aaaattgcctaacctaaaatgaggggaaaggtgggggaaagagaagaagg gggaagagaaatagagagataaaaggagaaaggggaaggcaatgagggaa gagggggaagagccatgaatgagattgtttaaaaggaaggtttttaaact ttaagacaagaaaggaaggagaacaggagaggagaaatggggggagaggg ga	gaattccagatctctctgacacttttaacatgaaggggtgatgtgtattg ctaaatgcttttttcagcatctaaggagaagatcatgtgatttctttctt tgaggttgtttatatagaggatcacattgctggattttcgtatattgaac caaccttgtatccctgggatgaagcctacttgttctcggtgaatgatggt tttgatgtgttcttttactcagtgtgcaagcatttgattattattgcatc catattcataagggatattggtctgtcatttttttcttttgttttttctt tgtgtgtatcagtgcttgctgtggtgggagagctgtattttgatggtgtc aaagtatattgtcttctgctgtttatggtatcatgcatgcttgccttcca ccatctggttacctcttgggttagctgccctgggtgtctctggagtctac ttcctgtgcccctgggttgcaacagatctcccaggagatctgtgtctcta gctgtagcagatctcttgagagacttgcagactatggggtgttgagagtg tcacacatgcagatctgcctcctgcaggtatagacctgaagggagatgta gttagtgtgaaggggaggtgttataatcctctgggcacctttggggtctc agctgctgtgttttagtcgggcaagtaccctacctgcttttctgactgta tcagatctcctgagagacctatagacttgaggtgtttaagagaaaagggc cagacaagctaatatactacctttgaatatgccagaaggaagatggagtt aattgcatagggatggattctaatttctgggtatcttgaagggtgtcaac tgctgtggttaagttgggtgggtatactatcagtagcattgactgc
quality values	Open. Hide. 56 59 62 62 62 62 59 46 59 59 62 59 62 59 49 62 62 59 62 62 62 62 62 51 62 32 34 46 46 54 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 59 62 62 62 59 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 46 62 62 58 58 58 58 58 58 58 58 58 58 58 52 54 58 52 58 58 58 58 58 58 58 52 58 42 58 58 49 58 58 58 58 58 58 54 58 58 58 54 42 39 58 58 58 58 49 58 58 58 58 58 58 58 58 54 58 58 51 58 58 58 58 58 48 49 58 58 54 58 51 40 51 48 47 38 39 41 43 44 49 33 43 41 24 49 48 48 58 58 58 58 58 58 58 58 54 58 46 54 48 43 15	Open. Hide. 58 47 43 42 62 62 47 30 62 54 47 42 38 30 24 32 56 43 35 56 62 54 62 62 62 35 62 62 54 49 62 62 43 49 62 62 62 62 62 62 35 44 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 49 62 59 59 62 62 62 62 62 59 62 62 62 62 49 59 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 56 62 49 30 47 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 42 62 52 62 62 62 62 62 62 62 43 62 46 54 43 62 62 62 62 62 42 62 43 54 62 54 62 62 62 62 52 62 43 62 58 58 50 58 52 54 58 54 52 52 54 49 54 54 58 44 58 52 52 58 52 52 58 54 48 46 52 40 58 54 58 54 52 40 58 52 42 49 52 52 54 42 58 58 54 58 52 41 58 58 54 33 52 25 54 54 52 42 54 54 42 54 54 54 37 52 58 54 19 31 41 52 43 17 54 35 52 38 42 42 42 19 41 52 45 37 50 40 39 50 42 53 33 35 35 30 40 39 45 39 58 58 19 21 50 52 35 39 37 47 52 49 48 50 50 16 47 27 42 37 8 20 18 25 50 22 47 42 28 50 50 51 34 26 47 50 36 39 50 48 48 50 46 31 47 51 50 37 52 32 46 37 35 37 49 40 32 50 41 33 9 42 49 39 29 30 32 40 39 46 21 39 23 37 26 22 25 18 50 47 32 39 16 27 36 37 33 15 54 34 33 8 15 6 6 13 6 20 14 31 50 28 14 25 50 32 16 31 22 16 33 12 33 26 27 35 51 40 6 15 49 38 18 24 19 25 16 15 7 49 32 23 38 32 28 17 37 37 39 32 31 13 29 25 25 38 13 12 7 9 5 6 10 16 6 7 26 24 31 7 21 31 15 14 15 10 6 33 17 22 31 31 26 28 14 35 35 17 15 7 9 11 11 13 7 9 14 17 10 9 6 26 12 15 16 21 17 24 22 21 37 8 21 29 28 31 39 33 32 33 34 15 8 17 31 18 31 7 31 15 27 31 31 31 23 15 27 30 24 16 23 15 7 23 19 15 16 17 16 33 11 8 15 15 15 13 30 11 22 20 7 15 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_23743193_23743746
seq2: B6Ng01-326O20.b_55_608 (reverse)

seq1  TCCCCTCTCCCCCCATTTCTCCTCTCCTGTTATCCTTCCTTTCTTGTCTT  50
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TCCCCTCTCCCCCCATTTCTCCTCTCCTGTTCTCCTTCCTTTCTTGTCTT  50

seq1  AAAGTTTAAAAACCTTCCTTTTAAACAATCTCATTCATGGCTCTTCCCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTTAAAAACCTTCCTTTTAAACAATCTCATTCATGGCTCTTCCCCC  100

seq1  TCTTCCCTCATTGCCTTCCCCTTTCTCCTTTTATCTCTCTATTTCTCTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCCTCATTGCCTTCCCCTTTCTCCTTTTATCTCTCTATTTCTCTTC  150

seq1  CCCCTTCTTCTCTTTCCCCCACCTTTCCCCTCATTTTAGGTTAGGCAATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTTCTTCTCTTTCCCCCACCTTTCCCCTCATTTTAGGTTAGGCAATT  200

seq1  TTTCTTCTATGATTTTATTGAAAATGTTTTCTGGGCCTTTGAGCTGGGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTCTATGATTTTATTGAAAATGTTTTCTGGGCCTTTGAGCTGGGAA  250

seq1  TCTTCTCCTTCTATTCATATTATTCTTATATTTTGTCTTTTCATTGTATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCTCCTTCTATTCATATTATTCTTATATTTTGTCTTTTCATTGTATT  300

seq1  CCAGTTCTCCTGGAGGATTTGTGATAGCAACTTTTTAGATTTAATATGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTTCTCCTGGAGGATTTGTGATAGCAACTTTTTAGATTTAATATGTT  350

seq1  CATTGATCATTATATCAGTTTCTTTTATCATCAGTTCAATGCCTAATATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGATCATTATATCAGTTTCTTTTATCATCAGTTCAATGCCTAATATT  400

seq1  TTCTCTTCTGTAGTCCAGTGTTCTGGAAGCTAGCCACAGAGCTCTCTGTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCTTCTGTAGTCCAGTGTTCTGGAAGCTAGCCACAGAGCTCTCTGTC  450

seq1  CAGGCCAGGTAGAAGGATTCAAGTGAGGGGGAAAGGGCACAAGCAGTGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCCAGGTAGAAGGATTCAAGTGAGGGGGAAAGGGCACAAGCAGTGGG  500

seq1  AGAGAAGTTCTTTTCCCTGGCAGTGTTATAGCTCTTATGACAGACACTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAAGTTCTTTTCCCTGGCAGTGTTATAGCTCTTATGACAGACACTCT  550

seq1  CAGA  554
      ||||
seq2  CAGA  554

seq1: chr2_23645741_23646578
seq2: B6Ng01-326O20.g_116_961

seq1  CTAAATGCTTTTTTCAGCATCTAAGGAGAAGATCATGTGATTTCTTTCTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAATGCTTTTTTCAGCATCTAAGGAGAAGATCATGTGATTTCTTTCTT  50

seq1  TGAGGTTGTTTATATAGAGGATCACATTGCTGGATTTTCGTATATTGAAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGTTGTTTATATAGAGGATCACATTGCTGGATTTTCGTATATTGAAC  100

seq1  CAACCTTGTATCCCTGGGATGAAGCCTACTTGTTCTCGGTGAATGATGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCTTGTATCCCTGGGATGAAGCCTACTTGTTCTCGGTGAATGATGGT  150

seq1  TTTGATGTGTTCTTTTACTCAGTGTGCAAGCATTTGATTATTATTGCATC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGATGTGTTCTTTTACTCAGTGTGCAAGCATTTGATTATTATTGCATC  200

seq1  CATATTCATAAGGGATATTGGTCTGTCATTTTTTTCTTTTGTTTTTTCTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATTCATAAGGGATATTGGTCTGTCATTTTTTTCTTTTGTTTTTTCTT  250

seq1  TGTGTGTATCAGTGCTTGCTGTGGTGGGAGAGCTGTATTTTGATGGTGTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGTATCAGTGCTTGCTGTGGTGGGAGAGCTGTATTTTGATGGTGTC  300

seq1  AAAGTATATTGTCTTCTGCTGTTTATGGTATCATGCATGCTTGCCTTCCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTATATTGTCTTCTGCTGTTTATGGTATCATGCATGCTTGCCTTCCA  350

seq1  CCATCTGGTTACCTCTTGGGTTAGCTGCCCTGGGTGTCTCTGGAGTCTAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCTGGTTACCTCTTGGGTTAGCTGCCCTGGGTGTCTCTGGAGTCTAC  400

seq1  TTCCTGTGCCCCTGGGTTGCAACAGATCTCCCAGGAGATCTGTGTCTCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTGTGCCCCTGGGTTGCAACAGATCTCCCAGGAGATCTGTGTCTCTA  450

seq1  GCTGTAGCAGATCTCTTGAGAGACTTGCAGACTATGGGGTGTTGAGAGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTAGCAGATCTCTTGAGAGACTTGCAGACTATGGGGTGTTGAGAGTG  500

seq1  TCACACATGCAGATCTGCCTCCTGCAGGTATAGACCTGAAGGGAGATGTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACACATGCAGATCTGCCTCCTGCAGGTATAGACCTGAAGGGAGATGTA  550

seq1  GTTAGTGTGAAGGGGAGGTGTTATAATCCTCTGGGCACCTTTGGGGTCTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAGTGTGAAGGGGAGGTGTTATAATCCTCTGGGCACCTTTGGGGTCTC  600

seq1  AGCTGCTGTG-TTTAGTCGGGCAAGTACCCTACCTGCTTTTCTGACTGTA  649
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  AGCTGCTGTGTTTTAGTCGGGCAAGTACCCTACCTGCTTTTCTGACTGTA  650

seq1  TCAGATCTCCTGAGAGACCTATAGACTTGAGGTG-TTGAGAG-AAAGGGC  697
      |||||||||||||||||||||||||||||||||| || |||| |||||||
seq2  TCAGATCTCCTGAGAGACCTATAGACTTGAGGTGTTTAAGAGAAAAGGGC  700

seq1  CAGACAAGCTAATATACTACC-TTGAATATGCCAGAAGGAAGATGGAGTT  746
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  CAGACAAGCTAATATACTACCTTTGAATATGCCAGAAGGAAGATGGAGTT  750

seq1  AA-TGCATAGGGATGGATTCT-ACTTCTGGGCACCTTG-AGGGTTTCAAC  793
      || |||||||||||||||||| | ||||||| | |||| ||||| |||||
seq2  AATTGCATAGGGATGGATTCTAATTTCTGGGTATCTTGAAGGGTGTCAAC  800

seq1  TGCTGTGGTT-AGTTGGGTGGGTATCCTATCTGTTGCATTGACTGC  838
      |||||||||| |||||||||||||| ||||| || |||||||||||
seq2  TGCTGTGGTTAAGTTGGGTGGGTATACTATCAGTAGCATTGACTGC  846

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information