MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-335E09
Chromosome	2 (Build37)
Map Location	164,858,188 - 165,007,235
singlet/doublet	doublet
Overlap gene	Ncoa5, Cd40, Cdh22
Upstream gene	LOC381404, Tomm34, Stk4, Kcns1, Wfdc5, Wfdc12, Wfdc15a, Wfdc15b, Svs2, Svs3b, Svs4, Svs3a, Svs6, Svs5, Slpi, Matn4, Rbpjl, Sdc4, 2610042O14Rik, 1700126L10Rik, Dbndd2, Pigt, LOC670507, Wfdc2, OTTMUSG00000016288, Wfdc6a, Spinlw1, Wfdc8, Wfdc6b, Wfdc16, OTTMUSG00000001088, Wfdc10, LOC629761, Wfdc13, Spint4, OTTMUSG00000016293, Wfdc3, Dnttip1, Ube2c, Tnnc2, Snx21, Acot8, Zswim3, Zswim1, 1700020C07Rik, Neurl2, Ctsa, Pltp, F730014I05Rik, Zfp335, LOC629777, Mmp9, Slc12a5
Downstream gene	Slc35c2, Elmo2, Gm1008, Zfp334, 4833422F24Rik, Slc13a3, 2810408M09Rik, Slc2a10, Eya2, Prkcbp1, LOC546780, Ncoa3, Sulf2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC381404 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins

name	Tomm34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67145 MGI:1914395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58231 MGI:1929004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcns1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16538 MGI:1197019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209232 MGI:2384800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192200 MGI:2183434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc15a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68221 MGI:1915471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc15b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192201 MGI:2445041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Svs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53878 MGI:1858275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svs3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329557 MGI:3583778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svs4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20941 MGI:98450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svs3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64335 MGI:1927635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svs6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20945 MGI:106178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svs5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20944 MGI:98453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slpi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20568 MGI:109297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17183 MGI:1328314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbpjl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19668 MGI:1196616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20971 MGI:1349164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610042O14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66460 MGI:1913710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700126L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73603 MGI:1920853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	Dbndd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52840 MGI:106562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Pigt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78928 MGI:1926178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Wfdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67701 MGI:1914951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000016288 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629747 MGI:3651470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Wfdc6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209351 MGI:2684968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spinlw1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75526 MGI:1922776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277343 MGI:2685552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433502 MGI:3575430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277345 MGI:2670994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000001088 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629754 MGI:3652032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins

name	Wfdc10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629756 MGI:3616889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629761 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	Wfdc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408190 MGI:3582777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spint4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78239 MGI:1925489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000016293 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:641368 MGI:3651687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71856 MGI:1923897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnttip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76233 MGI:1923483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68612 MGI:1915862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnnc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21925 MGI:98780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101113 MGI:1917729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170789 MGI:2158201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zswim3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67538 MGI:1914788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zswim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71971 MGI:1919221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700020C07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75642 MGI:1922892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 4 Proteins

name	Neurl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:415115 MGI:3043305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19025 MGI:97748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pltp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18830 MGI:103151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F730014I05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228866 MGI:2443858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329559 MGI:2682313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629777 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Mmp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17395 MGI:97011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc12a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57138 MGI:1862037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncoa5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228869 MGI:2385165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21939 MGI:88336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Cdh22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104010 MGI:1341843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228875 MGI:2385166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elmo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140579 MGI:2153045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Gm1008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381405 MGI:2685854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp334 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228876 MGI:2388656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833422F24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74614 MGI:1921864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc13a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114644 MGI:2149635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810408M09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381406 MGI:1918294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170441 MGI:2156687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eya2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14049 MGI:109341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228880 MGI:1918025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546780 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546780
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Ncoa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17979 MGI:1276535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sulf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72043 MGI:1919293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC381404 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250108 GeneID:381404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins product : similar to orthologue of H. sapiens chromosome 20 open reading frame 119 (C20orf119) transcript_id : XM_001480780.1

name	Tomm34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378078 GeneID:67145 MGI:1914395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of outer mitochondrial membrane 34 transcript_id : NM_025996.2

name	Stk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361509 GeneID:58231 MGI:1929004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 4 transcript_id : NM_021420.3

name	Kcns1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821678 GeneID:16538 MGI:1197019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : K+ voltage-gated channel, subfamily S, 1 transcript_id : NM_008435.2

name	Wfdc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778836 GeneID:209232 MGI:2384800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 5 transcript_id : NM_145369.2

name	Wfdc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981675 GeneID:192200 MGI:2183434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 12 transcript_id : NM_138684.2

name	Wfdc15a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802871 GeneID:68221 MGI:1915471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 15A transcript_id : NM_183271.2

name	Wfdc15b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930766 GeneID:192201 MGI:2445041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 15B transcript_id : NM_001045554.1

name	Wfdc15b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930763 GeneID:192201 MGI:2445041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 15B transcript_id : NM_138685.2

name	Svs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802212 GeneID:53878 MGI:1858275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 2 transcript_id : NM_017390.3

name	Svs3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378040 GeneID:329557 MGI:3583778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 3B transcript_id : NM_173377.2

name	Svs4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354034 GeneID:20941 MGI:98450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 4 transcript_id : NM_009300.2

name	Svs3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946689 GeneID:64335 MGI:1927635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretion 3A transcript_id : NM_021363.1

name	Svs6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046247 GeneID:20945 MGI:106178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 6 transcript_id : NM_013679.2

name	Svs5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678188 GeneID:20944 MGI:98453
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seminal vesicle secretory protein 5 transcript_id : NM_009301.1

name	Slpi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801540 GeneID:20568 MGI:109297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory leukocyte peptidase inhibitor transcript_id : NM_011414.2

name	Matn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980776 GeneID:17183 MGI:1328314
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrilin 4 transcript_id : NM_013592.2

name	Rbpjl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677688 GeneID:19668 MGI:1196616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : recombination signal binding protein for immunoglobulin kappa J region-like transcript_id : NM_009036.1

name	Sdc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130129 GeneID:20971 MGI:1349164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syndecan 4 transcript_id : NM_011521.2

name	2610042O14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361542 GeneID:66460 MGI:1913710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610042O14 gene transcript_id : NM_025575.2

name	Dbndd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299763 GeneID:52840 MGI:106562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysbindin (dystrobrevin binding protein 1) domain containing 2 transcript_id : NM_001048227.1

name	Dbndd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299765 GeneID:52840 MGI:106562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysbindin (dystrobrevin binding protein 1) domain containing 2 transcript_id : NM_026797.2

name	Dbndd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299766 GeneID:52840 MGI:106562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysbindin (dystrobrevin binding protein 1) domain containing 2 transcript_id : NM_001048228.1

name	Dbndd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299768 GeneID:52840 MGI:106562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysbindin (dystrobrevin binding protein 1) domain containing 2 transcript_id : NM_001048229.1

name	Pigt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587020 GeneID:78928 MGI:1926178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class T transcript_id : NM_133779.2

name	LOC670507 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250253 GeneID:670507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical LOC670507 transcript_id : XM_001481194.1

name	Wfdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802067 GeneID:67701 MGI:1914951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 2 transcript_id : NM_026323.2

name	OTTMUSG00000016288 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367414 GeneID:629747 MGI:3651470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : predicted gene, OTTMUSG00000016288 transcript_id : XM_894671.2

name	Wfdc6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371195 GeneID:209351 MGI:2684968
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 6A transcript_id : NM_001033240.2

name	Spinlw1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378349 GeneID:75526 MGI:1922776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine protease inhibitor-like, with Kunitz and WAP domains 1 (eppin) transcript_id : NM_029325.2

name	Wfdc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123704806 GeneID:277343 MGI:2685552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 8 transcript_id : NM_001080550.1

name	Wfdc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480129 GeneID:433502 MGI:3575430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 6B transcript_id : NM_001012725.1

name	Wfdc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794600 GeneID:277345 MGI:2670994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 16 transcript_id : NM_001012723.1

name	OTTMUSG00000001088 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250255 GeneID:629754 MGI:3652032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 2 Proteins product : predicted gene, OTTMUSG00000001088 transcript_id : XM_894678.3

name	Wfdc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803526 GeneID:629756 MGI:3616889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 10 transcript_id : NM_001039501.2

name	LOC629761 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250256 GeneID:629761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : similar to WAP four-disulfide core domain 11 precursor transcript_id : XM_001481196.1

name	Wfdc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60592761 GeneID:408190 MGI:3582777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 13 transcript_id : NM_001012704.1

name	Spint4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130688 GeneID:78239 MGI:1925489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine protease inhibitor, Kunitz type 4 transcript_id : NM_030058.2

name	OTTMUSG00000016293 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206445 GeneID:641368 MGI:3651687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000016293 transcript_id : NM_001040055.1

name	Wfdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625858 GeneID:71856 MGI:1923897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 3 transcript_id : NM_027961.1

name	Dnttip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526975 GeneID:76233 MGI:1923483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxynucleotidyltransferase, terminal, interacting protein 1 transcript_id : NM_133763.1

name	Ube2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350135 GeneID:68612 MGI:1915862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2C transcript_id : NM_026785.2

name	Tnnc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46852154 GeneID:21925 MGI:98780
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin C2, fast transcript_id : NM_009394.2

name	Snx21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801786 GeneID:101113 MGI:1917729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin family member 21 transcript_id : NM_133924.3

name	Acot8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875407 GeneID:170789 MGI:2158201
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 8 transcript_id : NM_133240.1

name	Zswim3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341641 GeneID:67538 MGI:1914788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, SWIM domain containing 3 transcript_id : NM_178375.2

name	Zswim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980692 GeneID:71971 MGI:1919221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, SWIM domain containing 1 transcript_id : NM_028028.2

name	1700020C07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367425 GeneID:75642 MGI:1922892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 4 Proteins product : RIKEN cDNA 1700020C07 gene transcript_id : XM_130672.6

name	Neurl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133505675 GeneID:415115 MGI:3043305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuralized-like 2 (Drosophila) transcript_id : NM_001082974.1

name	Ctsa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84042524 GeneID:19025 MGI:97748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin A transcript_id : NM_008906.3

name	Ctsa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84042522 GeneID:19025 MGI:97748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin A transcript_id : NM_001038492.1

name	Pltp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84042526 GeneID:18830 MGI:103151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipid transfer protein transcript_id : NM_011125.2

name	F730014I05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379259 GeneID:228866 MGI:2443858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F730014I05 gene transcript_id : NM_146129.3

name	Zfp335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517713 GeneID:329559 MGI:2682313
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 335 transcript_id : NM_199027.2

name	LOC629777 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367427 GeneID:629777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC629777 transcript_id : XM_901831.2

name	Mmp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560795 GeneID:17395 MGI:97011
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 9 transcript_id : NM_013599.2

name	Slc12a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859679 GeneID:57138 MGI:1862037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 12, member 5 transcript_id : NM_020333.1

name	Ncoa5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450270 GeneID:228869 MGI:2385165
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor coactivator 5 transcript_id : NM_144892.1

name	Cd40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608199 GeneID:21939 MGI:88336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD40 antigen transcript_id : NM_170701.2

name	Cd40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608201 GeneID:21939 MGI:88336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD40 antigen transcript_id : NM_011611.2

name	Cd40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608112 GeneID:21939 MGI:88336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD40 antigen transcript_id : NM_170704.2

name	Cd40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608176 GeneID:21939 MGI:88336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD40 antigen transcript_id : NM_170702.2

name	Cd40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608142 GeneID:21939 MGI:88336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD40 antigen transcript_id : NM_170703.2

name	Cdh22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341388 GeneID:104010 MGI:1341843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 22 transcript_id : NM_174988.2

name	Slc35c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450264 GeneID:228875 MGI:2385166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member C2 transcript_id : NM_144893.1

name	Elmo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877042 GeneID:140579 MGI:2153045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : engulfment and cell motility 2, ced-12 homolog (C. elegans) transcript_id : NM_080287.2

name	Elmo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877051 GeneID:140579 MGI:2153045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : engulfment and cell motility 2, ced-12 homolog (C. elegans) transcript_id : NM_207706.1

name	Elmo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877049 GeneID:140579 MGI:2153045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : engulfment and cell motility 2, ced-12 homolog (C. elegans) transcript_id : NM_207705.1

name	Gm1008 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53749213 GeneID:381405 MGI:2685854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1008, (NCBI) transcript_id : NM_001005425.1

name	Zfp334 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341520 GeneID:228876 MGI:2388656
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 334 transcript_id : NM_178411.2

name	4833422F24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312817 GeneID:74614 MGI:1921864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833422F24 gene transcript_id : NM_029021.1

name	Slc13a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892571 GeneID:114644 MGI:2149635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 transcript_id : NM_054055.2

name	2810408M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62510084 GeneID:381406 MGI:1918294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810408M09 gene transcript_id : NM_001007581.1

name	Slc2a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893061 GeneID:170441 MGI:2156687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 10 transcript_id : NM_130451.2

name	Eya2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129931 GeneID:14049 MGI:109341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eyes absent 2 homolog (Drosophila) transcript_id : NM_010165.2

name	Prkcbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064877 GeneID:228880 MGI:1918025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase C binding protein 1 transcript_id : NM_027230.3

name	Ncoa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026945 GeneID:17979 MGI:1276535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor coactivator 3 transcript_id : NM_008679.2

name	Sulf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801751 GeneID:72043 MGI:1919293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfatase 2 transcript_id : NM_028072.4

name	LOC381404 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250109 GeneID:381404
definition	codon_start : 1 product : similar to orthologue of H. sapiens chromosome 20 open reading frame 119 (C20orf119) protein_id : XP_001480830.1

name	Tomm34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385500 CCDS:CCDS17020.1 GeneID:67145 MGI:1914395
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : translocase of outer mitochondrial membrane 34a; Tom34a, translocase of outer mitochondrial membrane 34a; translocase of outer mitochondrial membrane 34b; Tom34b, translocase of outer mitochondrial membrane 34b product : translocase of outer mitochondrial membrane 34 protein_id : NP_080272.1

name	Stk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12328814 CCDS:CCDS17021.1 GeneID:58231 MGI:1929004
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0000902 - cell morphogenesis [Evidence ISS]; GO:0046777 - protein amino acid autophosphorylation [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] codon_start : 1 note : STE20-like kinase MST1; Yeast Sps1/Ste20-related kinase 3 product : serine/threonine kinase 4 protein_id : NP_067395.1

name	Kcns1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821679 CCDS:CCDS17022.1 GeneID:16538 MGI:1197019
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0008076 - voltage-gated potassium channel complex [Evidence ISS] [Evidence IEA] GO_function : GO:0005251 - delayed rectifier potassium channel activity [Evidence ISS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0015459 - potassium channel regulator activity [Evidence ISS]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : K+ voltage-gated channel, subfamily S, 1 protein_id : NP_032461.2

name	Wfdc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778837 CCDS:CCDS17023.1 GeneID:209232 MGI:2384800
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : WAP four-disulfide core domain 5 protein_id : NP_663344.2

name	Wfdc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149778 GeneID:192200 MGI:2183434
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0042742 - defense response to bacterium [Evidence IDA] [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : elafin-like protein II; single WAP motif protein 2 product : WAP four-disulfide core domain 12 protein_id : NP_619625.1

name	Wfdc15a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304062 GeneID:68221 MGI:1915471
definition	codon_start : 1 note : novel protein containing a WAP-type (Whey Acidic Protein) 'four-disulfide core' domain product : WAP four-disulfide core domain-like 1 protein_id : NP_899094.1

name	Wfdc15b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930767 GeneID:192201 MGI:2445041
definition	GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : single WAP motif protein 1; elafin-like protein I product : WAP four-disulfide core domain 15 protein_id : NP_001039019.1

name	Wfdc15b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149780 GeneID:192201 MGI:2445041
definition	GO_process : GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : single WAP motif protein 1; elafin-like protein I product : WAP four-disulfide core domain 15 protein_id : NP_619626.1

name	Svs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980848 CCDS:CCDS17027.1 GeneID:53878 MGI:1858275
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0030141 - secretory granule [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0019953 - sexual reproduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : semenoclotin; seminal vesicle protein, secretion 2; SVS II product : seminal vesicle secretory protein 2 protein_id : NP_059086.2

name	Svs3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27881417 GeneID:329557 MGI:3583778
definition	codon_start : 1 note : SVS III; novel protein similar to seminal vesicle secretion 3 (Svs3) product : seminal vesicle secretion 3 beta protein_id : NP_775553.1

name	Svs4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468869 CCDS:CCDS17029.1 GeneID:20941 MGI:98450
definition	codon_start : 1 note : seminal vesicle protein 2; seminal vesicle protein 4 product : seminal vesicle secretory protein 4 protein_id : NP_033326.1

name	Svs3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946690 CCDS:CCDS17030.1 GeneID:64335 MGI:1927635
definition	GO_component : GO:0005576 - extracellular region [Evidence IC]; GO:0030141 - secretory granule [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0042628 - mating plug formation [Evidence IDA]; GO:0019953 - sexual reproduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : seminal vesicle secretion 3; semenogelin II; seminal vesicle protein 3 product : seminal vesicle secretion 3 alpha protein_id : NP_067338.1

name	Svs6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046248 CCDS:CCDS17031.1 GeneID:20945 MGI:106178
definition	codon_start : 1 note : putative; seminal vesicle secretion 6 (MGD\|MGI:106178 GB\|NM_013679, evidence: BLASTN, 99%, match=532); seminal vesicle protein 6; SVS VI product : seminal vesicle secretory protein 6 protein_id : NP_038707.2

name	Svs5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678189 CCDS:CCDS17032.1 GeneID:20944 MGI:98453
definition	codon_start : 1 note : seminal vesicle secretion 5; SVS V; seminal vesicle protein F; semenogelin I; seminal vesicle protein 1 product : seminal vesicle secretory protein 5 protein_id : NP_033327.1

name	Slpi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755574 CCDS:CCDS17033.1 GeneID:20568 MGI:109297
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 function : serine protease inhibitor product : secretory leukocyte protease inhibitor protein_id : NP_035544.1

name	Matn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567374 CCDS:CCDS17034.1 GeneID:17183 MGI:1328314
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005518 - collagen binding [Evidence IEA]; GO:0005201 - extracellular matrix structural constituent [Evidence IEA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : matrilin 4 protein_id : NP_038620.1

name	Rbpjl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677689 CCDS:CCDS17035.1 GeneID:19668 MGI:1196616
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : RBP-J kappa-like product : recombining binding protein suppressor of hairless-like protein_id : NP_033062.1

name	Sdc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755442 CCDS:CCDS17036.1 GeneID:20971 MGI:1349164
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence IEA] codon_start : 1 product : syndecan 4 protein_id : NP_035651.1

name	2610042O14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385018 GeneID:66460 MGI:1913710
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC66460 protein_id : NP_079851.1

name	Dbndd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299764 GeneID:52840 MGI:106562
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : likely orthologue of H. sapiens chromosome 20 open reading frame 35 product : SCF apoptosis response protein 1 protein_id : NP_001041692.1

name	Dbndd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299767 GeneID:52840 MGI:106562
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : likely orthologue of H. sapiens chromosome 20 open reading frame 35 product : SCF apoptosis response protein 1 protein_id : NP_001041693.1

name	Dbndd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299769 GeneID:52840 MGI:106562
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : likely orthologue of H. sapiens chromosome 20 open reading frame 35 product : SCF apoptosis response protein 1 protein_id : NP_001041694.1

name	Dbndd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794440 GeneID:52840 MGI:106562
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : likely orthologue of H. sapiens chromosome 20 open reading frame 35 product : SCF apoptosis response protein 1 protein_id : NP_081073.1

name	Pigt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587021 CCDS:CCDS17038.1 GeneID:78928 MGI:1926178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0042765 - GPI-anchor transamidase complex [Evidence IEA] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003923 - GPI-anchor transamidase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0016255 - attachment of GPI anchor to protein [Evidence TAS]; GO:0006506 - GPI anchor biosynthesis [Evidence IEA]; GO:0051402 - neuron apoptosis [Evidence IDA]; GO:0030182 - neuron differentiation [Evidence IDA] codon_start : 1 product : phosphatidylinositol glycan, class T protein_id : NP_598540.2

name	LOC670507 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250254 GeneID:670507
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481244.1

name	Wfdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312840 CCDS:CCDS17040.1 GeneID:67701 MGI:1914951
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : WAP four-disulfide core domain 2 protein_id : NP_080599.1

name	OTTMUSG00000016288 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82887351 GeneID:629747 MGI:3651470
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899764.1

name	Wfdc6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701746 CCDS:CCDS17042.1 GeneID:209351 MGI:2684968
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : likely orthologue of H. sapiens WAP four-disulfide core domain 6 (WFDC6) product : WAP four-disulfide core domain 6A protein_id : NP_001028412.1

name	Spinlw1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19263328 CCDS:CCDS17043.1 GeneID:75526 MGI:1922776
definition	GO_component : GO:0001669 - acrosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : eppin protein_id : NP_083601.1

name	Wfdc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123704807 GeneID:277343 MGI:2685552
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : WAP-type serine protease inhibitor product : WAP four-disulfide core domain 8 protein_id : NP_001074019.1

name	Wfdc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480130 CCDS:CCDS17046.1 GeneID:433502 MGI:3575430
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : WAP four-disulfide core 6-like 1 product : WAP four-disulfide core domain 6 protein_id : NP_001012743.1

name	Wfdc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794601 GeneID:277345 MGI:2670994
definition	codon_start : 1 product : WAP four-disulfide core domain 16 protein_id : NP_001012741.1

name	OTTMUSG00000001088 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82887354 GeneID:629754 MGI:3652032
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899771.1

name	Wfdc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87196519 CCDS:CCDS17049.1 GeneID:629756 MGI:3616889
definition	codon_start : 1 product : WAP four-disulfide core domain 10 protein_id : NP_001034590.1

name	LOC629761 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250257 GeneID:629761
definition	codon_start : 1 product : similar to likely orthologue of H. sapiens WAP four-disulfide core domain 11 (WFDC11) protein_id : XP_001481246.1

name	Wfdc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60592762 GeneID:408190 MGI:3582777
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : WAP four-disulfide core domain 13-like 1 product : WAP four-disulfide core domain 13 protein_id : NP_001012722.1

name	Spint4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942057 CCDS:CCDS17051.1 GeneID:78239 MGI:1925489
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : epididymal trypsin inhibitor Spint4 protein_id : NP_084334.1

name	OTTMUSG00000016293 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91206446 CCDS:CCDS17052.1 GeneID:641368 MGI:3651687
definition	codon_start : 1 note : Spint5 (KUNITZ5) product : KUNITZ5 protein_id : NP_001035144.1

name	Wfdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625859 CCDS:CCDS17053.1 GeneID:71856 MGI:1923897
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WAP four-disulfide core domain 3 protein_id : NP_082237.1

name	Dnttip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526976 CCDS:CCDS17054.1 GeneID:76233 MGI:1923483
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0008047 - enzyme activator activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : terminal deoxynucleotidyltransferase interacting factor 1 protein_id : NP_598524.1

name	Ube2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312888 CCDS:CCDS17055.1 GeneID:68612 MGI:1915862
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2C protein_id : NP_081061.1

name	Tnnc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678371 CCDS:CCDS17056.1 GeneID:21925 MGI:98780
definition	GO_component : GO:0005861 - troponin complex [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence IEA] codon_start : 1 note : troponin C, fast skeletal product : fast skeletal muscle troponin C protein_id : NP_033420.1

name	Snx21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625874 GeneID:101113 MGI:1917729
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : sorting nexin family member 21 protein_id : NP_598685.2

name	Acot8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875408 CCDS:CCDS17057.1 GeneID:170789 MGI:2158201
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence TAS] GO_function : GO:0016291 - acyl-CoA thioesterase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : peroxisomal acyl-CoA thioesterase 1 protein_id : NP_573503.1

name	Zswim3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410014 CCDS:CCDS17058.1 GeneID:67538 MGI:1914788
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, SWIM domain containing 3 protein_id : NP_848462.1

name	Zswim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312606 CCDS:CCDS17059.1 GeneID:71971 MGI:1919221
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, SWIM domain containing 1 protein_id : NP_082304.1

name	1700020C07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20861675 GeneID:75642 MGI:1922892
definition	codon_start : 1 product : hypothetical protein LOC75642 protein_id : XP_130672.1

name	Neurl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133505676 GeneID:415115 MGI:3043305
definition	GO_component : GO:0005927 - muscle tendon junction [Evidence IDA]; GO:0030891 - VCB complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030239 - myofibril assembly [Evidence IMP]; GO:0045214 - sarcomere organization [Evidence IMP] codon_start : 1 product : neuralized-like 2 protein_id : NP_001076443.1

name	Ctsa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84042525 CCDS:CCDS17061.1 GeneID:19025 MGI:97748
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0004186 - carboxypeptidase C activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004185 - serine carboxypeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; protective protein for beta-galactosidase product : protective protein for beta-galactosidase isoform a protein_id : NP_032932.2

name	Ctsa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84042523 CCDS:CCDS17062.1 GeneID:19025 MGI:97748
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0004186 - carboxypeptidase C activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004185 - serine carboxypeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; protective protein for beta-galactosidase product : protective protein for beta-galactosidase isoform b protein_id : NP_001033581.1

name	Pltp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755112 CCDS:CCDS17063.1 GeneID:18830 MGI:103151
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : phospholipid transfer protein protein_id : NP_035255.1

name	F730014I05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122647 CCDS:CCDS17064.1 GeneID:228866 MGI:2443858
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : posphorylated CTD interacting factor PCIF1 protein_id : NP_666241.1

name	Zfp335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517714 GeneID:329559 MGI:2682313
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : NRC-interacting factor 1 product : zinc finger protein 335 protein_id : NP_950192.2

name	LOC629777 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82887362 GeneID:629777
definition	codon_start : 1 product : hypothetical protein protein_id : XP_906924.1

name	Mmp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305277 CCDS:CCDS17066.1 GeneID:17395 MGI:97011
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005518 - collagen binding [Evidence ISS]; GO:0008133 - collagenase activity [Evidence ISS]; GO:0004229 - gelatinase B activity [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence ISS] [Evidence IDA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence ISS] GO_process : GO:0030574 - collagen catabolism [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI] [Evidence IMP]; GO:0030225 - macrophage differentiation [Evidence ISS]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0043065 - positive regulation of apoptosis [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA] [Evidence ISS]; GO:0001501 - skeletal development [Evidence IMP] [Evidence IGI] codon_start : 1 note : Gel B; 92kD gelatinase; 92kD type IV collagenase; gelatinase B; 92kDa gelatinase; 92kDa type IV collagenase; collagenase type IVB product : matrix metalloproteinase 9 protein_id : NP_038627.1

name	Slc12a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859680 GeneID:57138 MGI:1862037
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0015377 - cation:chloride symporter activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0015379 - potassium:chloride symporter activity [Evidence ISS] [Evidence IMP]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006873 - cell ion homeostasis [Evidence ISS]; GO:0006821 - chloride transport [Evidence IMP]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : solute carrier family 12, member 5 protein_id : NP_065066.1

name	Ncoa5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450271 CCDS:CCDS17068.1 GeneID:228869 MGI:2385165
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nuclear receptor coactivator 5 protein_id : NP_659141.1

name	Cd40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608202 CCDS:CCDS17069.1 GeneID:21939 MGI:88336
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042113 - B cell activation [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0030890 - positive regulation of B cell proliferation [Evidence IDA]; GO:0048304 - positive regulation of isotype switching to IgG isotypes [Evidence IDA]; GO:0050776 - regulation of immune response [Evidence IDA]; GO:0051023 - regulation of immunoglobulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; tumor necrosis factor receptor superfamily, member 5 product : tumor necrosis factor receptor superfamily, member 5 isoform 1 protein_id : NP_035741.2

name	Cd40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608177 CCDS:CCDS17070.1 GeneID:21939 MGI:88336
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042113 - B cell activation [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0030890 - positive regulation of B cell proliferation [Evidence IDA]; GO:0048304 - positive regulation of isotype switching to IgG isotypes [Evidence IDA]; GO:0050776 - regulation of immune response [Evidence IDA]; GO:0051023 - regulation of immunoglobulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; tumor necrosis factor receptor superfamily, member 5 product : tumor necrosis factor receptor superfamily, member 5 isoform 5 protein_id : NP_733803.2

name	Cd40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24850129 GeneID:21939 MGI:88336
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042113 - B cell activation [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0030890 - positive regulation of B cell proliferation [Evidence IDA]; GO:0048304 - positive regulation of isotype switching to IgG isotypes [Evidence IDA]; GO:0050776 - regulation of immune response [Evidence IDA]; GO:0051023 - regulation of immunoglobulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; tumor necrosis factor receptor superfamily, member 5 product : tumor necrosis factor receptor superfamily, member 5 isoform 4 protein_id : NP_733805.1

name	Cd40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24850127 CCDS:CCDS17071.1 GeneID:21939 MGI:88336
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042113 - B cell activation [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0030890 - positive regulation of B cell proliferation [Evidence IDA]; GO:0048304 - positive regulation of isotype switching to IgG isotypes [Evidence IDA]; GO:0050776 - regulation of immune response [Evidence IDA]; GO:0051023 - regulation of immunoglobulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; tumor necrosis factor receptor superfamily, member 5 product : tumor necrosis factor receptor superfamily, member 5 isoform 2 protein_id : NP_733804.1

name	Cd40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24850125 GeneID:21939 MGI:88336
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042113 - B cell activation [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0030890 - positive regulation of B cell proliferation [Evidence IDA]; GO:0048304 - positive regulation of isotype switching to IgG isotypes [Evidence IDA]; GO:0050776 - regulation of immune response [Evidence IDA]; GO:0051023 - regulation of immunoglobulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; tumor necrosis factor receptor superfamily, member 5 product : tumor necrosis factor receptor superfamily, member 5 isoform 3 protein_id : NP_733802.1

name	Cdh22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27923931 CCDS:CCDS17073.1 GeneID:104010 MGI:1341843
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PB-cadherin product : cadherin 22 protein_id : NP_778153.1

name	Slc35c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450265 CCDS:CCDS17074.1 GeneID:228875 MGI:2385166
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ovarian cancer overexpressed 1 product : solute carrier family 35, member C2 protein_id : NP_659142.1

name	Elmo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877043 CCDS:CCDS17075.1 GeneID:140579 MGI:2153045
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006909 - phagocytosis [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : engulfment and cell motility 2, ced-12 homolog isoform 3 protein_id : NP_525026.2

name	Elmo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877052 CCDS:CCDS17076.1 GeneID:140579 MGI:2153045
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006909 - phagocytosis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : engulfment and cell motility 2, ced-12 homolog isoform 2 protein_id : NP_997589.1

name	Elmo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877050 CCDS:CCDS17077.1 GeneID:140579 MGI:2153045
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006909 - phagocytosis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : engulfment and cell motility 2, ced-12 homolog isoform 1 protein_id : NP_997588.1

name	Gm1008 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53749214 CCDS:CCDS17078.1 GeneID:381405 MGI:2685854
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : novel protein containing zinc finger, C2H2 type domains product : hypothetical protein LOC381405 protein_id : NP_001005425.1

name	Zfp334 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410744 CCDS:CCDS17079.1 GeneID:228876 MGI:2388656
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 334 protein_id : NP_848498.1

name	4833422F24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312818 CCDS:CCDS17080.1 GeneID:74614 MGI:1921864
definition	GO_function : GO:0005267 - potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 note : novel protein containing a DC-STAMP-like protein domain product : hypothetical protein LOC74614 protein_id : NP_083297.1

name	Slc13a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905091 CCDS:CCDS17081.1 GeneID:114644 MGI:2149635
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0015362 - high affinity sodium:dicarboxylate symporter activity [Evidence IDA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006835 - dicarboxylic acid transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 protein_id : NP_473396.1

name	2810408M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62510085 CCDS:CCDS17082.1 GeneID:381406 MGI:1918294
definition	codon_start : 1 note : novel protein similar to Trp53 regulating kinase (Trp53rk) product : hypothetical protein LOC381406 protein_id : NP_001007582.1

name	Slc2a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18485498 CCDS:CCDS17083.1 GeneID:170441 MGI:2156687
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0005355 - glucose transporter activity [Evidence ISS] GO_process : GO:0015758 - glucose transport [Evidence ISS] codon_start : 1 product : solute carrier family 2 member 10 protein_id : NP_569718.1

name	Eya2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859550 CCDS:CCDS17084.1 GeneID:14049 MGI:109341
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IDA] GO_process : GO:0008632 - apoptotic program [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : eyes absent 2 homolog protein_id : NP_034295.1

name	Prkcbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064878 GeneID:228880 MGI:1918025
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : protein kinase C binding protein 1 protein_id : NP_081506.3

name	Ncoa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026946 GeneID:17979 MGI:1276535
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nuclear receptor coactivator 3 protein_id : NP_032705.2

name	Sulf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656167 CCDS:CCDS17086.1 GeneID:72043 MGI:1919293
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0004065 - arylsulfatase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008449 - N-acetylglucosamine-6-sulfatase activity [Evidence ISS] GO_process : GO:0030201 - heparan sulfate proteoglycan metabolism [Evidence ISS]; GO:0006790 - sulfur metabolism [Evidence ISS] codon_start : 1 product : sulfatase 2 protein_id : NP_082348.2

name	LOC546780 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546780
definition	number : 1 pseudo : _no_value

name	1700126L10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149250252 GeneID:73603 MGI:1920853
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : RIKEN cDNA 1700126L10 gene transcript_id : XR_035042.1

clone name	MSMg01-361P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379B22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-459N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-411J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422F06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-446O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427A17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-058C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-122F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092J14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-335E09.b	B6Ng01-335E09.g
ACC	GA120556	GA120557
length	430	1,178
definition	B6Ng01-335E09.b	B6Ng01-335E09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(165,006,800 - 165,007,235)	(164,858,188 - 164,859,385)
sequence	atcaaccaagaaccagacaggcagccactgaatctgttttgggggcctgg gggctggagcagcagctggaagagctgtggggagcagcggtcttagaagg tgaaggaagggactggagcgtggggagagtgagctatcaacagtccctat tatgtctgctcctgcaaaggcacacagtaggtgtttaattagttattaca aggttagtgagagtcgctgcctgccctcagacagagcctcatcccatgtt ttctcttttgtcccacacaggttcccgatggctctggatgacccctagtc ccagaaggactccaagatccttttgccttcgctgatcacaccgtctgggc gcagggaccatggcacaagccctattcaggagcagctgccaggctgcctg gtgactggacctggggcttcagcgaggggg	gaattcagttctcacagtgcaggaagcttttaaaggcactgccatctgca ggccgcaggcatggaatgcctggaatagttatttacaataaagtttcaga gcaaagcattgtttatttagcttggggcactggtagatgaggctccactt gctgatgttcggaaatgggacttccaagtcaaatcaaatttcccttgctt ctttgtacattattgctcctgagaagtttgggaccaatggatgatcttat gtttagttctattctgtgctcaacctgaggtcagccccccaaaatacaga cttcttgtcatacagcccttggtgctggggtatctggaatggtccaagtt ggcttttctgaatttcctttcagaaaataaagtaaatctgctctcacact ttttaaaaactgaatttatgatcagatagctaatgggacatgaaactgct gatatctagaaaaataccttccatttagtcttgcaatgtggttgttttgc tagcacattatacaaggagaagcagtctcctatgtttcggtagagactaa tgcatgtctaggggctcaaaaaatatatgaaagaggaaagacgagctaaa tggaagagacaaaccaaaaggaaggcaggcatgcacgctaaccatcagtc aagtggtctccaatccccacaaggcaaaactagagccttgttccaaaatg ttgatacaaagttgctttttcacactcagacagatacaagtttaagtgtt ctgtggtcaaaagccacatcagggtttgcagaagcatccttttcatgaac tttcaaggtggctaccacaccacaatactgtaagaaagcgaggaaacaca cccagtacatctgagggatgggttcttgcagctcctgagattagcgcttc taaaggacaaccttttacaatgagaaagctcagatatttatcatcaccct gaagatcccgggacaccccgggacattgcatgggagctggaatgccgcag ggggaaaaatccatatacagtgaagacataacatgacattaccccgtact ccagggcagcgttcccaaagcctggagcgcacaacttcaggagaacagga cacattgttattatagacacggtatttatttttatgaagcgttagaaata ctggctttcatataccgattggtttcaa
quality values	Open. Hide. 22 42 34 52 52 54 39 35 62 62 49 48 62 47 37 62 47 62 62 62 62 54 62 62 62 42 35 44 36 28 20 34 44 51 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 46 59 56 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 56 62 62 62 62 62 62 62 62 62 56 56 56 46 56 62 62 62 62 49 47 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 54 48 46 62 52 21	Open. Hide. 62 47 42 39 62 47 37 54 62 42 51 38 24 31 43 24 32 45 62 59 62 59 62 59 62 62 62 62 62 62 59 62 62 59 62 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 59 59 46 54 56 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 56 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 41 54 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 62 62 62 62 43 42 35 21 35 47 43 46 62 62 62 62 62 62 62 52 62 62 62 62 62 43 62 52 46 52 62 62 62 62 62 62 62 62 62 62 62 62 62 28 20 23 17 34 21 41 32 54 58 58 54 58 54 48 46 58 42 54 58 54 54 58 58 58 52 58 54 51 58 58 58 58 35 41 52 54 49 42 46 58 58 54 32 52 22 27 52 37 40 52 54 38 33 58 47 52 53 52 54 54 54 58 54 58 58 46 58 31 37 41 46 58 58 49 39 42 42 39 32 28 42 52 50 39 45 31 52 52 58 30 19 54 58 52 40 54 48 58 51 50 37 50 54 42 58 41 33 42 43 51 39 50 50 52 53 50 32 53 52 50 50 33 45 41 40 54 58 52 40 47 41 29 34 52 40 47 42 50 39 37 49 39 51 52 40 50 54 34 50 50 31 50 35 25 17 48 58 24 35 25 9 58 31 37 26 26 47 33 38 49 26 20 58 41 46 46 58 58 58 58 39 26 49 32 50 52 41 30 31 35 32 32 31 40 23 23 39 23 50 30 50 42 35 34 32 24 46 42 39 24 40 39 53 25 49 26 17 32 19 58 58 50 24 39 42 31 39 26 39 32 25 14 44 33 28 53 44 38 28 26 20 51 54 25 45 31 45 34 22 8 54 54 22 31 14 29 41 28 31 22 26 53 26 34 19 41 40 53 26 35 23 31 43 15 17 41 31 37 21 26 24 19 33 16 31 33 31 35 42 40 31 40 41 32 54 54 33 13 14 14 40 26 10 35 40 21 23 21 31 16 42 53 31 20 24 31 31 36 17 21 31 35 33 33 28 47 22 31 19 23 52 18 39 22 41 31 31 31 31 13 16 31 31 31 31 23 31 37 21 28 11 33 43 11 18 9 23 16 38 42 31 17 40 18 20 24 26 17 26 28 27 31 36 46 48 31 19 25 22 31 20 31 25 18 30 37 27 26 31 29 32 24 6 46 19 18 26 42 33 20 31 31 27 32 31 14 31 48 27 32 32 38 22 16 30 21 32 46 32 21 46 26 10 15 19 35 44 41 37 9 46 32 21 28 11 34 34 31 11 29 11 31 42 11 27 16 33 21 19 33 26 28 33 28 26 29 18 12 6 8 29 36 38 28 17 48 48 48 25 32 7 22 9 13 27 28 14 34 24 14 10 23 34 29 8 8 9 5 7 7 24 16 19 33 33 22 21 22 9 7 31 6 28 34 27 20 6 19 15 22 19 24 19 7 48 18 9 14 13 10 24 6 21 13 32 23 16 28 19 6 8 15 9 27 13 15 7 16 13 16 6 14 19 24 16 16 24 10 7 30 11 10 18 6 24 9 12 7 15 7 5 4 5 4 3 3 3 6 14 15 18 4 3 6 14 6 7 7 16 6 9 21 5 5 10 8 9 7 20 28 17 28 21 9 23 9 5 3 5 7 5 6 15 8 6 5 29 4 4 10 12 6 21 16 5 18 28 14 13 5 13 5 13 13 9 12 6 3 11 6 11 5 1 2 10 5 22 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_165006800_165007235
seq2: B6Ng01-335E09.b_46_481 (reverse)

seq1  CCCCCTCGCTGAAGCCCCAGGTCCAGTCACCAGGCAGCCTGGCAGCTGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCTCGCTGAAGCCCCAGGTCCAGTCACCAGGCAGCCTGGCAGCTGCT  50

seq1  CCTGAATAGGGCTTGTGCCATGGTCCCTGCGCCCAGACGGTGTGATCAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAATAGGGCTTGTGCCATGGTCCCTGCGCCCAGACGGTGTGATCAGC  100

seq1  GAAGGCAAAAGGATCTTGGAGTCCTTCTGGGACTAGGGGTCATCCAGAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGCAAAAGGATCTTGGAGTCCTTCTGGGACTAGGGGTCATCCAGAGC  150

seq1  CATCGGGAACCTGTGTGGGACAAAAGAGAAAACATGGGATGAGGCTCTGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCGGGAACCTGTGTGGGACAAAAGAGAAAACATGGGATGAGGCTCTGT  200

seq1  CTGAGGGCAGGCAGCGACTCTCACTAACCTTGTAATAACTAATTAAACAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGGGCAGGCAGCGACTCTCACTAACCTTGTAATAACTAATTAAACAC  250

seq1  CTACTGTGTGCCTTTGCAGGAGCAGACATAATAGGGACTGTTGATAGCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTGTGTGCCTTTGCAGGAGCAGACATAATAGGGACTGTTGATAGCTC  300

seq1  ACTCTCCCCACGCTCCAGTCCCTTCCTTCACCTTCTAAGACCGCTGCTCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTCCCCACGCTCCAGTCCCTTCCTTCACCTTCTAAGACCGCTGCTCC  350

seq1  CCACAGCTCTTCCAGCTGCTGCTCCAGCCCCCAGGCCCCCAAAACAGATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACAGCTCTTCCAGCTGCTGCTCCAGCCCCCAGGCCCCCAAAACAGATT  400

seq1  CAGTGGCTGCCTGTCTGGTTCTTGGTTGATGAATTC  436
      ||||||||||||||||||||||||||||||||||||
seq2  CAGTGGCTGCCTGTCTGGTTCTTGGTTGATGAATTC  436

seq1: chr2_164858188_164859385
seq2: B6Ng01-335E09.g_69_1246

seq1  GAATTCAGTTCTCACAGTGCAGGAAGCTTTTAAAGGCACTGCCATCTGCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTTCTCACAGTGCAGGAAGCTTTTAAAGGCACTGCCATCTGCA  50

seq1  GGCCGCAGGCATGGAATGCCTGGAATAGTTATTTACAATAAAGTTTCAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCGCAGGCATGGAATGCCTGGAATAGTTATTTACAATAAAGTTTCAGA  100

seq1  GCAAAGCATTGTTTATTTAGCTTGGGGCACTGGTAGATGAGGCTCCACTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAGCATTGTTTATTTAGCTTGGGGCACTGGTAGATGAGGCTCCACTT  150

seq1  GCTGATGTTCGGAAATGGGACTTCCAAGTCAAATCAAATTTCCCTTGCTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGATGTTCGGAAATGGGACTTCCAAGTCAAATCAAATTTCCCTTGCTT  200

seq1  CTTTGTACATTATTGCTCCTGAGAAGTTTGGGACCAATGGATGATCTTAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGTACATTATTGCTCCTGAGAAGTTTGGGACCAATGGATGATCTTAT  250

seq1  GTTTAGTTCTATTCTGTGCTCAACCTGAGGTCAGCCCCCCAAAATACAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAGTTCTATTCTGTGCTCAACCTGAGGTCAGCCCCCCAAAATACAGA  300

seq1  CTTCTTGTCATACAGCCCTTGGTGCTGGGGTATCTGGAATGGTCCAAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTGTCATACAGCCCTTGGTGCTGGGGTATCTGGAATGGTCCAAGTT  350

seq1  GGCTTTTCTGAATTTCCTTTCAGAAAATAAAGTAAATCTGCTCTCACACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTTCTGAATTTCCTTTCAGAAAATAAAGTAAATCTGCTCTCACACT  400

seq1  TTTTAAAAACTGAATTTATGATCAGATAGCTAATGGGACATGAAACTGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAAAAACTGAATTTATGATCAGATAGCTAATGGGACATGAAACTGCT  450

seq1  GATATCTAGAAAAATACCTTCCATTTAGTCTTGCAATGTGGTTGTTTTGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATATCTAGAAAAATACCTTCCATTTAGTCTTGCAATGTGGTTGTTTTGC  500

seq1  TAGCACATTATACAAGGAGAAGCAGTCTCCTATGTTTCGGTAGAGACTAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCACATTATACAAGGAGAAGCAGTCTCCTATGTTTCGGTAGAGACTAA  550

seq1  TGCATGTCTAGGGGCTCAAAAAATATATGAAAGAGGAAAGACGAGCTAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATGTCTAGGGGCTCAAAAAATATATGAAAGAGGAAAGACGAGCTAAA  600

seq1  TGGAAGAGACAAACCAAAAGGAAGGCAGGCATGCACGCTAACCATCAGTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAGAGACAAACCAAAAGGAAGGCAGGCATGCACGCTAACCATCAGTC  650

seq1  AAGTGGTCTCCAATCCCCACAAGGCAAAACTAGAGCCTTGTTCCAAAATG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGGTCTCCAATCCCCACAAGGCAAAACTAGAGCCTTGTTCCAAAATG  700

seq1  TTGATACAAAGTTGCTTTTTCACACTCAGACAGATACAAGTTTAAGTGTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATACAAAGTTGCTTTTTCACACTCAGACAGATACAAGTTTAAGTGTT  750

seq1  CTGTGGTCAAAAGCCACATCAGGGTTTGCAGAAGCATCC-TTTCATGAAC  799
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  CTGTGGTCAAAAGCCACATCAGGGTTTGCAGAAGCATCCTTTTCATGAAC  800

seq1  TTTCAAGGTGGCTACCACACCACAATACTGTAAGAAAGCGAGGAAACACA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAAGGTGGCTACCACACCACAATACTGTAAGAAAGCGAGGAAACACA  850

seq1  CCCAGTACATCTGAGGGAT-GGTTCTTGCAGCTCCTGAGATTAGCGCTTC  898
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  CCCAGTACATCTGAGGGATGGGTTCTTGCAGCTCCTGAGATTAGCGCTTC  900

seq1  TAAAGGACAACCTTTTACAATGAGAAAGCTCAGAATATTTATCATCACCC  948
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  TAAAGGACAACCTTTTACAATGAGAAAGCTCAG-ATATTTATCATCACCC  949

seq1  TGAAGATCCCGGGACACCCCGGGACATTGCAATGGGAGCTGGAATGCCGC  998
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TGAAGATCCCGGGACACCCCGGGACATTGC-ATGGGAGCTGGAATGCCGC  998

seq1  AGGGGGAAAAATTCCATATACAGTGAAAGACATAACATGACAATTAACCC  1048
      ||||||||||| ||||||||||||| ||||||||||||||||  | ||||
seq2  AGGGGGAAAAA-TCCATATACAGTG-AAGACATAACATGACA--TTACCC  1044

seq1  CGTACTCCAAGGGCAGCGGTTCCCAAAGCCTGGAGCGCACAACTTCAGGA  1098
      |||||||| |||||||| ||||||||||||||||||||||||||||||||
seq2  CGTACTCC-AGGGCAGC-GTTCCCAAAGCCTGGAGCGCACAACTTCAGGA  1092

seq1  GGAACAAGGACACAAGTGTTTATTTTAATAGACA-GGTATTTATTTTTTT  1147
       |||| ||||||||     || || | ||||||| ||||||||||||| |
seq2  -GAAC-AGGACACA-----TTGTTATTATAGACACGGTATTTATTTTTAT  1135

seq1  TATGAGCGTTAGAGAAATAACTGGCTTTCCATTATACCGTTTGGGGTTCA  1197
       |  ||||||  |||||| ||||||||||   ||||||| || || ||||
seq2  GA--AGCGTT--AGAAAT-ACTGGCTTTC--ATATACCGATT-GGTTTCA  1177

seq1  A  1198
      |
seq2  A  1178

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information