MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-336O24
Chromosome	2 (Build37)
Map Location	33,190,713 - 33,287,264
singlet/doublet	doublet
Overlap gene	Ralgps1, Zbtb34
Upstream gene	Dnm1, Ciz1, 1110008P14Rik, Lcn2, Ptges2, LOC100041671, Slc25a25, 4933440H19Rik, C230093N12Rik, Dpm2, Pip5kl1, St6galnac4, St6galnac6, Ak1, Eng, Fpgs, Cdk9, Sh2d3c, Tor2a, Ttc16, Ptrh1, 1700019L03Rik, Stxbp1, 9130404D14Rik, Lrsam1, Snora65, Slc2a8, Garnl3, Angptl2
Downstream gene	Zbtb43, LOC676764, Lmx1b, LOC100041918, 2610528K11Rik, LOC100041931, Pbx3, LOC665948
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dnm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13429 MGI:107384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ciz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68379 MGI:1920234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110008P14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73737 MGI:1920987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16819 MGI:96757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptges2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:96979 MGI:1917592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041671 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 118 ESTs pseudo : _no_value

name	Slc25a25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227731 MGI:1915913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933440H19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71254 MGI:1918504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230093N12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98952 MGI:2138935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13481 MGI:1330238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5kl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227733 MGI:2448520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St6galnac4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20448 MGI:1341894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St6galnac6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50935 MGI:1355316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11636 MGI:87977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13805 MGI:95392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fpgs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14287 MGI:95576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107951 MGI:1328368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2d3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27387 MGI:1351631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tor2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30933 MGI:1353596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338348 MGI:2443048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptrh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329384 MGI:1913779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700019L03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227736 MGI:2447809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stxbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20910 MGI:107363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130404D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227737 MGI:2442910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrsam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227738 MGI:2684789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snora65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104367 MGI:2148176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56017 MGI:1860103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Garnl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99326 MGI:2139309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ralgps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241308 MGI:1922008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angptl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26360 MGI:1347002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241311 MGI:2685195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 4 Proteins

name	Zbtb43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71834 MGI:1919084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC676764 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Lmx1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16917 MGI:1100513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041918 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 642 ESTs, 2 Proteins pseudo : _no_value

name	2610528K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72543 MGI:1919793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pbx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18516 MGI:97496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Dnm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063569 GeneID:13429 MGI:107384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin 1 transcript_id : NM_010065.2

name	Ciz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19882246 GeneID:68379 MGI:1920234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDKN1A interacting zinc finger protein 1 transcript_id : NM_028412.1

name	1110008P14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574083 GeneID:73737 MGI:1920987
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110008P14 gene transcript_id : NM_198001.1

name	Lcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328048 GeneID:16819 MGI:96757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 2 transcript_id : NM_008491.1

name	Ptges2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526841 GeneID:96979 MGI:1917592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin E synthase 2 transcript_id : NM_133783.1

name	Slc25a25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560753 GeneID:227731 MGI:1915913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25 transcript_id : NM_146118.2

name	4933440H19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922677 GeneID:71254 MGI:1918504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933440H19 gene transcript_id : NM_194335.2

name	C230093N12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801802 GeneID:98952 MGI:2138935
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230093N12 gene transcript_id : NM_153560.3

name	Dpm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560809 GeneID:13481 MGI:1330238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichol-phosphate (beta-D) mannosyltransferase 2 transcript_id : NM_010073.2

name	Pip5kl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016143 GeneID:227733 MGI:2448520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase-like 1 transcript_id : NM_198191.1

name	St6galnac4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711335 GeneID:20448 MGI:1341894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 transcript_id : NM_011373.2

name	St6galnac6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778763 GeneID:50935 MGI:1355316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 transcript_id : NM_001025311.1

name	St6galnac6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778902 GeneID:50935 MGI:1355316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 transcript_id : NM_016973.2

name	St6galnac6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778903 GeneID:50935 MGI:1355316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 transcript_id : NM_001025310.1

name	Ak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130459 GeneID:11636 MGI:87977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate kinase 1 transcript_id : NM_021515.2

name	Eng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679648 GeneID:13805 MGI:95392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endoglin transcript_id : NM_007932.1

name	Fpgs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469106 GeneID:14287 MGI:95576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folylpolyglutamyl synthetase transcript_id : NM_010236.1

name	Cdk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662403 GeneID:107951 MGI:1328368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 9 (CDC2-related kinase) transcript_id : NM_130860.2

name	Sh2d3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982734 GeneID:27387 MGI:1351631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2 domain containing 3C transcript_id : NM_013781.2

name	Tor2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130175 GeneID:30933 MGI:1353596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : torsin family 2, member A transcript_id : NM_152800.2

name	Ttc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28893556 GeneID:338348 MGI:2443048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 16 transcript_id : NM_177384.1

name	Ptrh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802363 GeneID:329384 MGI:1913779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae) transcript_id : NM_178595.3

name	1700019L03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931145 GeneID:227736 MGI:2447809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700019L03 gene transcript_id : NM_025619.1

name	Stxbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678178 GeneID:20910 MGI:107363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin binding protein 1 transcript_id : NM_009295.1

name	9130404D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122640 GeneID:227737 MGI:2442910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130404D14 gene transcript_id : NM_146119.1

name	Lrsam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556365 GeneID:227738 MGI:2684789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and sterile alpha motif containing 1 transcript_id : NM_199302.1

name	Slc2a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130693 GeneID:56017 MGI:1860103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2, (facilitated glucose transporter), member 8 transcript_id : NM_019488.4

name	Garnl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385742 GeneID:99326 MGI:2139309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase activating RANGAP domain-like 3 transcript_id : NM_178888.4

name	Ralgps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352282 GeneID:241308 MGI:1922008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ral GEF with PH domain and SH3 binding motif 1 transcript_id : NM_175211.3

name	Angptl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803564 GeneID:26360 MGI:1347002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin-like 2 transcript_id : NM_011923.4

name	Zbtb34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366395 GeneID:241311 MGI:2685195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 4 Proteins product : zinc finger and BTB domain containing 34 transcript_id : XM_140881.6

name	Zbtb43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037380 GeneID:71834 MGI:1919084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 43 transcript_id : NM_001025594.1

name	Zbtb43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037382 GeneID:71834 MGI:1919084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 43 transcript_id : NM_027947.2

name	LOC676764 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249250 GeneID:676764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC676764 transcript_id : XM_001474275.1

name	Lmx1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754561 GeneID:16917 MGI:1100513
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox transcription factor 1 beta transcript_id : NM_010725.1

name	2610528K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893168 GeneID:72543 MGI:1919793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610528K11 gene transcript_id : NM_175184.4

name	LOC100041931 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249289 GeneID:100041931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041931 transcript_id : XM_001478858.1

name	Pbx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7949104 GeneID:18516 MGI:97496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre B-cell leukemia transcription factor 3 transcript_id : NM_016768.1

name	Dnm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063570 GeneID:13429 MGI:107384
definition	EC_number : 3.6.5.5 GO_component : GO:0030117 - membrane coat [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : dynamin protein_id : NP_034195.2

name	Ciz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19882247 CCDS:CCDS15911.1 GeneID:68379 MGI:1920234
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : CDKN1A-interacting zinc finger protein 1 product : Cip1-interacting zinc finger protein protein_id : NP_082688.1

name	1110008P14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574084 GeneID:73737 MGI:1920987
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73737 protein_id : NP_932118.1

name	Lcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328049 CCDS:CCDS15913.1 GeneID:16819 MGI:96757
definition	GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lipocalin 2 protein_id : NP_032517.1

name	Ptges2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526842 CCDS:CCDS15914.1 GeneID:96979 MGI:1917592
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0050220 - prostaglandin-E synthase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0046903 - secretion [Evidence IDA] codon_start : 1 exception : mismatches in translation product : prostaglandin E synthase 2 protein_id : NP_598544.1

name	Slc25a25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560754 CCDS:CCDS15915.1 GeneID:227731 MGI:1915913
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : mitochondrial Ca2+-dependent solute carrier protein_id : NP_666230.2

name	4933440H19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37059816 CCDS:CCDS15916.1 GeneID:71254 MGI:1918504
definition	codon_start : 1 product : hypothetical protein LOC71254 protein_id : NP_919316.1

name	C230093N12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956346 CCDS:CCDS15917.1 GeneID:98952 MGI:2138935
definition	codon_start : 1 product : early estrogen-induced gene 1 protein protein_id : NP_705788.1

name	Dpm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753672 GeneID:13481 MGI:1330238
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0009059 - macromolecule biosynthesis [Evidence IEA] codon_start : 1 product : dolichol-phosphate (beta-D) mannosyltransferase 2 protein_id : NP_034203.1

name	Pip5kl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016144 CCDS:CCDS15920.1 GeneID:227733 MGI:2448520
definition	GO_component : GO:0042995 - cell projection [Evidence IDA] GO_function : GO:0016308 - 1-phosphatidylinositol-4-phosphate 5-kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : phosphatidylinositol phosphate kinase-like product : phosphatidylinositol-4-phosphate 5-kinase-like 1 protein_id : NP_937834.1

name	St6galnac4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755512 CCDS:CCDS15921.1 GeneID:20448 MGI:1341894
definition	EC_number : 2.4.99.7 GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047290 - (alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1, 3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity [Evidence IEA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : ST6GalNAc IV; sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) D; Sia-alpha-2-3-Gal-beta-1-3-GalNAc GalNAc-alpha-2,6-sialyltransferase; GalNAc alpha-2,6-sialyltransferase; ST6 neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 protein_id : NP_035503.1

name	St6galnac6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778764 CCDS:CCDS15922.1 GeneID:50935 MGI:1355316
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030173 - integral to Golgi membrane [Evidence IEA] GO_function : GO:0001665 - alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity [Evidence IDA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence IDA]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; sialytransferase 7 (alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; ST6GalNAcVI; sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 isoform 3 protein_id : NP_001020482.1

name	St6galnac6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394269 CCDS:CCDS15923.1 GeneID:50935 MGI:1355316
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030173 - integral to Golgi membrane [Evidence IEA] GO_function : GO:0001665 - alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity [Evidence IDA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence IDA]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; sialytransferase 7 (alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; ST6GalNAcVI; sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 isoform 1 protein_id : NP_058669.1

name	St6galnac6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778904 GeneID:50935 MGI:1355316
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030173 - integral to Golgi membrane [Evidence IEA] GO_function : GO:0001665 - alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity [Evidence IDA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0001574 - ganglioside biosynthesis [Evidence IDA]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; sialytransferase 7 (alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; ST6GalNAcVI; sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F; (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 product : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6 isoform 2 protein_id : NP_001020481.1

name	Ak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946936 CCDS:CCDS15924.1 GeneID:11636 MGI:87977
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004017 - adenylate kinase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0019201 - nucleotide kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046034 - ATP metabolism [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 note : cytosolic adenylate kinase product : adenylate kinase 1 protein_id : NP_067490.1

name	Eng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679649 CCDS:CCDS15925.1 GeneID:13805 MGI:95392
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence TAS] codon_start : 1 exception : mismatches in translation note : transmembrane glycoprotein product : endoglin protein_id : NP_031958.1

name	Fpgs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469107 CCDS:CCDS15926.1 GeneID:14287 MGI:95576
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004326 - tetrahydrofolylpolyglutamate synthase activity [Evidence IEA] GO_process : GO:0009396 - folic acid and derivative biosynthesis [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : folylpolyglutamyl synthetase protein_id : NP_034366.1

name	Cdk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18699998 CCDS:CCDS15927.1 GeneID:107951 MGI:1328368
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0017069 - snRNA binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 9 protein_id : NP_570930.1

name	Sh2d3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305329 CCDS:CCDS15928.1 GeneID:27387 MGI:1351631
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005068 - transmembrane receptor protein tyrosine kinase adaptor protein activity [Evidence TAS] GO_process : GO:0007165 - signal transduction [Evidence TAS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : novel SH2-containing protein 3; Cas/HEF1-associated signal transducer; SH2-containing Eph receptor-binding protein 1 product : SH2 domain containing 3C protein_id : NP_038809.1

name	Tor2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779883 CCDS:CCDS15929.1 GeneID:30933 MGI:1353596
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IEA] codon_start : 1 product : torsin family 2, member A protein_id : NP_690013.1

name	Ttc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893557 CCDS:CCDS15930.1 GeneID:338348 MGI:2443048
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : tetratricopeptide repeat domain 16 protein_id : NP_796358.1

name	Ptrh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519902 CCDS:CCDS15931.1 GeneID:329384 MGI:1913779
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : novel protein similar to bacterial peptidyl-tRNA hydrolase product : peptidyl-tRNA hydrolase 1 homolog protein_id : NP_848710.1

name	1700019L03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931146 CCDS:CCDS15932.1 GeneID:227736 MGI:2447809
definition	codon_start : 1 product : hypothetical protein LOC227736 protein_id : NP_079895.1

name	Stxbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678179 CCDS:CCDS15933.1 GeneID:20910 MGI:107363
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007412 - axon target recognition [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0016188 - synaptic vesicle maturation [Evidence IMP]; GO:0006810 - transport [Evidence IEA]; GO:0006904 - vesicle docking during exocytosis [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : minisatellite 10g detected by probe MMS10; UNC-18 homolog product : syntaxin binding protein 1 protein_id : NP_033321.1

name	9130404D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122641 CCDS:CCDS15934.1 GeneID:227737 MGI:2442910
definition	codon_start : 1 note : novel PH domain containing protein product : hypothetical protein LOC227737 protein_id : NP_666231.1

name	Lrsam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556366 CCDS:CCDS15935.1 GeneID:227738 MGI:2684789
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : leucine rich repeat and sterile alpha motif containing 1 protein_id : NP_955006.1

name	Slc2a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506735 CCDS:CCDS15937.1 GeneID:56017 MGI:1860103
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015284 - fructose uniporter activity [Evidence ISS]; GO:0005354 - galactose transporter activity [Evidence ISS]; GO:0005536 - glucose binding [Evidence IDA]; GO:0005355 - glucose transporter activity [Evidence IEA] [Evidence IDA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA]; GO:0015755 - fructose transport [Evidence ISS]; GO:0015757 - galactose transport [Evidence ISS]; GO:0006006 - glucose metabolism [Evidence TAS]; GO:0015758 - glucose transport [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0001666 - response to hypoxia [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : glucose transporter X1; intestinal GLUT8 transporter product : solute carrier family 2, (facilitated glucose transporter), member 8 protein_id : NP_062361.1

name	Garnl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542097 CCDS:CCDS15938.1 GeneID:99326 MGI:2139309
definition	GO_function : GO:0005083 - small GTPase regulator activity [Evidence IEA] codon_start : 1 product : GTPase activating RANGAP domain-like 3 protein_id : NP_849219.2

name	Ralgps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424836 CCDS:CCDS15939.1 GeneID:241308 MGI:1922008
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : Ral guanine nucleotide exchange factor RalGPS1A protein_id : NP_780420.1

name	Angptl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560520 CCDS:CCDS15940.1 GeneID:26360 MGI:1347002
definition	codon_start : 1 note : angiopoietin related protein 2 product : angiopoietin-like 2 protein_id : NP_036053.2

name	Zbtb34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63489785 GeneID:241311 MGI:2685195
definition	codon_start : 1 product : similar to zinc finger and BTB domain containing 34 protein_id : XP_140881.4

name	Zbtb43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037383 CCDS:CCDS15942.1 GeneID:71834 MGI:1919084
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; zinc finger protein 297B; ortholog of zinc finger protein 297B ZNF297B product : zinc finger protein 297B isoform a protein_id : NP_082223.2

name	Zbtb43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037381 CCDS:CCDS15943.1 GeneID:71834 MGI:1919084
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; zinc finger protein 297B; ortholog of zinc finger protein 297B ZNF297B product : zinc finger protein 297B isoform b protein_id : NP_001020765.1

name	LOC676764 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249251 GeneID:676764
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474325.1

name	Lmx1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754562 CCDS:CCDS15944.1 GeneID:16917 MGI:1100513
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009953 - dorsal/ventral pattern formation [Evidence IEP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence ISS]; GO:0030326 - embryonic limb morphogenesis [Evidence NAS]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : transcription factor note : LIM homeo box transcription factor 1B product : LIM homeobox transcription factor 1 beta protein_id : NP_034855.1

name	2610528K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254287 CCDS:CCDS15946.1 GeneID:72543 MGI:1919793
definition	codon_start : 1 product : hypothetical protein LOC72543 protein_id : NP_780393.2

name	LOC100041931 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249290 GeneID:100041931
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478908.1

name	Pbx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949105 CCDS:CCDS15947.1 GeneID:18516 MGI:97496
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : pre B-cell leukemia transcription factor 3 protein_id : NP_058048.1

name	LOC665948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665948
definition	number : 2 pseudo : _no_value

name	LOC665948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665948
definition	number : 1 pseudo : _no_value

name	LOC100041671 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249283 GeneID:100041671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 118 ESTs product : hypothetical protein LOC100041671 pseudo : _no_value transcript_id : XR_033714.1

name	Snora65 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604689 GeneID:104367 MGI:2148176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 65 transcript_id : NR_002898.1

name	LOC100041918 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249288 GeneID:100041918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 642 ESTs, 2 Proteins product : similar to histone pseudo : _no_value transcript_id : XR_033935.1

clone name	MSMg01-486I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-499A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-309M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477M12
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-102A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-336O24.b	B6Ng01-336O24.g
ACC	GA121713	GA121714
length	908	719
definition	B6Ng01-336O24.b	B6Ng01-336O24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(33,190,713 - 33,191,614)	(33,286,546 - 33,287,264)
sequence	gaattctttcagtccatatgtttagtaagcacctattatcagcacatttt ggacacaaaaactcgagagacatgtcaggtcctgtccctaggttcatcct ccagtgcaggaaacagtgataaagcaggtcacacagcaatgttatatcaa gtagtaactgttgttctgaaaagcacaagcaggaggagagcgatgacggc cctgtcagcccaggcaagcctcacagaggacgatggaaacacagagaggc tgaggacacagcgaggctgaggctggaggctgtgagagtggattggaaat atggctagaatatagctgcagaggcaaggaaggggcaggagaagacatgg ccagactctagggcaggatactgcaggcctcaggagtaaggctggagcaa tgagccattggaatgagaactgactgttgtttaagatttattttaaagta tgtgtgtgggggcagggtaggggggtattcctatagaagccagagagttg ggtttccaggtactagagttacagagagttgtgaactagccacctgacac gggtacaggaacagaacttaaatcctctacaaaagtgatgcacactttaa cctcttaactactgtgccatctctccagaacttttagacatactgaaggc tctctctgcagagcctgactaaatgaatatggaagcccaagatggcacag ctgcaaagtgtgggatcattggcatggccctgtagttggcatggatcctc catacagtgggagaccagagagaagtgggcatgtcaaggaacagccaatg ctctgcagagaaacacagcccttggaacagtttctcaaaatcacgcttga agtcacccagtgcccagcattccccaagggaaaggaaagcatttatggga tgccagct	gaattctgttttttaagaccttgtctcaaggcaagaccctaaaataataa aaatagaaataaagaacttaaaaagcatggcttagcaggtcgtaggtgtg gggctttccacaggcttagggtccgggtgcacacggtcgagtcctgctcc ggccagcaggtggagccaaggagaaggcgggcggaaggccacgggccgca gagtcgggatttcaggctccaaacccgggttgctgttcagctacccgccc gtctactggtcggcctgcagcactagccaggagctgggattccgaccggc ccgccgcgagaagtccggccatatcgacacccgcccgggtccgcgcctgc ccggaagcgcgggcgccgagggggcggggcctggaagcgcttccgggggc ggggggcgcgggcaggggcggcagcgggagcggcggggaatggcctggcg ccggcggcggcggcggcggagggggcgccgcgggcgggcgatgtgaacgc ggcgcgcggcccaggtgaggctggcgggctgcgggcagaggcggcagggt cggggcgacccgtggggcggctgtccgacctcctccgtgagctcggcggg acgggggagaggctgcctggtcagtgtcagggtcggctgggcgggtcttg aggcccgggcacctgccggaggcaggggcttggccccgaggggtgggcga acccggggcatctgccctg
quality values	Open. Hide. 58 29 28 31 58 58 58 49 62 38 11 62 62 62 37 25 62 62 54 62 62 62 49 41 62 62 62 54 62 62 56 62 56 44 56 46 59 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 56 62 62 56 56 62 56 62 62 62 62 62 62 62 62 62 62 56 62 47 62 62 54 56 62 54 62 56 62 56 56 62 54 62 56 56 62 42 54 62 62 62 62 56 56 62 56 45 47 47 56 62 54 56 62 62 62 62 47 62 56 62 56 62 62 47 54 62 52 62 47 62 52 52 47 50 62 38 47 62 52 52 47 47 43 43 40 52 43 62 52 43 50 62 62 54 54 54 58 58 49 54 52 48 42 52 54 58 58 58 54 58 54 58 58 58 58 49 58 58 54 50 54 58 40 58 41 58 32 30 19 19 23 27 46 49 46 39 20 32 58 39 52 54 58 58 58 54 32 43 52 52 54 52 54 54 58 43 43 19 45 37 50 50 53 50 50 35 50 49 51 46 33 54 24 40 48 32 37 17 27 39 30 47 10 42 49 51 38 48 46 51 46 41 50 58 30 34 50 17 19 32 33 28 13 58 44 27 24 50 35 48 58 41 40 53 38 25 46 38 29 58 41 32 49 17 37 41 38 17 19 40 51 19 15 16 15 24 15 18 39 37 19 31 39 51 24 22 51 35 39 18 15 41 40 46 35 34 23 24 23 32 41 25 34 31 35 22 31 26 40 39 24 38 35 25 12 41 18 17 27 7 39 27 34 20 14 31 37 34 45 39 32 34 31 16 21 22 31 27 40 35 29 37 34 21 19 25 25 35 33 52 29 34 53 52 32 19 16 19 38 18 34 37 19 35 28 31 27 21 33 42 32 28 29 47 25 17 33 32 32 19 20 32 13 11 31 32 51 29 40 31 23 31 18 5 13 9 29 28 32 30 12 14 10 11 12 14 22 25 9 9 14 27 14 31 16 6 15 22 18 19 42 29 28 32 22 9 28 23 48 27 25 40 10 18 23 28 30 31 17 32 15 18 30 12 18 21 30 32 23 12 9 8 16 31 15 13 12 9	Open. Hide. 36 28 50 47 62 51 47 44 51 56 38 56 56 59 18 38 39 59 59 59 62 62 62 59 59 62 59 51 49 59 62 49 49 50 46 59 59 62 62 62 51 50 50 56 59 43 59 62 59 59 62 43 49 51 43 25 48 50 51 59 59 62 59 59 62 62 62 62 62 62 56 56 59 59 48 48 59 62 62 59 59 62 62 62 34 62 59 59 62 62 62 59 59 56 38 62 62 62 54 54 54 59 62 59 62 62 62 59 59 51 59 59 59 62 59 62 62 59 50 62 62 59 59 59 59 62 62 59 62 59 50 59 59 59 59 62 59 62 49 59 59 59 62 62 62 62 62 62 62 62 49 59 49 51 51 43 49 43 34 59 40 56 62 59 49 51 59 46 48 43 46 46 46 54 49 38 62 59 39 50 43 40 43 56 59 56 51 62 56 59 59 62 59 62 51 49 56 38 43 43 14 54 34 49 59 43 59 56 59 59 62 59 49 39 40 59 46 59 62 59 59 62 62 62 62 62 56 62 54 54 59 59 49 59 56 59 59 56 49 40 51 59 46 59 50 46 34 45 45 46 43 50 50 46 49 49 59 59 51 59 34 30 39 30 34 48 48 34 34 31 49 49 50 56 59 40 51 59 49 51 51 59 51 51 59 56 56 46 49 59 59 46 46 34 59 48 23 23 21 10 27 30 34 39 43 43 51 46 46 46 62 59 59 51 49 48 35 56 37 56 56 59 49 59 51 34 44 46 43 46 50 46 59 59 56 59 59 62 59 59 59 59 34 49 34 43 43 49 51 31 34 39 27 38 46 38 34 46 38 50 50 46 50 50 40 51 46 27 46 34 43 46 46 46 49 51 50 50 51 49 51 56 50 31 43 50 40 49 39 56 59 51 49 13 13 18 13 13 13 51 40 49 43 36 50 46 46 49 56 51 46 46 38 27 36 51 49 36 46 40 43 27 34 30 34 24 34 28 44 34 34 30 35 24 30 34 34 14 28 28 10 33 39 43 30 49 43 27 26 24 49 43 13 28 16 13 25 27 24 30 31 18 34 28 18 28 30 24 27 43 24 40 34 25 28 34 24 40 43 21 20 30 17 23 18 17 23 18 16 18 32 17 23 24 18 24 28 17 16 23 12 23 17 23 24 18 28 17 30 43 46 43 46 5 21 32 34 38 30 46 28 49 49 32 16 10 17 18 18 40 38 19 22 18 17 16 10 10 38 15 28 23 10 34 18 11 18 32 23 37 39 30 27 29 29 43 14 30 16 15 16 18 34 45 30 36 43 43 43 43 51 59 56 45 34 29 17 38 19 31 28 13 17 11 16 12 13 17 17 30 13 13 10 24 15 22 14 13 11 18 15 18 13 18 10 10 11 18 12 19 13 18 14 39 13 7 8 12 17 8 14 23 10 10 13 30 24 14 8 15 32 19 10 20 18 14 7 10 15 14 10 10 10 19 15 11 29 32 32 30 15 15 24 10 30 25 28 22 27 14 24 26 20 18 14 11 15 8 14 22 9 14 20 14 13 20 15 10 22 21 34 26 16 13 23 21 14 10 23 8 23 13 13 16 10 24 23 12 12 17 15 14 14 11 14 20 26 24 11 14 14 23 41 24 11 10 17 24 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_33190713_33191614
seq2: B6Ng01-336O24.b_47_954

seq1  GAATTCTTTCAGTCCATATGTTTAGTAAGCACCTATTATCAGCACATTTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTCAGTCCATATGTTTAGTAAGCACCTATTATCAGCACATTTT  50

seq1  GGACACAAAAACTCGAGAGACATGTCAGGTCCTGTCCCTAGGTTCATCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACACAAAAACTCGAGAGACATGTCAGGTCCTGTCCCTAGGTTCATCCT  100

seq1  CCAGTGCAGGAAACAGTGATAAAGCAGGTCACACAGCAATGTTATATCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTGCAGGAAACAGTGATAAAGCAGGTCACACAGCAATGTTATATCAA  150

seq1  GTAGTAACTGTTGTTCTGAAAAGCACAAGCAGGAGGAGAGCGATGACGGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGTAACTGTTGTTCTGAAAAGCACAAGCAGGAGGAGAGCGATGACGGC  200

seq1  CCTGTCAGCCCAGGCAAGCCTCACAGAGGACGATGGAAACACAGAGAGGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGTCAGCCCAGGCAAGCCTCACAGAGGACGATGGAAACACAGAGAGGC  250

seq1  TGAGGACACAGCGAGGCTGAGGCTGGAGGCTGTGAGAGTGGATTGGAAAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGACACAGCGAGGCTGAGGCTGGAGGCTGTGAGAGTGGATTGGAAAT  300

seq1  ATGGCTAGAATATAGCTGCAGAGGCAAGGAAGGGGCAGGAGAAGACATGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCTAGAATATAGCTGCAGAGGCAAGGAAGGGGCAGGAGAAGACATGG  350

seq1  CCAGACTCTAGGGCAGGATACTGCAGGCCTCAGGAGTAAGGCTGGAGCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGACTCTAGGGCAGGATACTGCAGGCCTCAGGAGTAAGGCTGGAGCAA  400

seq1  TGAGCCATTGGAATGAGAACTGACTGTTGTTTAAGATTTATTTTAAAGTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCCATTGGAATGAGAACTGACTGTTGTTTAAGATTTATTTTAAAGTA  450

seq1  TGTGTGTGGGGGCAGGGTAGGGGGGTATTCCTATAGAAGCCAGAGAGTTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGTGGGGGCAGGGTAGGGGGGTATTCCTATAGAAGCCAGAGAGTTG  500

seq1  GGTTTCCAGGTACTAGAGTTACAGAGAGTTGTGAACTAGCCACCTGACAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTCCAGGTACTAGAGTTACAGAGAGTTGTGAACTAGCCACCTGACAC  550

seq1  GGGTACAGGAACAGAACTTAAATCCTCTACAAAAGTGATGCACACTTTAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTACAGGAACAGAACTTAAATCCTCTACAAAAGTGATGCACACTTTAA  600

seq1  CCTCTTAACTACTGTGCCATCTCTCCAGAACTTTTAGACATACTGAAGGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTAACTACTGTGCCATCTCTCCAGAACTTTTAGACATACTGAAGGC  650

seq1  TCTCTCTGCAGAGCCTGACTAAATGAATATGGAAGCCCAAGATGGCACAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTGCAGAGCCTGACTAAATGAATATGGAAGCCCAAGATGGCACAG  700

seq1  CTGCAAAGTGT-GGATCATTGGCATGGCCCTGTAGTTGGCATGGATCCTC  749
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  CTGCAAAGTGTGGGATCATTGGCATGGCCCTGTAGTTGGCATGGATCCTC  750

seq1  CATACAGTGGGAGACCAGAAAGAAGTGGGCATGTCAAGGAACAGCCAATG  799
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  CATACAGTGGGAGACCAGAGAGAAGTGGGCATGTCAAGGAACAGCCAATG  800

seq1  CTCTGCAGAGAAACACAGCCCTTGGAACAG-TTCTCAAAATCAGGCTTGA  848
      |||||||||||||||||||||||||||||| |||||||||||| ||||||
seq2  CTCTGCAGAGAAACACAGCCCTTGGAACAGTTTCTCAAAATCACGCTTGA  850

seq1  AGTCACCCAGTG-CCAGCATTCCCCAAGGGAA--GGAAGCA-TTATGGGA  894
      |||||||||||| |||||||||||||||||||  | ||||| ||||||||
seq2  AGTCACCCAGTGCCCAGCATTCCCCAAGGGAAAGGAAAGCATTTATGGGA  900

seq1  TGCCAGCT  902
      ||||||||
seq2  TGCCAGCT  908

seq1: chr2_33286546_33287264
seq2: B6Ng01-336O24.g_69_787 (reverse)

seq1  CAGGGCAGCTGCCCCGGG-TCG-CCACCCCTCGGGGCCAAGCGCCTGGCC  48
      |||||||| ||||||||| ||| ||||||||||||||||||| ||| |||
seq2  CAGGGCAGATGCCCCGGGTTCGCCCACCCCTCGGGGCCAAGCCCCT-GCC  49

seq1  TCCGGCAGGTGCCCGGGCCTCAAGACCCCGCCCGGCCGGCCCCGACACTG  98
      ||||||||||||||||||||||||| ||||||| |||| ||| |||||||
seq2  TCCGGCAGGTGCCCGGGCCTCAAGA-CCCGCCCAGCCGACCCTGACACTG  98

seq1  ACCAGGCAGCCTCTCCCCCGTCCCGCCGCGCTCACGGGGGAGGTCGGACA  148
      |||||||||||||||||||||||||||| |||||||| ||||||||||||
seq2  ACCAGGCAGCCTCTCCCCCGTCCCGCCGAGCTCACGGAGGAGGTCGGACA  148

seq1  GCCGCCCCACGGGTCGCCCCGACCCTGCCGCCTCTGCCCGCAGCCCGCCA  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCGCCCCACGGGTCGCCCCGACCCTGCCGCCTCTGCCCGCAGCCCGCCA  198

seq1  GCCTCACCTGGGCCGCGCGCCGCGTTCACATCGCCCGCCCGCGGCGCCCC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCACCTGGGCCGCGCGCCGCGTTCACATCGCCCGCCCGCGGCGCCCC  248

seq1  CTCCGCCGCCGCCGCCGCCGGCGCCAGGCCCTTCCCCGCCGCTCCCGCTG  298
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  CTCCGCCGCCGCCGCCGCCGGCGCCAGGCCATTCCCCGCCGCTCCCGCTG  298

seq1  CCGCCCCTGCCCGCGCCCCCCGCCCCCGGAAGCGCTTCCAGGCCCCGCCC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGCCCCTGCCCGCGCCCCCCGCCCCCGGAAGCGCTTCCAGGCCCCGCCC  348

seq1  CCTCGGCGCCCGCGCTTCCGGGCAGGCGCGGACCCGGGCGGGTGTCGATA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCGGCGCCCGCGCTTCCGGGCAGGCGCGGACCCGGGCGGGTGTCGATA  398

seq1  TGGCCGGACTTCTCGCGGCGGGCCGGTCGGAATCCCAGCTCCTGGCTAGT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCGGACTTCTCGCGGCGGGCCGGTCGGAATCCCAGCTCCTGGCTAGT  448

seq1  GCTGCAGGCCGACCAGTAGACGGGCGGGTAGCTGAACAGCAACCCGGGTT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCAGGCCGACCAGTAGACGGGCGGGTAGCTGAACAGCAACCCGGGTT  498

seq1  TGGAGCCTGAAATCCCGACTCTGCGGCCCGTGGCCTTCCGCCCGCCTTCT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGCCTGAAATCCCGACTCTGCGGCCCGTGGCCTTCCGCCCGCCTTCT  548

seq1  CCTTGGCTCCACCTGCTGGCCGGAGCAGGACTCGACCGTGTGCACCCGGA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGGCTCCACCTGCTGGCCGGAGCAGGACTCGACCGTGTGCACCCGGA  598

seq1  CCCTAAGCCTGTGGAAAGCCCCACACCTACGACCTGCTAAGCCATGCTTT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTAAGCCTGTGGAAAGCCCCACACCTACGACCTGCTAAGCCATGCTTT  648

seq1  TTAAGTTCTTTATTTCTATTTTTATTATTTTAGGGTCTTGCCTTGAGACA  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGTTCTTTATTTCTATTTTTATTATTTTAGGGTCTTGCCTTGAGACA  698

seq1  AGGTCTTAAAAAACAGAATTC  719
      |||||||||||||||||||||
seq2  AGGTCTTAAAAAACAGAATTC  719

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information