MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-341D04
Chromosome	2 (Build37)
Map Location	120,168,016 - 120,168,946
singlet/doublet	singlet
Overlap gene	Vps39
Upstream gene	Chac1, Inoc1, LOC100043612, Exdl1, 1500003O03Rik, LOC100043307, Oip5, Nusap1, Ndufaf1, LOC625328, LOC100043622, Rtf1, Itpka, Ltk, Rpap1, Tyro3, 6330405D24Rik, LOC625403, Mga, Mapkbp1, Pla2g4b, Spnb5, Ehd4, Pla2g4e, LOC100043635, Pla2g4d, Pla2g4f
Downstream gene	Tmem87a, Ganc, Capn3, Zfp106, Snap23, Lrrc57, Cep27, Stard9, Cdan1, Ttbk2, Ubr1, Tmem62, Rnu3b-ps2, Ccndbp1, Epb4.2, Tgm5, LOC640543, Lcmt2, Adal, Zscan29, D2Ertd435e, Trp53bp1, Mtap1a, Hisppd2a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Chac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69065 MGI:1916315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inoc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68142 MGI:1915392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs

name	Exdl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241624 MGI:3045306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500003O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56398 MGI:1927185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043307 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs

name	Oip5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70645 MGI:1917895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nusap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108907 MGI:2675669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ndufaf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69702 MGI:1916952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 1433 ESTs, 27 Proteins

name	LOC100043622 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 141 ESTs, 1 Protein pseudo : _no_value

name	Rtf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76246 MGI:1309480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs, 5 Proteins

name	Itpka (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228550 MGI:1333822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17005 MGI:96840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Rpap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68925 MGI:1916175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tyro3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22174 MGI:104294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330405D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70715 MGI:1917965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	LOC625403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 7 Proteins pseudo : _no_value

name	Mga (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29808 MGI:1352483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapkbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26390 MGI:1347004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211429 MGI:2384819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spnb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640524 MGI:2685200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 22 Proteins

name	Ehd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98878 MGI:1919619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329502 MGI:1919144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043635 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Pla2g4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78390 MGI:1925640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271844 MGI:2685493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269338 MGI:2443189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem87a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211499 MGI:2441844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ganc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76051 MGI:1923301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12335 MGI:107437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20402 MGI:1270153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snap23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20619 MGI:109356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66606 MGI:1913856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cep27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66296 MGI:1913546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stard9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668880 MGI:3045258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 46 ESTs, 4 Proteins

name	Cdan1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68968 MGI:1916218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttbk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ubr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22222 MGI:1277977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:96957 MGI:2139461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu3b-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19853 MGI:97980
definition	note : U3B small nuclear RNA pseudogene 2 pseudo : _no_value

name	Ccndbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17151 MGI:109595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epb4.2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13828 MGI:95402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74176 MGI:1921426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC640543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	Lcmt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329504 MGI:1353659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 41 ESTs, 5 Proteins

name	Adal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75894 MGI:1923144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99334 MGI:2139317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 10 Proteins

name	D2Ertd435e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51885 MGI:1196293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp53bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27223 MGI:1351320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17754 MGI:1306776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hisppd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327655 MGI:2443281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385952 GeneID:69065 MGI:1916315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ChaC, cation transport regulator-like 1 (E. coli) transcript_id : NM_026929.3

name	Inoc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129872 GeneID:68142 MGI:1915392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : INO80 complex homolog 1 (S. cerevisiae) transcript_id : NM_026574.3

name	LOC100043612 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250056 GeneID:100043612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs product : hypothetical protein LOC100043612 transcript_id : XM_001480350.1

name	Exdl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351361 GeneID:241624 MGI:3045306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vexonuclease 3'-5' domain-like 1 transcript_id : NM_172857.2

name	1500003O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120319 GeneID:56398 MGI:1927185
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500003O03 gene transcript_id : NM_019769.3

name	LOC100043307 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249967 GeneID:100043307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs product : hypothetical protein LOC100043307 transcript_id : XM_001479922.1

name	Oip5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120324 GeneID:70645 MGI:1917895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Opa interacting protein 5 transcript_id : NM_001042653.1

name	Nusap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111118997 GeneID:108907 MGI:2675669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar and spindle associated protein 1 transcript_id : NM_133851.3

name	Nusap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111118995 GeneID:108907 MGI:2675669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar and spindle associated protein 1 transcript_id : NM_001042652.1

name	Ndufaf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803171 GeneID:69702 MGI:1916952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 transcript_id : NM_027175.3

name	LOC625328 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250064 GeneID:625328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1433 ESTs, 27 Proteins product : similar to H3 histone, family 3A transcript_id : XM_889893.3

name	Rtf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250062 GeneID:76246 MGI:1309480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs, 5 Proteins product : Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) transcript_id : XM_283757.7

name	Itpka (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130226 GeneID:228550 MGI:1333822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-trisphosphate 3-kinase A transcript_id : NM_146125.2

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935378 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_206942.1

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935372 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_203345.1

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935374 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_008523.2

name	Ltk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45935376 GeneID:17005 MGI:96840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte tyrosine kinase transcript_id : NM_206941.1

name	Rpap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144445948 GeneID:68925 MGI:1916175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase II associated protein 1 transcript_id : NM_177294.4

name	Tyro3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68989242 GeneID:22174 MGI:104294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TYRO3 protein tyrosine kinase 3 transcript_id : NM_019392.2

name	6330405D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249970 GeneID:70715 MGI:1917965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : RIKEN cDNA 6330405D24 gene transcript_id : XM_917516.3

name	Mga (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444913 GeneID:29808 MGI:1352483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAX gene associated transcript_id : NM_013720.2

name	Mapkbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037374 GeneID:26390 MGI:1347004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase binding protein 1 transcript_id : NM_011941.2

name	Pla2g4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249336 GeneID:211429 MGI:2384819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVB (cytosolic) transcript_id : NM_145378.2

name	Spnb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249972 GeneID:640524 MGI:2685200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 22 Proteins product : spectrin beta 5 transcript_id : XM_001481329.1

name	Ehd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803304 GeneID:98878 MGI:1919619
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EH-domain containing 4 transcript_id : NM_133838.3

name	Pla2g4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861233 GeneID:329502 MGI:1919144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVE transcript_id : NM_177845.4

name	LOC100043635 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250067 GeneID:100043635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043635 transcript_id : XM_001480419.1

name	Pla2g4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906182 GeneID:78390 MGI:1925640
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVD transcript_id : NM_001024137.1

name	Pla2g4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972422 GeneID:271844 MGI:2685493
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVF transcript_id : NM_001024145.1

name	Vps39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892962 GeneID:269338 MGI:2443189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 39 (yeast) transcript_id : NM_178851.2

name	Vps39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30578430 GeneID:269338 MGI:2443189
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 39 (yeast) transcript_id : NM_147153.2

name	Tmem87a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343465 GeneID:211499 MGI:2441844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 87A transcript_id : NM_173734.2

name	Ganc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487338 GeneID:76051 MGI:1923301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase, alpha; neutral C transcript_id : NM_172672.2

name	Capn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680843 GeneID:12335 MGI:107437
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 3 transcript_id : NM_007601.1

name	Zfp106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948268 GeneID:20402 MGI:1270153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 106 transcript_id : NM_011743.2

name	Snap23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389019 GeneID:20619 MGI:109356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptosomal-associated protein 23 transcript_id : NM_009222.3

name	Lrrc57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981232 GeneID:66606 MGI:1913856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 57 transcript_id : NM_025657.2

name	Cep27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68299778 GeneID:66296 MGI:1913546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosomal protein 27 transcript_id : NM_025475.2

name	Stard9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249974 GeneID:668880 MGI:3045258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 46 ESTs, 4 Proteins product : START domain containing 9 transcript_id : XM_001004201.2

name	Cdan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430552 GeneID:68968 MGI:1916218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : congenital dyserythropoietic anemia, type I (human) transcript_id : NM_026891.2

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326518 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_080788.3

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326517 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_001024857.2

name	Ttbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326516 GeneID:140810 MGI:2155779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tau tubulin kinase 2 transcript_id : NM_001024856.2

name	Ubr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678490 GeneID:22222 MGI:1277977
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin protein ligase E3 component n-recognin 1 transcript_id : NM_009461.1

name	Tmem62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271525 GeneID:96957 MGI:2139461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 62 transcript_id : NM_175285.3

name	Ccndbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955252 GeneID:17151 MGI:109595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D-type binding-protein 1 transcript_id : NM_010761.2

name	Epb4.2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129920 GeneID:13828 MGI:95402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.2 transcript_id : NM_013513.2

name	Tgm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368844 GeneID:74176 MGI:1921426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transglutaminase 5 transcript_id : NM_028799.2

name	LOC640543 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249976 GeneID:640543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : similar to transglutaminase 7 transcript_id : XM_001479973.1

name	Lcmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94367205 GeneID:329504 MGI:1353659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 41 ESTs, 5 Proteins product : leucine carboxyl methyltransferase 2 transcript_id : XM_141327.6

name	Adal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626055 GeneID:75894 MGI:1923144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenosine deaminase-like transcript_id : NM_029475.1

name	Zscan29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149250076 GeneID:99334 MGI:2139317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 10 Proteins product : zinc finger SCAN domains 29 transcript_id : XM_001480554.1

name	D2Ertd435e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130151 GeneID:51885 MGI:1196293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, ERATO Doi 435, expressed transcript_id : NM_153387.2

name	Trp53bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34852026 GeneID:27223 MGI:1351320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 binding protein 1 transcript_id : NM_013735.2

name	Mtap1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244032 GeneID:17754 MGI:1306776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 1 A transcript_id : NM_032393.1

name	Hisppd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328430 GeneID:327655 MGI:2443281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidine acid phosphatase domain containing 2A transcript_id : NM_178795.3

name	Chac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312195 CCDS:CCDS16601.1 GeneID:69065 MGI:1916315
definition	codon_start : 1 product : ChaC, cation transport regulator-like 1 protein_id : NP_081205.1

name	Inoc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62234443 CCDS:CCDS16602.1 GeneID:68142 MGI:1915392
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : yeast INO80-like protein protein_id : NP_080850.2

name	LOC100043612 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250057 GeneID:100043612
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480400.1

name	Exdl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370298 CCDS:CCDS16603.1 GeneID:241624 MGI:3045306
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : vexonuclease 3'-5' domain-like 1 protein_id : NP_766445.1

name	1500003O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790225 CCDS:CCDS16604.1 GeneID:56398 MGI:1927185
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : calcium binding protein P22 protein_id : NP_062743.1

name	LOC100043307 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249968 GeneID:100043307
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479972.1

name	Oip5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111120325 GeneID:70645 MGI:1917895
definition	codon_start : 1 product : Opa interacting protein 5 protein_id : NP_001036118.1

name	Nusap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527068 CCDS:CCDS16605.1 GeneID:108907 MGI:2675669
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005876 - spindle microtubule [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA] GO_process : GO:0000281 - cytokinesis after mitosis [Evidence ISS]; GO:0040001 - establishment of mitotic spindle localization [Evidence ISS]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0000070 - mitotic sister chromatid segregation [Evidence ISS]; GO:0045840 - positive regulation of mitosis [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1; nucleolar protein ANKT product : nucleolar and spindle associated protein 1 isoform a protein_id : NP_598612.1

name	Nusap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111118996 GeneID:108907 MGI:2675669
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005876 - spindle microtubule [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA] GO_process : GO:0000281 - cytokinesis after mitosis [Evidence ISS]; GO:0040001 - establishment of mitotic spindle localization [Evidence ISS]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0000070 - mitotic sister chromatid segregation [Evidence ISS]; GO:0045840 - positive regulation of mitosis [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2; nucleolar protein ANKT product : nucleolar and spindle associated protein 1 isoform b protein_id : NP_001036117.1

name	Ndufaf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980802 GeneID:69702 MGI:1916952
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : NADH dehydrogenase (ubiquinone) 1 assembly factor 1 product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1 protein_id : NP_081451.3

name	LOC625328 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82886797 GeneID:625328
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894986.1

name	Rtf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250063 GeneID:76246 MGI:1309480
definition	codon_start : 1 product : Rtf1, Paf1/RNA polymerase II complex component, homolog protein_id : XP_283757.6

name	Itpka (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122643 CCDS:CCDS16607.1 GeneID:228550 MGI:1333822
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence TAS]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006020 - myo-inositol metabolism [Evidence IMP] codon_start : 1 note : IP3-kinase A product : inositol 1,4,5-trisphosphate 3-kinase A protein_id : NP_666237.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935379 CCDS:CCDS16609.1 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform C is encoded by transcript variant 3; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform C protein_id : NP_996825.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935373 CCDS:CCDS16608.1 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform D is encoded by transcript variant 4; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform D protein_id : NP_976220.1

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935375 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant 1; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform A protein_id : NP_032549.2 transl_except : (pos:complement(119584032..119584034),aa:Met)

name	Ltk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45935377 GeneID:17005 MGI:96840
definition	EC_number : 2.7.10.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant 2; leukocyte tyrosine kinase receptor product : leukocyte tyrosine kinase isoform B protein_id : NP_996824.1 transl_except : (pos:complement(119584032..119584034),aa:Met)

name	Rpap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537534 CCDS:CCDS16610.1 GeneID:68925 MGI:1916175
definition	GO_component : GO:0030880 - RNA polymerase complex [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : RNA polymerase II associated protein 1 protein_id : NP_796268.2

name	Tyro3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68989243 CCDS:CCDS16611.1 GeneID:22174 MGI:104294
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : TYRO3 protein tyrosine kinase 3 protein_id : NP_062265.2

name	6330405D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249971 GeneID:70715 MGI:1917965
definition	codon_start : 1 product : hypothetical protein LOC70715 protein_id : XP_922609.3

name	Mga (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444914 GeneID:29808 MGI:1352483
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Max dimerization protein 5 product : MAX-interacting protein protein_id : NP_038748.2

name	Mapkbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037375 CCDS:CCDS16612.1 GeneID:26390 MGI:1347004
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007256 - activation of JNKK activity [Evidence IDA] codon_start : 1 exception : mismatches in translation note : JNK-binding protein 1; Jun N-terminal kinase-binding protein 1; Jun N-terminal kinase binding protein 1; mitogen activated protein kinase binding proten 1 product : mitogen activated protein kinase binding protein 1 protein_id : NP_036071.2

name	Pla2g4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249337 GeneID:211429 MGI:2384819
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IEA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : cytosolic phospholipase A2 beta; phospholipase A2 group IVB (cytosolic) product : phospholipase A2, group IVB protein_id : NP_663353.2

name	Spnb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249973 GeneID:640524 MGI:2685200
definition	codon_start : 1 note : overriding stop codons product : similar to beta V spectrin protein_id : XP_001481379.1 transl_except : (pos:complement(119884630..119884632),aa:OTHER)

name	Ehd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981592 CCDS:CCDS16615.1 GeneID:98878 MGI:1919619
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : EH domain containing protein MPAST2 product : EH-domain containing 4 protein_id : NP_598599.2

name	Pla2g4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63999319 CCDS:CCDS16616.1 GeneID:329502 MGI:1919144
definition	EC_number : 3.1.1.4 GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVE product : cytosolic phospholipase A2 epsilon protein_id : NP_808513.2

name	LOC100043635 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250068 GeneID:100043635
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480469.1

name	Pla2g4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906183 CCDS:CCDS16617.1 GeneID:78390 MGI:1925640
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVD product : cytosolic phospholipase A2 delta protein_id : NP_001019308.1

name	Pla2g4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972423 CCDS:CCDS16618.1 GeneID:271844 MGI:2685493
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : phospholipase A2 group IVF product : cytosolic phospholipase A2 zeta protein_id : NP_001019316.1

name	Vps39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30578384 CCDS:CCDS16619.1 GeneID:269338 MGI:2443189
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Vam6/Vps39-like product : vacuolar protein sorting 39 isoform 2 protein_id : NP_849182.1

name	Vps39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164794 GeneID:269338 MGI:2443189
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Vam6/Vps39-like product : vacuolar protein sorting 39 isoform 1 protein_id : NP_671495.1

name	Tmem87a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424573 GeneID:211499 MGI:2441844
definition	codon_start : 1 product : hypothetical protein LOC211499 protein_id : NP_776095.1

name	Ganc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487339 GeneID:76051 MGI:1923301
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004558 - alpha-glucosidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0006006 - glucose metabolism [Evidence IC]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glucosidase, alpha; neutral C protein_id : NP_766260.2

name	Capn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680844 CCDS:CCDS16620.1 GeneID:12335 MGI:107437
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence IDA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030239 - myofibril assembly [Evidence IMP]; GO:0006508 - proteolysis [Evidence IDA]; GO:0006938 - sarcomere alignment [Evidence IMP]; GO:0045214 - sarcomere organization [Evidence IMP] codon_start : 1 exception : mismatches in translation function : intracellular calcium-dependant cysteine proteinase note : skeletal muscle specific calpain p94 product : calpain 3 protein_id : NP_031627.1

name	Zfp106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948269 CCDS:CCDS16621.1 GeneID:20402 MGI:1270153
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0001515 - opioid peptide activity [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SH3-domain binding protein 3 protein_id : NP_035873.2

name	Snap23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678049 CCDS:CCDS16622.1 GeneID:20619 MGI:109356
definition	GO_component : GO:0005792 - microsome [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : synaptosomal-associated protein, 23kD product : synaptosomal-associated protein 23 protein_id : NP_033248.1

name	Lrrc57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981233 CCDS:CCDS16623.1 GeneID:66606 MGI:1913856
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 57 protein_id : NP_079933.2

name	Cep27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539591 CCDS:CCDS16624.1 GeneID:66296 MGI:1913546
definition	codon_start : 1 product : centrosomal protein 27 protein_id : NP_079751.1

name	Stard9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249975 GeneID:668880 MGI:3045258
definition	codon_start : 1 product : START domain containing 9 protein_id : XP_001004201.2

name	Cdan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430553 GeneID:68968 MGI:1916218
definition	GO_process : GO:0006998 - nuclear membrane organization and biogenesis [Evidence TAS] codon_start : 1 product : congenital dyserythropoietic anemia, type I protein_id : NP_081167.2

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906805 CCDS:CCDS16626.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : tau tubulin kinase 2 isoform 1 protein_id : NP_542966.2

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906807 CCDS:CCDS16627.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tau tubulin kinase 2 isoform 2 protein_id : NP_001020027.1

name	Ttbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906809 CCDS:CCDS16627.1 GeneID:140810 MGI:2155779
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3 product : tau tubulin kinase 2 isoform 2 protein_id : NP_001020028.1

name	Ubr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678491 CCDS:CCDS16628.1 GeneID:22222 MGI:1277977
definition	GO_component : GO:0000502 - proteasome complex (sensu Eukaryota) [Evidence IGI]; GO:0000151 - ubiquitin ligase complex [Evidence IGI] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IGI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IGI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IGI]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IMP] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : E3 alpha; ubiquitin-protein ligase e3 componen n-recognin product : ubiquitin protein ligase E3 component n-recognin 1 protein_id : NP_033487.1

name	Tmem62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424948 CCDS:CCDS16629.1 GeneID:96957 MGI:2139461
definition	codon_start : 1 product : transmembrane protein 62 protein_id : NP_780494.1

name	Ccndbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955253 GeneID:17151 MGI:109595
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence TAS] codon_start : 1 note : maternal inhibition of differentiation; stage specific embryonic cDNA-8 product : cyclin D-type binding-protein 1 protein_id : NP_034891.2

name	Epb4.2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305035 CCDS:CCDS16631.1 GeneID:13828 MGI:95402
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0043249 - erythrocyte maturation [Evidence IEA]; GO:0018149 - peptide cross-linking [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 product : erythrocyte protein band 4.2 protein_id : NP_038541.1

name	Tgm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229194 CCDS:CCDS16632.1 GeneID:74176 MGI:1921426
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003810 - protein-glutamine gamma-glutamyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0018149 - peptide cross-linking [Evidence IEA] codon_start : 1 product : transglutaminase 5 protein_id : NP_083075.1

name	LOC640543 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249977 GeneID:640543
definition	codon_start : 1 product : similar to transglutaminase 7 protein_id : XP_001480023.1

name	Lcmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82886834 GeneID:329504 MGI:1353659
definition	codon_start : 1 product : leucine carboxyl methyltransferase 2 protein_id : XP_141327.5

name	Adal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626056 CCDS:CCDS16633.1 GeneID:75894 MGI:1923144
definition	GO_function : GO:0019239 - deaminase activity [Evidence IEA] GO_process : GO:0009168 - purine ribonucleoside monophosphate biosynthesis [Evidence IEA] codon_start : 1 product : adenosine deaminase-like protein_id : NP_083751.1

name	Zscan29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149250077 GeneID:99334 MGI:2139317
definition	codon_start : 1 product : zinc finger protein 690 protein_id : XP_001480604.1

name	D2Ertd435e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943924 CCDS:CCDS16637.1 GeneID:51885 MGI:1196293
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence IEA]; GO:0000922 - spindle pole [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : gamma tubulin ring complex protein protein_id : NP_700436.1

name	Trp53bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34852027 GeneID:27223 MGI:1351320
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0006281 - DNA repair [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : murine p53-binding protein; transformation related protein 53 binding-protein 1 product : transformation related protein 53 binding protein 1 protein_id : NP_038763.2

name	Mtap1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244033 GeneID:17754 MGI:1306776
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007605 - sensory perception of sound [Evidence IDA] codon_start : 1 note : modifier of tubby hearing 1 product : microtubule-associated protein 1 A protein_id : NP_115769.1

name	Hisppd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328431 CCDS:CCDS16639.1 GeneID:327655 MGI:2443281
definition	codon_start : 1 exception : mismatches in translation note : KIAA0377-like product : histidine acid phosphatase domain containing 2A protein_id : NP_848910.2

name	LOC100043622 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250065 GeneID:100043622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 141 ESTs, 1 Protein product : hypothetical protein LOC100043622 pseudo : _no_value transcript_id : XR_034664.1

name	LOC625403 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250066 GeneID:625403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 7 Proteins product : similar to keratinocyate lipid-binding protein pseudo : _no_value transcript_id : XR_034672.1

clone name	MSMg01-355A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-162C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548G19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-191L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222O20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-341D04.b	B6Ng01-341D04.g
ACC	GA124656	GA124657
length	931	591
definition	B6Ng01-341D04.b	B6Ng01-341D04.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccacgaactgcaggtaacgtccactgtgcctgctgtgcaggcagg gtgggagctggcactgtagctagcctcgagcctcctggttagatctagtt agccccggcttgagcctcctggttagatctagttagccccggcttgagcc tcctggttagatctagttaaccccagcttgaggttctccccaggcagaca ctgatgcagagtcctaggcctgcttatttgtgcccacaattccacagcat tcctgcactttatcttgtctcttctaagggaacctttcctgcactttttc cagttcctgggtgatttatattcttattagggtgactcatattgtttatt ggttggttggttttcttttgttattgttttgagacaggatctctaggtag ctctggatttcttggaacttgataatgtagaccaggctggccttgaactc acagaaatctgcctgcctttgcctcccaagtgctagaactaagcccagac cttatttgtattttatttatatagttcttcaagaattgtgctcagcacta acggcagacactattgcatacaccagcagaattttgctgaaaggaccctg atatagctgtctcctgtgaggctatactagtgcctggcaaatacagaagt ggatgctcacagtcatctataggatggaacagagggcccccaatgtagga gctagagaaagtacctaagagctgaaagggtctgcaaccctataggtgga acaacaatatgaactaaccagtacccccgagctcgtgtctctagctgcat atgtagcagaagatggcctagtcagccatcattgggaatagaggcccctt ggtctagcaaacttgatatgccccagtacaggggaacaccagggccaaga ggtgggagtaagtgggtaggggagcagggcg	gaattcaagaaggaagaccatagtgtggattcttcgatccatcttagaag gggggaacaaaacacccatggaaggagttacagagacaaagtgtggagta aagactgaagaaatgaccatccagagactgactcatctggggagccatcc catttacaatcaccaaacccagacactgttgtggatgccaacaagtgctt gctgacaggagcctgatatagctgtctcctgagaggctctgctagtgcct cacaaatacagaggtggatgctcacagccatccattggactgagcatagg gtccccaatgaaggagctagagaaagtacccaaggagctgaaggggtttg cagccccataggaggaacaacaatatgaactagccagtatccccagagct cccagagactaaaccaccaactaaagaacacacatggtgggactcatggc tccagctatatacgcagcagaggatgtcctagtcagacatcaatggggag agaggacctttgttctatgaaggttctatgccccaatgtgggggaatagc agggccaggaagcaggagtgggtgggttgatgagcagggga
quality values	Open. Hide. 58 36 32 32 62 62 33 16 54 62 62 62 62 49 62 62 47 62 62 62 62 62 47 54 54 62 44 59 59 62 62 50 49 56 59 49 38 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 59 59 62 62 62 49 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 41 62 54 62 54 62 62 62 62 49 54 62 62 62 62 62 62 53 62 62 62 31 48 58 58 54 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 54 54 54 58 46 58 45 54 54 58 58 58 58 58 58 54 54 52 58 58 58 54 58 54 42 58 42 54 58 58 58 58 54 58 58 58 58 54 45 58 54 37 58 58 58 58 54 52 54 58 52 52 54 58 58 54 54 54 54 58 54 58 53 54 51 35 58 40 54 50 58 52 58 58 52 52 51 58 58 58 54 58 58 37 58 58 49 50 46 53 40 52 58 58 41 53 58 50 53 39 41 53 53 53 41 39 52 51 39 53 52 52 51 35 53 53 58 50 50 37 29 58 42 49 50 50 35 50 58 36 58 50 50 58 58 58 47 39 53 53 52 34 42 31 42 41 15 50 53 35 40 54 32 47 58 58 38 39 31 30 39 39 32 52 29 58 16 50 53 52 50 58 42 44 54 35 39 45 45 42 37 23 26 33 54 53 53 45 41 32 26 32 49 49 50 30 35 39 32 35 27 6 54 31 31 50 40 47 37 37 39 37 47 41 54 40 37 20 30 33 51 53 51 25 9 54 13 52 45 29 34 39 51 32 32 33 39 41 40 33 34 43 35 30 27 40 29 33 45 36 32 35 33 34 11 53 45 15 45 23 32 52 7 38 29 29 10 31 39 33 26 45 42 24 40 24 29 33 31 31 51 29 25 32 35 29 35 42 24 45 28 40 40 31 30 25 34 32 31 34 34 33 21 30 26 46 29 18 29 46 29 29 21 19 30 33 25 40 40 33 30 23 32 33 32 32 32 46 42 31 38 19 12 13 31 31 15 10 46 24 29 28 31 31 7 35 14 30 26 34 46 26 39 14 31 22 41 18 21 31 41 33 20 22 18 33 38 17 19 8 31 39 27 28 11 9 7	Open. Hide. 62 49 39 47 62 44 44 47 62 62 59 50 49 49 56 45 35 43 59 47 62 62 49 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 54 62 59 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 52 62 62 54 62 62 62 62 62 62 62 62 62 54 58 58 50 58 44 46 49 42 58 54 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 47 54 58 52 58 42 46 54 58 54 39 58 58 58 58 58 58 58 58 58 52 54 58 58 58 42 38 48 58 58 54 58 58 58 58 58 58 46 46 58 58 58 52 58 58 58 58 58 58 51 51 58 51 58 58 52 58 58 54 58 53 51 58 58 58 49 53 54 37 58 58 50 58 58 58 58 50 54 58 41 44 58 58 51 46 58 58 50 58 54 38 49 44 58 49

Alignment Information

BAC End 1

BAC End 2

seq1: chr2_120168016_120168946
seq2: B6Ng01-341D04.b_46_976 (reverse)

seq1  CGCCCTGCTCCCCTACCCACTTACTCCCACCTCTTGGCCCTGGTGTTCCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCCTGCTCCCCTACCCACTTACTCCCACCTCTTGGCCCTGGTGTTCCC  50

seq1  CTGTACTGGGGCATATCAAGTTTGCTAGACCAAGGGGCCTCTATTCCCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTACTGGGGCATATCAAGTTTGCTAGACCAAGGGGCCTCTATTCCCAA  100

seq1  TGATGGCTGACTAGGCCATCTTCTGCTACATATGCAGCTAGAGACACGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGGCTGACTAGGCCATCTTCTGCTACATATGCAGCTAGAGACACGAG  150

seq1  CTCGGGGGTACTGGTTAGTTCATATTGTTGTTCCACCTATAGGGTTGCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGGGGGTACTGGTTAGTTCATATTGTTGTTCCACCTATAGGGTTGCAG  200

seq1  ACCCTTTCAGCTCTTAGGTACTTTCTCTAGCTCCTACATTGGGGGCCCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTTTCAGCTCTTAGGTACTTTCTCTAGCTCCTACATTGGGGGCCCTC  250

seq1  TGTTCCATCCTATAGATGACTGTGAGCATCCACTTCTGTATTTGCCAGGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCCATCCTATAGATGACTGTGAGCATCCACTTCTGTATTTGCCAGGC  300

seq1  ACTAGTATAGCCTCACAGGAGACAGCTATATCAGGGTCCTTTCAGCAAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAGTATAGCCTCACAGGAGACAGCTATATCAGGGTCCTTTCAGCAAAA  350

seq1  TTCTGCTGGTGTATGCAATAGTGTCTGCCGTTAGTGCTGAGCACAATTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGCTGGTGTATGCAATAGTGTCTGCCGTTAGTGCTGAGCACAATTCT  400

seq1  TGAAGAACTATATAAATAAAATACAAATAAGGTCTGGGCTTAGTTCTAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGAACTATATAAATAAAATACAAATAAGGTCTGGGCTTAGTTCTAGC  450

seq1  ACTTGGGAGGCAAAGGCAGGCAGATTTCTGTGAGTTCAAGGCCAGCCTGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGGGAGGCAAAGGCAGGCAGATTTCTGTGAGTTCAAGGCCAGCCTGG  500

seq1  TCTACATTATCAAGTTCCAAGAAATCCAGAGCTACCTAGAGATCCTGTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACATTATCAAGTTCCAAGAAATCCAGAGCTACCTAGAGATCCTGTCT  550

seq1  CAAAACAATAACAAAAGAAAACCAACCAACCAATAAACAATATGAGTCAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAACAATAACAAAAGAAAACCAACCAACCAATAAACAATATGAGTCAC  600

seq1  CCTAATAAGAATATAAATCACCCAGGAACTGGAAAAAGTGCAGGAAAGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAATAAGAATATAAATCACCCAGGAACTGGAAAAAGTGCAGGAAAGGT  650

seq1  TCCCTTAGAAGAGACAAGATAAAGTGCAGGAATGCTGTGGAATTGTGGGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTTAGAAGAGACAAGATAAAGTGCAGGAATGCTGTGGAATTGTGGGC  700

seq1  ACAAATAAGCAGGCCTAGGACTCTGCATCAGTGTCTGCCTGGGGAGAACC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAATAAGCAGGCCTAGGACTCTGCATCAGTGTCTGCCTGGGGAGAACC  750

seq1  TCAAGCTGGGGTTAACTAGATCTAACCAGGAGGCTCAAGCCGGGGCTAAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGCTGGGGTTAACTAGATCTAACCAGGAGGCTCAAGCCGGGGCTAAC  800

seq1  TAGATCTAACCAGGAGGCTCAAGCCGGGGCTAACTAGATCTAACCAGGAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATCTAACCAGGAGGCTCAAGCCGGGGCTAACTAGATCTAACCAGGAG  850

seq1  GCTCGAGGCTAGCTACAGTGCCAGCTCCCACCCTGCCTGCACAGCAGGCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCGAGGCTAGCTACAGTGCCAGCTCCCACCCTGCCTGCACAGCAGGCA  900

seq1  CAGTGGACGTTACCTGCAGTTCGTGGAATTC  931
      |||||||||||||||||||||||||||||||
seq2  CAGTGGACGTTACCTGCAGTTCGTGGAATTC  931

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information