MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-498P07
Chromosome	2 (Build37)
Map Location	25,448,540 - 25,448,676
singlet/doublet	singlet
Overlap gene	B230208H17Rik
Upstream gene	LOC664938, Cacna1b, Ehmt1, Arrdc1, Zmynd19, Wdr85, Mrpl41, Pnpla7, Nelf, Entpd8, Noxa1, Nrarp, A830007P12Rik, A730008L03Rik, 4933433C11Rik, BC061039, Tubb2c, Slc34a3, Gm757, 2310002J15Rik, Rnf208, LOC100039232, Ndor1, C730025P13Rik, C430004E15Rik, Ssna1, Anapc2, 4930571C24Rik, BC004853, Grin1, Man1b1, Dpp7, Uap1l1, 2010317E24Rik, Entpd2, Npdc1, Fut7, Abca2, Clic3, BC029214, Ptgds, EG665070, Lcn12, C8g, Fbxw5, Traf2, Edf1, Mamdc4, Phpt1, Gm996, LOC100039887
Downstream gene	4921530D09Rik, Tmem141, Fcna, Lcn8, Lcn5, LOC620709, Lcn10, Lcn13, Bmyc, LOC383678, Lcn3, Lcn11, LOC620858, Glt6d1, Lcn9, Sohlh1, Kcnt1, Camsap1, LOC100040100, LOC665199, Ubadc1, Btbd14a, C330006A16Rik, Lhx3, Qscn6l1, C030048H21Rik, 4932418E24Rik, Gpsm1, D2Bwg1335e, Card9, Snapc4, Sdccag3, Pmpca, Inpp5e, AU024582, Notch1, Egfl7
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC664938 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 39 ESTs, 4 Proteins pseudo : _no_value

name	Cacna1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ehmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77683 MGI:1924933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Arrdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215705 MGI:2446136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmynd19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67187 MGI:1914437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr85 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67228 MGI:1914478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107733 MGI:1333816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnpla7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241274 MGI:2385325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nelf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56876 MGI:1861755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Entpd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72090 MGI:1919340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Noxa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:241275 MGI:2449980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrarp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67122 MGI:1914372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830007P12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227612 MGI:2442720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730008L03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58202 MGI:1931035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933433C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74472 MGI:1921722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins

name	BC061039 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68222 MGI:3605773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubb2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227613 MGI:1915472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc34a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:142681 MGI:2159410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm757 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329360 MGI:2685603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310002J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67859 MGI:1915109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf208 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68846 MGI:1916096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein

name	Ndor1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78797 MGI:1926047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	C730025P13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227615 MGI:2443597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C430004E15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97031 MGI:2139535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68475 MGI:1915725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anapc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99152 MGI:2139135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930571C24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78217 MGI:1925467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	BC004853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227618 MGI:2385129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14810 MGI:95819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227619 MGI:2684954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83768 MGI:1933213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uap1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227620 MGI:2443318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010317E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72080 MGI:1919330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Entpd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12496 MGI:1096863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18146 MGI:1099802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fut7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14347 MGI:107692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11305 MGI:99606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clic3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69454 MGI:1916704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC029214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227622 MGI:2442831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptgds (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19215 MGI:99261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665070 MGI:3648573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lcn12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77701 MGI:1924951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C8g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69379 MGI:88237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30839 MGI:1354731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22030 MGI:101835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59022 MGI:1891227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mamdc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381352 MGI:2685841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75454 MGI:1922704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm996 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381353 MGI:2685842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	B230208H17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227624 MGI:2442633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921530D09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77058 MGI:1924308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	Tmem141 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51875 MGI:1098773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14133 MGI:1340905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78076 MGI:2135945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13863 MGI:1277241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC620709 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	Lcn10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332578 MGI:1925000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227627 MGI:2387617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmyc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107771 MGI:88184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383678 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Lcn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16820 MGI:102669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227630 MGI:2684955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	LOC620858 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Glt6d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71103 MGI:1918353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77704 MGI:1924954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sohlh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227631 MGI:2684956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227632 MGI:1924627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camsap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227634 MGI:3036242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 217 ESTs, 3 Proteins

name	LOC100040100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	LOC665199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ubadc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98766 MGI:1920995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd14a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67991 MGI:1915241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	C330006A16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109299 MGI:1924939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 81 ESTs

name	Lhx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16871 MGI:102673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qscn6l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227638 MGI:2387194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030048H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77481 MGI:1924731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 19 ESTs

name	4932418E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329366 MGI:3045295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpsm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67839 MGI:1915089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D2Bwg1335e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52838 MGI:106559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Card9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332579 MGI:2685628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Snapc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227644 MGI:2443935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdccag3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68112 MGI:1915362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pmpca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66865 MGI:1918568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inpp5e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64436 MGI:1927753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU024582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227648 MGI:2139207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Notch1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18128 MGI:97363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egfl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353156 MGI:2449923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Cacna1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225365 GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, N type, alpha 1B subunit transcript_id : NM_007579.2

name	Cacna1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225367 GeneID:12287 MGI:88296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, N type, alpha 1B subunit transcript_id : NM_001042528.1

name	Ehmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369397 GeneID:77683 MGI:1924933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : euchromatic histone methyltransferase 1 transcript_id : NM_172545.2

name	Ehmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60302889 GeneID:77683 MGI:1924933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : euchromatic histone methyltransferase 1 transcript_id : NM_001012518.1

name	Arrdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341544 GeneID:215705 MGI:2446136
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin domain containing 1 transcript_id : NM_178408.2

name	Zmynd19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364884 GeneID:67187 MGI:1914437
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYND domain containing 19 transcript_id : NM_026021.2

name	Wdr85 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369415 GeneID:67228 MGI:1914478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD40 repeat domain 85 transcript_id : NM_026044.2

name	Mrpl41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461979 GeneID:107733 MGI:1333816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L41 transcript_id : NM_001031808.2

name	Pnpla7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345054 GeneID:241274 MGI:2385325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patatin-like phospholipase domain containing 7 transcript_id : NM_146251.3

name	Nelf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476081 GeneID:56876 MGI:1861755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nasal embryonic LHRH factor transcript_id : NM_001039386.1

name	Nelf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476085 GeneID:56876 MGI:1861755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nasal embryonic LHRH factor transcript_id : NM_020276.3

name	Nelf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476078 GeneID:56876 MGI:1861755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nasal embryonic LHRH factor transcript_id : NM_001039387.1

name	Entpd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821697 GeneID:72090 MGI:1919340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 8 transcript_id : NM_028093.1

name	Noxa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802449 GeneID:241275 MGI:2449980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADPH oxidase activator 1 transcript_id : NM_172204.3

name	Nrarp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815819 GeneID:67122 MGI:1914372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch-regulated ankyrin repeat protein transcript_id : NM_025980.2

name	A830007P12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370326 GeneID:227612 MGI:2442720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830007P12 gene transcript_id : NM_146115.3

name	A730008L03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946737 GeneID:58202 MGI:1931035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730008L03 gene transcript_id : NM_021393.1

name	4933433C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249232 GeneID:74472 MGI:1921722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins product : RIKEN cDNA 4933433C11 gene, transcript variant 1 transcript_id : XM_130141.5

name	BC061039 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802505 GeneID:68222 MGI:3605773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC061039 transcript_id : NM_026624.2

name	Tubb2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165383 GeneID:227613 MGI:1915472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, beta 2c transcript_id : NM_146116.1

name	Slc34a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252793 GeneID:142681 MGI:2159410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 34 (sodium phosphate), member 3 transcript_id : NM_080854.1

name	Gm757 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803138 GeneID:329360 MGI:2685603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 757, (NCBI) transcript_id : NM_001033410.2

name	2310002J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353513 GeneID:67859 MGI:1915109
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310002J15 gene transcript_id : NM_026415.2

name	Rnf208 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119395755 GeneID:68846 MGI:1916096
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 208 transcript_id : NM_176834.2

name	LOC100039232 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249222 GeneID:100039232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 1 Protein product : similar to ring finger protein 183 transcript_id : XM_001472503.1

name	Ndor1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723292 GeneID:78797 MGI:1926047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADPH dependent diflavin oxidoreductase 1 transcript_id : NM_001082476.1

name	C730025P13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001544 GeneID:227615 MGI:2443597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730025P13 gene transcript_id : NM_177344.3

name	C430004E15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129853 GeneID:97031 MGI:2139535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C430004E15 gene transcript_id : NM_175286.3

name	Ssna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311553 GeneID:68475 MGI:1915725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sjogren's syndrome nuclear autoantigen 1 transcript_id : NM_023464.2

name	Anapc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803257 GeneID:99152 MGI:2139135
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anaphase promoting complex subunit 2 transcript_id : NM_175300.3

name	4930571C24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366279 GeneID:78217 MGI:1925467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930571C24 gene transcript_id : XM_884900.2

name	BC004853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122636 GeneID:227618 MGI:2385129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC004853 transcript_id : NM_146117.1

name	Grin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680094 GeneID:14810 MGI:95819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA1 (zeta 1) transcript_id : NM_008169.1

name	Man1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71534294 GeneID:227619 MGI:2684954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase, alpha, class 1B, member 1 transcript_id : NM_001029983.1

name	Dpp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981424 GeneID:83768 MGI:1933213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidylpeptidase 7 transcript_id : NM_031843.2

name	Uap1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383016 GeneID:227620 MGI:2443318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 transcript_id : NM_001033293.2

name	2010317E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487324 GeneID:72080 MGI:1919330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010317E24 gene transcript_id : NM_001081085.1

name	Entpd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753347 GeneID:12496 MGI:1096863
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 2 transcript_id : NM_009849.1

name	Npdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130668 GeneID:18146 MGI:1099802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neural proliferation, differentiation and control gene 1 transcript_id : NM_008721.3

name	Fut7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129912 GeneID:14347 MGI:107692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosyltransferase 7 transcript_id : NM_013524.2

name	Abca2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225378 GeneID:11305 MGI:99606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 2 transcript_id : NM_007379.2

name	Clic3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375574 GeneID:69454 MGI:1916704
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride intracellular channel 3 transcript_id : NM_027085.2

name	BC029214 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956329 GeneID:227622 MGI:2442831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC029214 transcript_id : NM_153557.1

name	Ptgds (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226207 GeneID:19215 MGI:99261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin D2 synthase (brain) transcript_id : NM_008963.2

name	EG665070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366287 GeneID:665070 MGI:3648573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG665070 transcript_id : XM_974333.1

name	Lcn12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037498 GeneID:77701 MGI:1924951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 12 transcript_id : NM_029958.1

name	C8g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037158 GeneID:69379 MGI:88237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 8, gamma subunit transcript_id : NM_027062.1

name	Fbxw5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351961 GeneID:30839 MGI:1354731
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 5 transcript_id : NM_013908.3

name	Traf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921632 GeneID:22030 MGI:101835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 2 transcript_id : NM_009422.2

name	Edf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946941 GeneID:59022 MGI:1891227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial differentiation-related factor 1 transcript_id : NM_021519.1

name	Mamdc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487084 GeneID:381352 MGI:2685841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAM domain containing 4 transcript_id : NM_001081199.1

name	Phpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130568 GeneID:75454 MGI:1922704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphohistidine phosphatase 1 transcript_id : NM_029293.2

name	Gm996 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53749207 GeneID:381353 MGI:2685842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 996, (NCBI) transcript_id : NM_001005424.1

name	LOC100039887 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249236 GeneID:100039887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039887 transcript_id : XM_001474393.1

name	B230208H17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986572 GeneID:227624 MGI:2442633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230208H17 gene transcript_id : NM_001024616.1

name	4921530D09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249238 GeneID:77058 MGI:1924308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : RIKEN cDNA 4921530D09 gene transcript_id : XM_974596.2

name	Tmem141 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387859 GeneID:51875 MGI:1098773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 141 transcript_id : NM_001040130.2

name	Fcna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982365 GeneID:14133 MGI:1340905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ficolin A transcript_id : NM_007995.2

name	Lcn8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14994307 GeneID:78076 MGI:2135945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 8 transcript_id : NM_033145.1

name	Lcn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835734 GeneID:13863 MGI:1277241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 5 transcript_id : NM_001042630.1

name	Lcn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835736 GeneID:13863 MGI:1277241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 5 transcript_id : NM_007947.2

name	LOC620709 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94366291 GeneID:620709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to lipocalin 6 transcript_id : XM_885099.2

name	Lcn10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803496 GeneID:332578 MGI:1925000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 10 transcript_id : NM_178036.3

name	Lcn13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956341 GeneID:227627 MGI:2387617
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 13 transcript_id : NM_153558.1

name	Bmyc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83035028 GeneID:107771 MGI:88184
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain expressed myelocytomatosis oncogene transcript_id : NM_023326.2

name	LOC383678 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249242 GeneID:383678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel lipocalin protein transcript_id : XM_357181.4

name	Lcn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754513 GeneID:16820 MGI:102669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 3 transcript_id : NM_010694.1

name	Lcn11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366296 GeneID:227630 MGI:2684955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : lipocalin 11 transcript_id : XM_130103.4

name	LOC620858 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249226 GeneID:620858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC620858 transcript_id : XM_001472746.1

name	Glt6d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875494 GeneID:71103 MGI:1918353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycosyltransferase 6 domain containing 1 transcript_id : NM_001039095.1

name	Lcn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368163 GeneID:77704 MGI:1924954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipocalin 9 transcript_id : NM_029959.2

name	Sohlh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48762517 GeneID:227631 MGI:2684956
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis and oogenesis specific basic helix-loop-helix 1 transcript_id : NM_001001714.1

name	Kcnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73611941 GeneID:227632 MGI:1924627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily T, member 1 transcript_id : NM_175462.3

name	Camsap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249246 GeneID:227634 MGI:3036242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 217 ESTs, 2 Proteins product : calmodulin regulated spectrin-associated protein 1 transcript_id : XM_975192.2

name	LOC100040100 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149249248 GeneID:100040100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : hypothetical protein LOC100040100 transcript_id : XM_001474832.1

name	Ubadc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527049 GeneID:98766 MGI:1920995
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin associated domain containing 1 transcript_id : NM_133835.1

name	Btbd14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80861478 GeneID:67991 MGI:1915241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 14A transcript_id : NM_026495.3

name	Btbd14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80861476 GeneID:67991 MGI:1915241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 14A transcript_id : NM_001037098.1

name	C330006A16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94366305 GeneID:109299 MGI:1924939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 81 ESTs product : RIKEN cDNA C330006A16 gene transcript_id : XM_358556.5

name	Lhx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89001115 GeneID:16871 MGI:102673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 3 transcript_id : NM_001039653.1

name	Qscn6l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130105 GeneID:227638 MGI:2387194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : quiescin Q6-like 1 transcript_id : NM_153559.2

name	C030048H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149249228 GeneID:77481 MGI:1924731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 19 ESTs product : RIKEN cDNA C030048H21 gene transcript_id : XM_975397.2

name	4932418E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351965 GeneID:329366 MGI:3045295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932418E24 gene transcript_id : NM_177841.3

name	Gpsm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351775 GeneID:67839 MGI:1915089
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein signalling modulator 1 (AGS3-like, C. elegans) transcript_id : NM_153410.3

name	D2Bwg1335e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370449 GeneID:52838 MGI:106559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 2, Brigham & Women's Genetics 1335 expressed transcript_id : NM_026828.2

name	Card9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82884281 GeneID:332579 MGI:2685628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : caspase recruitment domain family, member 9, transcript variant 1 transcript_id : XM_285326.4

name	Snapc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361207 GeneID:227644 MGI:2443935
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear RNA activating complex, polypeptide 4 transcript_id : NM_172339.2

name	Sdccag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801709 GeneID:68112 MGI:1915362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serologically defined colon cancer antigen 3 transcript_id : NM_026563.2

name	Pmpca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129895 GeneID:66865 MGI:1918568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidase (mitochondrial processing) alpha transcript_id : NM_173180.3

name	Inpp5e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981235 GeneID:64436 MGI:1927753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-5-phosphatase E transcript_id : NM_033134.2

name	AU024582 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378049 GeneID:227648 MGI:2139207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU024582 transcript_id : NM_153125.2

name	Notch1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543331 GeneID:18128 MGI:97363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch gene homolog 1 (Drosophila) transcript_id : NM_008714.2

name	Egfl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570122 GeneID:353156 MGI:2449923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like domain 7 transcript_id : NM_178444.3

name	Egfl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570126 GeneID:353156 MGI:2449923
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like domain 7 transcript_id : NM_198725.1

name	Egfl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38570124 GeneID:353156 MGI:2449923
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like domain 7 transcript_id : NM_198724.1

name	Cacna1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225366 CCDS:CCDS15739.1 GeneID:12287 MGI:88296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IMP]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007269 - neurotransmitter secretion [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; calcium channel, voltage-dependent, L type, alpha 1B subunit; brain calcium channel III product : calcium channel, voltage-dependent, N type, alpha 1B subunit isoform 2 protein_id : NP_031605.2

name	Cacna1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225368 GeneID:12287 MGI:88296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IMP]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0008217 - blood pressure regulation [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007269 - neurotransmitter secretion [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; calcium channel, voltage-dependent, L type, alpha 1B subunit; brain calcium channel III product : calcium channel, voltage-dependent, N type, alpha 1B subunit isoform 1 protein_id : NP_001035993.1

name	Ehmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60302890 CCDS:CCDS15740.1 GeneID:77683 MGI:1924933
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence ISS]; GO:0016571 - histone methylation [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : euchromatic histone methyltransferase 1 isoform 1 protein_id : NP_001012536.1

name	Ehmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369762 GeneID:77683 MGI:1924933
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence ISS]; GO:0016571 - histone methylation [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : euchromatic histone methyltransferase 1 isoform 2 protein_id : NP_766133.1

name	Arrdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410732 CCDS:CCDS15741.1 GeneID:215705 MGI:2446136
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : arrestin domain containing 1 protein_id : NP_848495.1

name	Zmynd19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385526 CCDS:CCDS15742.1 GeneID:67187 MGI:1914437
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger MYND domain containing 19 product : melanin concentrating hormone receptor interacting zinc finger protein protein_id : NP_080297.1

name	Wdr85 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313066 CCDS:CCDS15743.1 GeneID:67228 MGI:1914478
definition	codon_start : 1 note : novel protein containing WD40 domains product : WD40 repeat domain 85 protein_id : NP_080320.1

name	Mrpl41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461980 CCDS:CCDS15744.1 GeneID:107733 MGI:1333816
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L41 protein_id : NP_001026978.2

name	Pnpla7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542202 GeneID:241274 MGI:2385325
definition	GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 product : patatin-like phospholipase domain containing 7 protein_id : NP_666363.2

name	Nelf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476082 CCDS:CCDS15745.1 GeneID:56876 MGI:1861755
definition	codon_start : 1 note : isoform A is encoded by transcript variant 1; Jacob protein product : nasal embryonic LHRH factor isoform A protein_id : NP_001034475.1

name	Nelf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10190662 CCDS:CCDS15747.1 GeneID:56876 MGI:1861755
definition	codon_start : 1 note : isoform C is encoded by transcript variant 3; Jacob protein product : nasal embryonic LHRH factor isoform C protein_id : NP_064672.2

name	Nelf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476079 CCDS:CCDS15746.1 GeneID:56876 MGI:1861755
definition	codon_start : 1 note : isoform B is encoded by transcript variant 2; Jacob protein product : nasal embryonic LHRH factor isoform B protein_id : NP_001034476.1

name	Entpd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821698 CCDS:CCDS15748.1 GeneID:72090 MGI:1919340
definition	GO_component : GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA] GO_process : GO:0009133 - nucleoside diphosphate biosynthesis [Evidence IDA]; GO:0009124 - nucleoside monophosphate biosynthesis [Evidence IDA] codon_start : 1 product : ectonucleoside triphosphate diphosphohydrolase 8 protein_id : NP_082369.1

name	Noxa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982024 CCDS:CCDS15749.1 GeneID:241275 MGI:2449980
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0016176 - superoxide-generating NADPH oxidase activator activity [Evidence IDA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : NADPH oxidase activator 1 protein_id : NP_757341.2

name	Nrarp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815820 GeneID:67122 MGI:1914372
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : Notch-regulated ankyrin repeat protein protein_id : NP_080256.2

name	A830007P12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981884 CCDS:CCDS15750.1 GeneID:227612 MGI:2442720
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC227612 protein_id : NP_666227.2

name	A730008L03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946738 CCDS:CCDS15751.1 GeneID:58202 MGI:1931035
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : negative elongation factor B product : cofactor of BRCA1 protein_id : NP_067368.1

name	4933433C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249233 GeneID:74472 MGI:1921722
definition	codon_start : 1 product : hypothetical protein LOC74472 isoform 1 protein_id : XP_130141.6

name	BC061039 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311859 CCDS:CCDS15752.1 GeneID:68222 MGI:3605773
definition	codon_start : 1 note : 4931415M17 mRNA product : hypothetical protein LOC68222 protein_id : NP_080900.1

name	Tubb2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165384 CCDS:CCDS15753.1 GeneID:227613 MGI:1915472
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA]; GO:0045298 - tubulin [Evidence NAS] GO_function : GO:0005525 - GTP binding [Evidence NAS] [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 note : novel tubulin protein product : tubulin, beta, 2 protein_id : NP_666228.1

name	Slc34a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252794 CCDS:CCDS15754.1 GeneID:142681 MGI:2159410
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005903 - brush border [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015321 - sodium-dependent phosphate transporter activity [Evidence IDA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sodium-phosphate cotransporter IIC product : type IIc Na+/Pi-cotransporter protein_id : NP_543130.1

name	Gm757 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701917 CCDS:CCDS15755.1 GeneID:329360 MGI:2685603
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC329360 protein_id : NP_001028582.1

name	2310002J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385910 GeneID:67859 MGI:1915109
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67859 protein_id : NP_080691.1

name	Rnf208 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119395756 CCDS:CCDS15757.1 GeneID:68846 MGI:1916096
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 208 protein_id : NP_789804.2

name	LOC100039232 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249223 GeneID:100039232
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472553.1

name	Ndor1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723293 GeneID:78797 MGI:1926047
definition	GO_function : GO:0010181 - FMN binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] codon_start : 1 product : NADPH dependent diflavin oxidoreductase 1 protein_id : NP_001075945.1

name	C730025P13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001545 GeneID:227615 MGI:2443597
definition	codon_start : 1 product : hypothetical protein LOC227615 protein_id : NP_796318.2

name	C430004E15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424950 CCDS:CCDS15759.1 GeneID:97031 MGI:2139535
definition	codon_start : 1 product : hypothetical protein LOC97031 protein_id : NP_780495.1

name	Ssna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963687 GeneID:68475 MGI:1915725
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence IPI] codon_start : 1 product : Sjogren's syndrome nuclear autoantigen 1 protein_id : NP_075953.1

name	Anapc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424970 CCDS:CCDS15761.1 GeneID:99152 MGI:2139135
definition	GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : anaphase-promoting complex subunit 2 protein_id : NP_780509.1

name	4930571C24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82884213 GeneID:78217 MGI:1925467
definition	codon_start : 1 product : hypothetical protein LOC78217 protein_id : XP_889993.1

name	BC004853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122637 CCDS:CCDS15763.1 GeneID:227618 MGI:2385129
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : novel protein containing a tandem array of leucine rich repeats product : hypothetical protein LOC227618 protein_id : NP_666229.1

name	Grin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680095 CCDS:CCDS15764.1 GeneID:14810 MGI:95819
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030425 - dendrite [Evidence ISS]; GO:0030426 - growth cone [Evidence NAS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0017146 - N-methyl-D-aspartate selective glutamate receptor complex [Evidence ISS]; GO:0045211 - postsynaptic membrane [Evidence IDA]; GO:0045202 - synapse [Evidence ISS]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016595 - glutamate binding [Evidence ISS]; GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0016594 - glycine binding [Evidence NAS] [Evidence ISS]; GO:0016933 - glycine-gated ion channel activity [Evidence ISS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence ISS]; GO:0004972 - N-methyl-D-aspartate selective glutamate receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence ISS]; GO:0006812 - cation transport [Evidence ISS]; GO:0007215 - glutamate signaling pathway [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0007611 - learning and/or memory [Evidence ISS]; GO:0048167 - regulation of synaptic plasticity [Evidence ISS]; GO:0045471 - response to ethanol [Evidence NAS]; GO:0007268 - synaptic transmission [Evidence TAS] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : glutamate receptor ionotropic NMDA1 (zeta 1) product : glutamate receptor, ionotropic, NMDA1 (zeta 1) protein_id : NP_032195.1

name	Man1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71534295 CCDS:CCDS15765.1 GeneID:227619 MGI:2684954
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004571 - mannosyl-oligosaccharide 1,2-alpha-mannosidase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030433 - ER-associated protein catabolism [Evidence IMP] codon_start : 1 note : mannosidase alpha class 1B member 1 product : mannosidase, alpha, class 1B, member 1 protein_id : NP_001025154.1

name	Dpp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981425 CCDS:CCDS15766.1 GeneID:83768 MGI:1933213
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : dipeptidyl peptidase 7; dipeptidyl peptidase II product : dipeptidylpeptidase 7 protein_id : NP_114031.2

name	Uap1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794548 CCDS:CCDS15767.1 GeneID:227620 MGI:2443318
definition	GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 protein_id : NP_001028465.1

name	2010317E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487325 GeneID:72080 MGI:1919330
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72080 protein_id : NP_001074554.1

name	Entpd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753348 CCDS:CCDS15770.1 GeneID:12496 MGI:1096863
definition	GO_component : GO:0005605 - basal lamina [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0030168 - platelet activation [Evidence IDA]; GO:0009181 - purine ribonucleoside diphosphate catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : CD39 antigen-like 1 product : ectonucleoside triphosphate diphosphohydrolase 2 protein_id : NP_033979.1

name	Npdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982836 CCDS:CCDS15771.1 GeneID:18146 MGI:1099802
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : neural proliferation differentiation control-1 protein; neural proliferation differentiation and control gene 1 product : neural proliferation, differentiation and control gene 1 protein_id : NP_032747.2

name	Fut7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305073 CCDS:CCDS15772.1 GeneID:14347 MGI:107692
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008417 - fucosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : fucosyltransferase 7 protein_id : NP_038552.1

name	Abca2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225379 CCDS:CCDS15773.1 GeneID:11305 MGI:99606
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005765 - lysosomal membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATP-binding cassette 2; ATP-binding cassette sub-family A (ABC1) member 2 product : ATP-binding cassette, sub-family A (ABC1), member 2 protein_id : NP_031405.2

name	Clic3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229085 CCDS:CCDS15774.1 GeneID:69454 MGI:1916704
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA] codon_start : 1 product : chloride intracellular channel 3 protein_id : NP_081361.1

name	BC029214 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956330 CCDS:CCDS15775.1 GeneID:227622 MGI:2442831
definition	codon_start : 1 product : hypothetical protein LOC227622 protein_id : NP_705785.1

name	Ptgds (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226208 GeneID:19215 MGI:99261
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005576 - extracellular region [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005791 - rough endoplasmic reticulum [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004667 - prostaglandin-D synthase activity [Evidence IEA] [Evidence ISS]; GO:0005501 - retinoid binding [Evidence ISS]; GO:0005215 - transporter activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0001516 - prostaglandin biosynthesis [Evidence IEA] [Evidence ISS]; GO:0045187 - regulation of circadian sleep/wake cycle, sleep [Evidence IDA]; GO:0006810 - transport [Evidence ISS] [Evidence IEA] codon_start : 1 note : prostaglandin D2 synthase (brain) (MGD\|MGI:99261 GB\|NM_008963, evidence: BLASTN, 99%, match=785); putative; lipocalin-type prostaglandin-D synthase; glutathione-independent PGD synthetase; prostaglandin D2 synthase (21 kDa, brain); prostaglandin-H2 D-isomerase product : prostaglandin H2 D-isomerase protein_id : NP_032989.2

name	EG665070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94366288 GeneID:665070 MGI:3648573
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979427.1

name	Lcn12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037499 CCDS:CCDS15776.1 GeneID:77701 MGI:1924951
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lipocalin 12 protein_id : NP_084234.1

name	C8g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037159 CCDS:CCDS15777.1 GeneID:69379 MGI:88237
definition	GO_component : GO:0005579 - membrane attack complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0019841 - retinol binding [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006957 - complement activation, alternative pathway [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0019835 - cytolysis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 note : novel lipocalin protein product : complement component 8, gamma polypeptide protein_id : NP_081338.1

name	Fbxw5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305047 CCDS:CCDS15778.1 GeneID:30839 MGI:1354731
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box protein Fbw5 product : F-box and WD repeat domain containing 5 protein_id : NP_038936.1

name	Traf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921633 CCDS:CCDS15779.1 GeneID:22030 MGI:101835
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence NAS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0030163 - protein catabolism [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0051023 - regulation of immunoglobulin secretion [Evidence IMP]; GO:0046328 - regulation of JNK cascade [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 product : Tnf receptor-associated factor 2 protein_id : NP_033448.2

name	Edf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946942 CCDS:CCDS15780.1 GeneID:59022 MGI:1891227
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : endothelial differentiation-related factor 1 protein_id : NP_067494.1

name	Mamdc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487085 GeneID:381352 MGI:2685841
definition	codon_start : 1 note : probable ortholog of human apical early endosomal glycoprotein precursor (AEGP) product : MAM domain containing 4 protein_id : NP_001074668.1

name	Phpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037409 CCDS:CCDS15781.1 GeneID:75454 MGI:1922704
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008969 - phosphohistidine phosphatase activity [Evidence ISS]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] GO_process : GO:0016311 - dephosphorylation [Evidence ISS] codon_start : 1 product : phosphohistidine phosphatase protein_id : NP_083569.1

name	Gm996 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53749208 GeneID:381353 MGI:2685842
definition	codon_start : 1 product : hypothetical protein LOC381353 protein_id : NP_001005424.1

name	LOC100039887 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249237 GeneID:100039887
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474443.1

name	B230208H17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181302 GeneID:227624 MGI:2442633
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : novel Ras protein product : hypothetical protein LOC227624 protein_id : NP_001019787.2

name	4921530D09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249239 GeneID:77058 MGI:1924308
definition	codon_start : 1 product : hypothetical protein LOC77058 protein_id : XP_979690.2

name	Tmem141 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92110403 GeneID:51875 MGI:1098773
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 141 protein_id : NP_001035219.1

name	Fcna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679763 CCDS:CCDS15785.1 GeneID:14133 MGI:1340905
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : ficolin A protein_id : NP_032021.1

name	Lcn8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14994308 CCDS:CCDS15786.1 GeneID:78076 MGI:2135945
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : lipocalin 5 product : lipocalin 8 protein_id : NP_149157.1

name	Lcn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835735 GeneID:13863 MGI:1277241
definition	GO_component : GO:0005615 - extracellular space [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005501 - retinoid binding [Evidence TAS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0042573 - retinoic acid metabolism [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; MEP 10; epididymal retinoic acid-binding protein; epididymal retinoic acid binding protein product : lipocalin 5 isoform b protein_id : NP_001036095.1

name	Lcn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835737 GeneID:13863 MGI:1277241
definition	GO_component : GO:0005615 - extracellular space [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005501 - retinoid binding [Evidence TAS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0042573 - retinoic acid metabolism [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; MEP 10; epididymal retinoic acid-binding protein; epididymal retinoic acid binding protein product : lipocalin 5 isoform a protein_id : NP_031973.2

name	LOC620709 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82884242 GeneID:620709
definition	codon_start : 1 product : similar to lipocalin 6 protein_id : XP_890192.1

name	Lcn10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794262 CCDS:CCDS15787.1 GeneID:332578 MGI:1925000
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lipocalin protein_id : NP_828875.1

name	Lcn13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956342 CCDS:CCDS15788.1 GeneID:227627 MGI:2387617
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lipocalin 13 protein_id : NP_705786.1

name	Bmyc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83035029 CCDS:CCDS15789.1 GeneID:107771 MGI:88184
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : brain expressed myelocytomatosis oncogene protein_id : NP_075815.2

name	LOC383678 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249243 GeneID:383678
definition	codon_start : 1 product : similar to novel lipocalin protein protein_id : XP_357181.4

name	Lcn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754514 CCDS:CCDS15790.1 GeneID:16820 MGI:102669
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 function : transportation of lipophilic molecules, possible pheromone-carrier product : lipocalin 3 protein_id : NP_034824.1

name	Lcn11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20823096 GeneID:227630 MGI:2684955
definition	codon_start : 1 product : lipocalin 11 protein_id : XP_130103.1

name	LOC620858 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249227 GeneID:620858
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472796.1

name	Glt6d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875495 CCDS:CCDS15791.1 GeneID:71103 MGI:1918353
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : novel glycosyltransferase family 6 protein product : galactosyltransferase family 6 domain containing 1 protein_id : NP_001034184.1

name	Lcn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28933463 CCDS:CCDS15792.1 GeneID:77704 MGI:1924954
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005550 - pheromone binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : MUP-like lipocalin product : lipocalin protein_id : NP_084235.1

name	Sohlh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48762518 CCDS:CCDS15793.1 GeneID:227631 MGI:2684956
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : helix-loop-helix protein NOHLH; novel protein containing a helix-loop-helix DNA binding domain product : spermatogenesis and oogenesis specific basic helix-loop-helix 1 protein_id : NP_001001714.1

name	Kcnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73611942 CCDS:CCDS15794.1 GeneID:227632 MGI:1924627
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015269 - calcium-activated potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium channel subfamily T member 1 product : potassium channel, subfamily T, member 1 protein_id : NP_780671.2

name	Camsap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249247 GeneID:227634 MGI:3036242
definition	codon_start : 1 product : calmodulin regulated spectrin-associated protein 1 protein_id : XP_980286.2

name	LOC100040100 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149249249 GeneID:100040100
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474882.1

name	Ubadc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527050 CCDS:CCDS15795.1 GeneID:98766 MGI:1920995
definition	codon_start : 1 exception : mismatches in translation product : putative glialblastoma cell differentiation-related protein_id : NP_598596.1

name	Btbd14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861479 CCDS:CCDS15796.1 GeneID:67991 MGI:1915241
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : BTB (POZ) domain containing 14A isoform 1 protein_id : NP_080771.3

name	Btbd14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861477 CCDS:CCDS15796.1 GeneID:67991 MGI:1915241
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : BTB (POZ) domain containing 14A isoform 2 protein_id : NP_001032175.1

name	C330006A16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38074580 GeneID:109299 MGI:1924939
definition	codon_start : 1 product : hypothetical protein LOC109299 protein_id : XP_358556.1

name	Lhx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89001116 GeneID:16871 MGI:102673
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : LIM homeo box protein 3 product : LIM homeobox protein 3 protein_id : NP_001034742.1

name	Qscn6l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956334 CCDS:CCDS15798.1 GeneID:227638 MGI:2387194
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0016972 - thiol oxidase activity [Evidence IEA] codon_start : 1 product : quiescin Q6-like 1 protein_id : NP_705787.1

name	C030048H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149249229 GeneID:77481 MGI:1924731
definition	codon_start : 1 product : hypothetical protein LOC77481 protein_id : XP_980491.2

name	4932418E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244424 GeneID:329366 MGI:3045295
definition	codon_start : 1 product : hypothetical protein LOC329366 protein_id : NP_808509.1

name	Gpsm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189378 CCDS:CCDS15800.1 GeneID:67839 MGI:1915089
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : activator of G-protein signaling 3; G-protein signalling modulator 1 (AGS3-like C. elegans) product : G-protein signalling modulator 1 (AGS3-like, C. elegans) protein_id : NP_700459.2

name	D2Bwg1335e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625712 GeneID:52838 MGI:106559
definition	codon_start : 1 product : hypothetical protein LOC52838 protein_id : NP_081104.1

name	Card9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82884282 GeneID:332579 MGI:2685628
definition	codon_start : 1 product : caspase recruitment domain family, member 9 isoform 1 protein_id : XP_285326.4

name	Snapc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27261820 CCDS:CCDS15802.1 GeneID:227644 MGI:2443935
definition	GO_component : GO:0005634 - nucleus [Evidence ISS]; GO:0019185 - snRNA-activating protein complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence ISS] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0042795 - snRNA transcription from RNA polymerase II promoter [Evidence ISS]; GO:0042796 - snRNA transcription from RNA polymerase III promoter [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : small nuclear RNA activating complex, polypeptide 4 protein_id : NP_758842.1

name	Sdccag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311937 CCDS:CCDS15803.1 GeneID:68112 MGI:1915362
definition	codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : serologically defined colon cancer antigen 3 isoform 1 protein_id : NP_080839.1

name	Pmpca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27502349 CCDS:CCDS15804.1 GeneID:66865 MGI:1918568
definition	EC_number : 3.4.24.64 GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004240 - mitochondrial processing peptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mitochondrial matrix processing protease, alpha subunit product : peptidase (mitochondrial processing) alpha protein_id : NP_775272.1

name	Inpp5e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14916467 CCDS:CCDS15805.1 GeneID:64436 MGI:1927753
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IDA]; GO:0004439 - phosphoinositide 5-phosphatase activity [Evidence IDA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : inositol polyphosphate-5-phosphatase, 72 kDa product : inositol polyphosphate-5-phosphatase E protein_id : NP_149125.1

name	AU024582 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378050 GeneID:227648 MGI:2139207
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0004445 - inositol-polyphosphate 5-phosphatase activity [Evidence ISS] codon_start : 1 product : hypothetical protein LOC227648 protein_id : NP_694765.2

name	Notch1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543332 CCDS:CCDS15806.1 GeneID:18128 MGI:97363
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0004623 - phospholipase A2 activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0042640 - anagen [Evidence IMP]; GO:0007409 - axonogenesis [Evidence IDA] [Evidence IMP]; GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0045165 - cell fate commitment [Evidence IMP]; GO:0001708 - cell fate specification [Evidence IMP]; GO:0007386 - compartment specification [Evidence IMP]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0007492 - endoderm development [Evidence IMP]; GO:0008544 - epidermis development [Evidence IGI]; GO:0001837 - epithelial to mesenchymal transition [Evidence IMP]; GO:0030900 - forebrain development [Evidence IGI] [Evidence IMP]; GO:0007440 - foregut morphogenesis [Evidence IMP]; GO:0010001 - glial cell differentiation [Evidence IMP]; GO:0031069 - hair follicle morphogenesis [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030216 - keratinocyte differentiation [Evidence IMP]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0045665 - negative regulation of neuron differentiation [Evidence IMP]; GO:0048663 - neuron fate commitment [Evidence IGI]; GO:0007219 - Notch signaling pathway [Evidence IMP] [Evidence IDA] [Evidence IC]; GO:0043065 - positive regulation of apoptosis [Evidence IGI] [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0050793 - regulation of development [Evidence IEA]; GO:0050678 - regulation of epithelial cell proliferation [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048103 - somatic stem cell division [Evidence IGI] [Evidence IDA]; GO:0002040 - sprouting angiogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : major type A protein; transmembrane receptor Notch1 product : Notch gene homolog 1 protein_id : NP_032740.2

name	Egfl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570123 CCDS:CCDS15807.1 GeneID:353156 MGI:2449923
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence NAS]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0001568 - blood vessel development [Evidence IEP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0001570 - vasculogenesis [Evidence IEP] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant a; vascular endothelial-statin; NEU1 protein product : vascular endothelial statin isoform 1 precursor protein_id : NP_848538.2

name	Egfl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570125 CCDS:CCDS15807.1 GeneID:353156 MGI:2449923
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence NAS]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0001568 - blood vessel development [Evidence IEP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0001570 - vasculogenesis [Evidence IEP] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant b; vascular endothelial-statin; NEU1 protein product : vascular endothelial statin isoform 1 precursor protein_id : NP_942017.1

name	Egfl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38570127 CCDS:CCDS15808.1 GeneID:353156 MGI:2449923
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence NAS]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0001568 - blood vessel development [Evidence IEP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0001570 - vasculogenesis [Evidence IEP] codon_start : 1 note : isoform 2 precursor is encoded by transcript variant c; vascular endothelial-statin; NEU1 protein product : vascular endothelial statin isoform 2 precursor protein_id : NP_942018.1

name	LOC665199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665199
definition	number : 2 pseudo : _no_value

name	LOC665199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665199
definition	number : 1 pseudo : _no_value

name	LOC664938 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149249225 GeneID:664938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 39 ESTs, 4 Proteins product : similar to Wwp1 protein pseudo : _no_value transcript_id : XR_002289.2

clone name	MSMg01-408E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-498P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-217G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-427B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-264J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472F17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-350G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-498P07.T7 (MSMg01no498_p07.b1)	MSMg01-498P07.TJ (MSMg01no498_p07.g1)
ACC	AG575154	AG575155
length	1,200	800
length of high quality (start - end)	---	137 (494 - 630)
definition	CHROMAT_FILE: MSMg01no498_p07.b1 PHD_FILE: MSMg01no498_p07.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:25:13 2005	CHROMAT_FILE: MSMg01no498_p07.g1 PHD_FILE: MSMg01no498_p07.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:25:13 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TTACCTTCATATATATATAAAGACTCTTATTCTGAGGCTGTGTACCACTC CCTCAAAAGAGACATAAGTATGTCCGCGTGAACGTCGTCTACGACTATAT TGATCTCACCGAAGTCGTGCCGAGACATAGCTAACATTTATCATGTTTGT TTGATTCATTAACGACACCACGTTTCTTCGGTTAATGCGATCACTGCGTA CATATCCGTGGTGACCCGCAATCCTCCTGCCGCCTAAGTCTTCACTGCCG ACGATGATACTGTAATGTGGCCGCGCGAACTCACTATCCAACCGCGTTAT ACCAAGACGATTACACCACGGCGGCGCGCCATACGTTTTTTAATGTACGC CGGTGTAACGGATCTTGCGGGTATAGAACGACTATAACGTATACTACTAA TCTTTGACTGCGAGGAGATTACGTCGTAGTGATATCCTATATCGCGTTGC TAGGACCTGATCGTAATGTATTGCTATCGGCACAGAGTATGCTACGTGAG AGAGCTAAGCGAGTACACCGGAACTTAGTATCTATCCTCAGTAACTTCCA ATCGCTCGGCGCTATTAATCTCATTTAGATCGACTACGCGCACTGACGAA CGATGTAAATTAGTAGTCTCTCGCACTGAGCCTATGCGACACTCGGCATG TCACGCGCGCGAGCTGTATGTAAGTGCATGTCTGTGATTCGTCACATAAA GAGCCGCGAAGTATTGGGTGCTCGACACGCGCGCCGTCTCACGACCGCAT GACAGAACTATCCACTACANCATATACAATAATATATAAATATGCCGTGT TGATATATTATTTCTGTCGCAGATTGCGGGCCTCGCGCATCATTATTGTG TATATCGAGTNCATGTATATATATGTCGCTGAATACTCCTATGNAGTCGC TCTCATATATTATCAGCGTTGAAATATCCATCGATCACATCTTGCGGCTA CTACGCATTGATATCTGCGTCACCATTATTACTACGCGCTCTATATATTC ACAATCACGTAATGTTTATGCACCAATTATCGTTAGTCACACGTATATAT AACATCCACTGCAGTTGTGTGTATAGCGTATAACTCGTGTATCACATATA CACTATCTCTCTATTATCGAACNGCGAGCTGGCAGATATAAACGTGCCGT CTACTTNAGTACTGTTTATTGGTATCACACGCGCCGCCGCGTTATACGTN	AGGAAGCCGAGGGTACGGGNNNNANCANNNANAANNNNNNNNGCNNNNNN NNNCCGATGCAATGGGTAGGCCCGGNGNNNGCCCGGCTCGGCACTCGANG NGANNNANANAAGTTACANGAGNAGAGGANNNNNNNNGGNNAGGNGNNGN NANNNNANNNNNAANAATTTACCCAANAAAAGAAGAGNNGAANAAAANAN NAANAGAGNANGNNANAGGAGNAAAAGGGGNAGNANNNANNGGNNNAGGG GNNNAAGGAAGNNNNGNANANNGNNGGGNAGAAAGANNNGANGANNGNNN ATGTTTTGGTAGTTGNNNAGNANANANANNGGNANATGGGTTGGNANTTT GGGAAGNTNNNGGAGAATTTTTTTGTTTTTNNNNNGAAAAGGGAGGGAGG GNNNNGNTTTTTTTGTCTCCCCCTNAGAGAGATGGATGTANTAATTTTTT GGTTTAANTNGGNAGAACACTTGTCACCTCTTTTAGGGNTCAGAGATGAA CAAATGCTACAACCTTCAGCTGCATCTCTGGTCACTGCCTCTCTCAGAGA GCAGTTCCCCTATACCTCAATTCAAGGTGCCTGTTCTTTTGTCTGTAGTT GGTATGACACCTGTCTATGTTGCTATGAATTGGTTTCAAGGGCTGGTGGG GTGGCTTGGAGGATAGAAGAGCTTGCTGCAGGGCTTGATGACCTGAGTTT GATCTTTTTTTCTTTTTTTAAAGAGTTGTATCTCATAGCCTGCCCTCCGG TCTCCAACATACAATCTCCAAGCCCTTCTATTTTTTTTTATCCACCTCAG
quality values	Open. Hide. 6 8 6 6 6 6 6 6 6 6 6 6 8 11 9 9 12 8 8 10 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 10 10 12 8 8 8 8 8 8 8 8 8 8 8 8 6 8 6 6 8 8 8 10 8 10 8 8 8 8 10 10 10 11 11 11 7 6 8 8 8 8 10 11 9 8 8 6 7 7 7 8 6 6 6 6 8 8 8 8 8 8 8 8 6 6 6 7 8 6 6 6 6 6 6 8 10 10 9 9 6 8 7 6 10 8 10 8 8 6 9 9 11 10 8 8 8 6 6 6 6 8 10 10 9 9 9 8 8 8 8 8 10 8 10 6 6 6 6 8 7 10 6 6 8 6 6 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 9 11 8 8 8 8 8 8 8 8 10 8 8 8 10 8 8 8 8 10 10 10 10 15 10 8 8 8 9 8 10 8 8 8 8 8 8 8 8 8 8 8 15 6 6 6 6 8 8 7 9 9 6 8 6 6 6 8 9 6 8 6 6 8 8 8 8 6 6 6 7 8 8 10 8 8 6 6 6 10 10 10 10 8 10 8 8 7 8 7 6 10 8 8 6 7 8 10 10 9 6 8 8 8 9 8 8 8 8 8 8 8 8 10 8 8 8 8 8 12 9 9 9 10 9 8 10 8 8 8 8 8 9 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 12 10 10 10 8 8 6 6 8 8 8 8 8 9 10 11 11 11 8 8 8 6 8 8 8 8 8 8 8 11 6 6 6 6 8 8 6 6 6 8 8 8 8 8 8 9 9 8 10 8 6 6 6 6 10 10 10 11 15 13 8 8 8 7 10 11 10 8 6 7 6 6 6 6 6 6 8 6 7 8 8 6 6 8 10 7 6 8 6 9 9 12 10 9 10 8 8 7 7 8 8 9 9 8 8 8 8 8 14 12 10 10 8 8 8 8 8 8 8 8 10 10 13 10 8 6 6 6 6 10 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 8 6 6 7 6 8 8 12 12 9 9 9 9 9 9 8 8 8 8 8 8 8 8 8 12 10 6 6 6 6 8 8 10 9 9 10 10 8 8 8 8 8 8 6 6 8 8 8 8 8 11 10 10 10 9 11 8 8 8 7 7 8 8 8 8 8 10 8 8 6 6 8 8 8 8 8 8 8 6 6 6 6 8 10 12 10 11 10 9 10 10 6 6 6 6 6 8 6 6 6 6 6 8 8 8 9 10 10 10 9 10 10 10 10 10 9 9 9 10 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 8 7 8 8 8 8 8 9 8 8 8 8 6 6 7 7 6 6 8 8 8 8 8 8 6 6 8 6 8 8 8 8 8 8 12 11 8 8 8 8 8 8 8 12 9 9 10 8 8 8 8 6 6 8 13 26 11 10 10 9 9 10 12 15 17 9 9 9 9 9 9 8 8 8 8 8 7 12 9 10 10 10 10 9 9 9 8 6 6 6 6 6 6 6 8 8 8 8 6 6 6 6 6 8 8 8 8 8 11 11 11 11 11 9 7 3 0 3 8 8 9 9 8 6 6 6 6 6 8 11 9 10 10 12 10 6 6 6 8 6 8 8 8 8 9 8 6 6 6 6 7 13 13 10 10 10 9 8 10 8 8 8 8 10 7 7 7 7 7 10 9 9 8 8 8 8 8 8 10 10 7 7 6 8 8 6 6 6 6 10 6 10 10 10 10 8 9 6 9 9 7 7 8 8 8 6 3 0 3 10 10 9 9 8 8 8 8 13 8 10 10 10 9 9 9 9 9 9 10 13 13 13 10 8 8 9 9 10 12 3 0 3 6 8 6 6 8 8 8 10 6 6 8 8 8 8 8 8 10 8 6 6 8 10 9 8 8 8 8 8 8 8 11 10 11 9 10 9 10 18 23 14 8 8 8 8 10 8 10 10 10 8 8 8 8 8 8 9 9 9 9 9 9 11 12 11 11 10 8 8 8 10 10 10 8 10 10 6 6 6 8 13 10 8 6 6 6 6 8 8 9 10 10 9 9 9 9 10 8 11 10 11 9 9 9 10 8 10 6 7 8 6 9 10 11 12 9 9 9 9 11 10 15 9 9 9 9 9 10 8 6 6 8 6 6 6 6 6 6 6 6 6 8 10 8 8 8 10 8 6 6 6 6 8 8 8 10 9 9 9 10 9 6 6 6 6 8 8 8 6 6 6 6 8 8 9 9 9 11 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 6 8 8 8 8 6 6 6 6 6 6 8 8 8 11 10 10 10 10 10 10 10 8 8 8 9 13 13 8 8 8 8 8 10 3 0 3 6 6 6 8 8 9 10 8 8 8 8 10 10 13 9 6 8 6 6 6 6 8 8 8 8 8 8 10 10 8 8 3 0 3 6 6 6 9 9 8 8 13 8 8 8 8 6 6 6 6 6 6 8 8 9 9 10 8 8 8 6 6 10 8 13 10 8 8 7 8 12 7 8 8 3 0	Open. Hide. 8 8 8 8 10 10 11 8 8 8 8 8 8 8 8 8 8 10 3 0 0 0 0 3 0 3 3 0 0 0 3 0 3 3 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 3 8 8 8 8 8 8 8 9 9 10 19 8 8 6 8 8 6 8 7 7 3 0 3 0 0 0 3 18 18 8 3 3 3 6 6 3 3 3 6 6 6 9 9 3 0 3 0 3 3 0 0 0 3 0 3 0 3 7 7 7 8 9 9 3 0 3 9 3 0 3 9 9 9 10 3 0 0 0 0 0 0 0 0 3 3 0 0 3 27 3 0 3 0 0 3 0 0 3 0 0 0 0 3 0 0 0 0 0 3 3 0 3 6 6 7 7 9 6 7 6 7 3 0 3 8 8 8 6 7 7 9 9 3 0 0 3 6 3 0 3 6 6 3 0 3 0 0 3 3 0 3 23 23 3 0 3 0 3 0 0 3 0 3 17 17 17 3 0 3 23 19 19 9 7 7 3 0 3 3 0 3 0 0 0 3 0 0 3 3 0 0 0 3 14 7 7 3 0 0 0 3 7 7 9 7 8 3 0 0 0 0 3 0 3 0 3 0 0 3 0 0 3 7 3 0 3 23 17 8 8 8 3 0 0 0 3 3 0 3 3 0 0 3 0 0 0 3 9 9 9 15 15 9 9 9 9 23 23 27 23 3 0 0 0 3 3 0 3 0 3 0 3 0 3 0 0 3 3 0 3 0 3 25 22 28 20 30 25 18 3 0 3 0 3 23 23 43 43 43 23 23 3 0 3 0 0 0 3 23 23 23 10 13 11 18 19 23 15 15 7 7 6 10 12 12 3 0 0 0 0 0 3 27 27 59 59 59 59 59 59 59 59 23 18 7 7 3 0 0 0 0 3 0 3 7 7 9 8 11 8 8 8 7 7 8 10 12 23 20 3 0 3 20 23 23 22 9 9 9 12 12 15 28 18 22 3 0 3 7 7 9 13 34 27 36 27 14 13 10 11 17 17 3 0 3 0 3 3 0 3 6 6 7 6 6 9 23 12 12 11 12 12 13 19 18 13 10 8 8 8 11 12 27 3 0 3 18 12 12 12 25 30 43 43 43 43 43 43 30 30 18 20 20 27 27 32 20 20 28 32 37 34 30 25 40 36 42 40 39 32 32 39 42 43 43 36 32 30 30 28 40 40 39 39 37 43 37 47 57 46 47 44 44 42 44 36 42 32 24 24 30 25 20 18 18 18 20 20 19 30 36 47 47 57 57 57 57 43 43 32 28 28 23 23 32 43 50 57 57 57 57 54 54 57 57 44 43 24 16 11 11 11 21 21 35 35 38 30 23 23 32 43 43 37 37 37 43 50 47 47 47 50 44 43 33 27 32 32 32 42 44 42 46 30 25 10 10 10 11 9 9 14 24 24 13 15 13 24 24 32 18 18 15 24 14 16 10 10 10 12 13 26 19 15 8 8 8 10 16 30 36 25 15 8 8 8 8 8 9 9 11 11 13 23 22 15 10 12 8 8 8 12 10 14 14 23 12 12 9 17 18 28 18 18 18 20 23 12 13 14 23 14 12 19 14 11 6 6 6 13 19 17 18 11 11 11 11 12 22 15 11 11 8 8 8 10 10 13 12 10 10 8 8 8 8 13 13 11 10 10 11 12 11 8 6 6 8 12 12 8 8 6 6 6 8 8 10 10 10 9 9 9 9 9 12 12 15 11 10 6 6 8 15 8 8 8 8 12 15 15 17 8 8 7 6 6 6 8 9 9 12 9 9 9 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no498_p07.g1 MSMg01no498_p07.g1 CHROMAT_FILE:
MSMg01no498_p07.g1 PHD_FILE: MSMg01no498_p07.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:25:13 2005
         (137 letters)



>mm_chr2_25448340_25448876
          Length = 537

 Score =  257 bits (133), Expect = 2e-73
 Identities = 136/137 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   agatgaacaaatgctacaaccttcagctgcatctctggtcactgcctctctcagagagca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agatgaacaaatgctacaaccttcagctgcatctctggtcactgcctctctcagagagca 260

                                                                       
Query: 61  gttcccctatacctcaattcaaggtgcctgttcttttgtctgtagttggtatgacacctg 120
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gttcccctacacctcaattcaaggtgcctgttcttttgtctgtagttggtatgacacctg 320

                            
Query: 121 tctatgttgctatgaat 137
           |||||||||||||||||
Sbjct: 321 tctatgttgctatgaat 337


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 137
Length of database: 537
Length adjustment: 8
Effective length of query: 129
Effective length of database: 529
Effective search space:    68241
Effective search space used:    68241
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information