MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-504C16
Chromosome	2 (Build37)
Map Location	174,731,837 - 174,732,363
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC664880, LOC100043912, LOC664901, Stx16, Npepl1, Nespas, Gnas, Th1l, Ctsz, Rpl30-ps5, Tubb1, Atp5e, Slmo2, LOC664967, LOC100043757, Edn3
Downstream gene	LOC545487, LOC100043760, LOC100043761, LOC620790, LOC665001, LOC100043762, LOC100043763, LOC100043764, LOC100043914, LOC100043915, LOC668009, LOC100038953, LOC620804, LOC100039000, LOC100043126
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC664880 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 824 ESTs pseudo : _no_value

name	LOC100043912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC664901 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Stx16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228960 MGI:1923396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npepl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:228961 MGI:2448523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nespas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56802 MGI:1861674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14683 MGI:95777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 9 mRNAs

name	Th1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57314 MGI:1926424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64138 MGI:1891190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl30-ps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64903 MGI:1929159
definition	note : ribosomal protein L30, pseudogene 5 pseudo : _no_value

name	Tubb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545486 MGI:107814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67126 MGI:1855697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slmo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66390 MGI:1913640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins pseudo : _no_value

name	LOC100043757 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Edn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13616 MGI:95285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545487 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 315 ESTs, 7 Proteins

name	LOC100043760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100043761 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 3 Proteins pseudo : _no_value

name	LOC620790 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC665001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 4 Proteins

name	LOC100043762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043763 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 1341 ESTs, 7 Proteins

name	LOC100043764 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC100043914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs

name	LOC100043915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein

name	LOC668009 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 36 ESTs

name	LOC100038953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 1 Protein pseudo : _no_value

name	LOC620804 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs, 2 Proteins

name	LOC100043126 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs

name	Stx16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360172 GeneID:228960 MGI:1923396
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 16 transcript_id : NM_172675.2

name	Npepl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523980 GeneID:228961 MGI:2448523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminopeptidase-like 1 transcript_id : NM_213733.1

name	Gnas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117959902 GeneID:14683 MGI:95777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus transcript_id : NM_022000.2

name	Gnas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117959891 GeneID:14683 MGI:95777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus transcript_id : NM_019690.2

name	Gnas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117959906 GeneID:14683 MGI:95777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus transcript_id : NM_010309.3

name	Gnas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117959920 GeneID:14683 MGI:95777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus transcript_id : NM_001077507.1

name	Gnas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117959925 GeneID:14683 MGI:95777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus transcript_id : NM_201617.1

name	Gnas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117959932 GeneID:14683 MGI:95777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus transcript_id : NR_003258.1

name	Gnas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117959929 GeneID:14683 MGI:95777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus transcript_id : NM_201616.1

name	Gnas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117959927 GeneID:14683 MGI:95777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus transcript_id : NM_001077510.1

name	Th1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982764 GeneID:57314 MGI:1926424
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TH1-like homolog (Drosophila) transcript_id : NM_020580.2

name	Ctsz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892749 GeneID:64138 MGI:1891190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin Z transcript_id : NM_022325.4

name	Tubb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430499 GeneID:545486 MGI:107814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, beta 1 transcript_id : NM_001080971.1

name	Atp5e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158704 GeneID:67126 MGI:1855697
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit transcript_id : NM_025983.3

name	Slmo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981271 GeneID:66390 MGI:1913640
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slowmo homolog 2 (Drosophila) transcript_id : NM_025531.2

name	LOC100043757 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250144 GeneID:100043757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to likely orthologue of H. sapiens chromosome 20 open reading frame 174 (C20orf174) transcript_id : XM_001480903.1

name	Edn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351300 GeneID:13616 MGI:95285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelin 3 transcript_id : NM_007903.3

name	LOC545487 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367661 GeneID:545487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 315 ESTs, 7 Proteins product : similar to ribosomal protein L27a-like transcript_id : XM_619852.3

name	LOC100043760 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250146 GeneID:100043760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to M03D4.4b transcript_id : XM_001480905.1

name	LOC620790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250149 GeneID:620790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001480909.1

name	LOC665001 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250272 GeneID:665001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 1 transcript_id : XM_973954.2

name	LOC100043763 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250153 GeneID:100043763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 1341 ESTs, 7 Proteins product : similar to ribosomal protein S8 transcript_id : XM_001480910.1

name	LOC100043764 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250155 GeneID:100043764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001480913.1

name	LOC100043914 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250274 GeneID:100043914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001481228.1

name	LOC100043915 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250276 GeneID:100043915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 1 Protein product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 1 transcript_id : XM_001481229.1

name	LOC100043915 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250278 GeneID:100043915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 50 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein, transcript variant 2 transcript_id : XM_001481230.1

name	LOC668009 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94367710 GeneID:668009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 36 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001004283.1

name	LOC100039000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250457 GeneID:100039000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs, 2 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001472066.1

name	LOC100043126 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149250465 GeneID:100043126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein transcript_id : XM_001480068.1

name	Stx16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789393 CCDS:CCDS17147.1 GeneID:228960 MGI:1923396
definition	codon_start : 1 product : syntaxin 16 protein_id : NP_766263.1

name	Npepl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523981 CCDS:CCDS17148.1 GeneID:228961 MGI:2448523
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004178 - leucyl aminopeptidase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0019538 - protein metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : aminopeptidase-like 1 protein_id : NP_998898.1

name	Gnas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117959892 GeneID:14683 MGI:95777
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006112 - energy reserve metabolism [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP] [Evidence IDA]; GO:0042493 - response to drug [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 4; Gs alpha subunit; stimulatory G-protein alpha subunit product : GNAS complex locus isoform c protein_id : NP_062664.2

name	Gnas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117959903 CCDS:CCDS17149.1 GeneID:14683 MGI:95777
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006112 - energy reserve metabolism [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP] [Evidence IDA]; GO:0042493 - response to drug [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; Gs alpha subunit; stimulatory G-protein alpha subunit product : GNAS complex locus isoform c protein_id : NP_068840.2

name	Gnas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271396 CCDS:CCDS17151.1 GeneID:14683 MGI:95777
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006112 - energy reserve metabolism [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP] [Evidence IDA]; GO:0042493 - response to drug [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Gs alpha subunit; stimulatory G-protein alpha subunit product : GNAS complex locus isoform a protein_id : NP_034439.2

name	Gnas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117959921 GeneID:14683 MGI:95777
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006112 - energy reserve metabolism [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP] [Evidence IDA]; GO:0042493 - response to drug [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform f is encoded by transcript variant 5; Gs alpha subunit; stimulatory G-protein alpha subunit product : GNAS complex locus isoform f protein_id : NP_001070975.1

name	Gnas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117959926 GeneID:14683 MGI:95777
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006112 - energy reserve metabolism [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP] [Evidence IDA]; GO:0042493 - response to drug [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform d is encoded by transcript variant 6; Gs alpha subunit; stimulatory G-protein alpha subunit product : GNAS complex locus isoform d protein_id : NP_963911.1

name	Gnas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117959930 GeneID:14683 MGI:95777
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006112 - energy reserve metabolism [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP] [Evidence IDA]; GO:0042493 - response to drug [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform h is encoded by transcript variant 7; Gs alpha subunit; stimulatory G-protein alpha subunit product : GNAS complex locus isoform h protein_id : NP_963910.1

name	Gnas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117959928 GeneID:14683 MGI:95777
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence IMP] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006112 - energy reserve metabolism [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP] [Evidence IDA]; GO:0042493 - response to drug [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform g is encoded by transcript variant 8; Gs alpha subunit; stimulatory G-protein alpha subunit product : GNAS complex locus isoform g protein_id : NP_001070978.1

name	Th1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91982765 GeneID:57314 MGI:1926424
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : TH1 homolog protein_id : NP_065605.2

name	Ctsz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11968166 CCDS:CCDS17152.1 GeneID:64138 MGI:1891190
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : cathepsin X; cathepsin Z product : cathepsin Z preproprotein protein_id : NP_071720.1

name	Tubb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430500 GeneID:545486 MGI:107814
definition	codon_start : 1 product : tubulin, beta 1 protein_id : NP_001074440.1

name	Atp5e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385484 GeneID:67126 MGI:1855697
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005753 - proton-transporting ATP synthase complex (sensu Eukaryota) [Evidence ISS]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence ISS]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence ISS] [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATP synthase epsilon chain, mitochondrial product : ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit protein_id : NP_080259.1

name	Slmo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384954 CCDS:CCDS17155.1 GeneID:66390 MGI:1913640
definition	codon_start : 1 note : likely orthologue of H. sapiens chromosome 20 open reading frame 45 (C20orf45) product : slowmo homolog 2 protein_id : NP_079807.1

name	LOC100043757 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250145 GeneID:100043757
definition	codon_start : 1 product : similar to likely orthologue of H. sapiens chromosome 20 open reading frame 174 (C20orf174) protein_id : XP_001480953.1

name	Edn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681267 CCDS:CCDS17156.1 GeneID:13616 MGI:95285
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0030318 - melanocyte differentiation [Evidence IDA]; GO:0009405 - pathogenesis [Evidence IEA]; GO:0050880 - regulation of blood vessel size [Evidence IEA]; GO:0019229 - regulation of vasoconstriction [Evidence IEA]; GO:0042310 - vasoconstriction [Evidence IEA] codon_start : 1 note : lethal spotting product : endothelin 3 protein_id : NP_031929.1

name	LOC545487 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82887979 GeneID:545487
definition	codon_start : 1 product : similar to ribosomal protein L27a-like protein_id : XP_619852.2

name	LOC100043760 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250147 GeneID:100043760
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480955.1

name	LOC620790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250150 GeneID:620790
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001480959.1

name	LOC665001 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250273 GeneID:665001
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_979048.2

name	LOC100043763 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250154 GeneID:100043763
definition	codon_start : 1 product : similar to ribosomal protein S8 protein_id : XP_001480960.1

name	LOC100043764 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250156 GeneID:100043764
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001480963.1

name	LOC100043914 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250275 GeneID:100043914
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001481278.1

name	LOC100043915 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250277 GeneID:100043915
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 1 protein_id : XP_001481279.1

name	LOC100043915 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250279 GeneID:100043915
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein isoform 2 protein_id : XP_001481280.1

name	LOC668009 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94367711 GeneID:668009
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001004283.1

name	LOC100039000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250458 GeneID:100039000
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001472116.1

name	LOC100043126 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149250466 GeneID:100043126
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_001480118.1

name	LOC100043912 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043912
definition	number : 1 pseudo : _no_value

name	LOC664967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664967
definition	number : 1 pseudo : _no_value

name	LOC664967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664967
definition	number : 2 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 5 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 4 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 3 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 2 pseudo : _no_value

name	LOC100043762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043762
definition	number : 1 pseudo : _no_value

name	LOC620804 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620804
definition	number : 3 pseudo : _no_value

name	LOC620804 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620804
definition	number : 2 pseudo : _no_value

name	LOC620804 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620804
definition	number : 1 pseudo : _no_value

name	LOC664880 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250270 GeneID:664880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 824 ESTs product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_035052.1

name	LOC664901 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250271 GeneID:664901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to synaptobrevin like protein 1B pseudo : _no_value transcript_id : XR_035053.1

name	Nespas (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:141802301 GeneID:56802 MGI:1861674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroendocrine secretory protein antisense transcript_id : NR_002846.2

name	LOC100043761 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250148 GeneID:100043761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 3 Proteins product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein pseudo : _no_value transcript_id : XR_034901.1

name	LOC100038953 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149250456 GeneID:100038953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 1 Protein product : similar to zinc finger protein 586 pseudo : _no_value transcript_id : XR_030511.1

clone name	MSMg01-430P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-325B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099L09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-504C16.T7 (MSMg01no504_c16.b1)	MSMg01-504C16.TJ (MSMg01no504_c16.g1)
ACC	AG579111	AG579112
length	774	792
length of high quality (start - end)	623 (47 - 669)	527 (75 - 601)
definition	CHROMAT_FILE: MSMg01no504_c16.b1 PHD_FILE: MSMg01no504_c16.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:31:41 2005	CHROMAT_FILE: MSMg01no504_c16.g1 PHD_FILE: MSMg01no504_c16.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:31:41 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NACCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCG GAATTCAAGCGTTTTCCTTTGTGCCCTCCTTGTAATTTAGCTTCTTTGGG TCTATGGATTGTACCATAGTTGTCCCCTATACTTTATGGCTAAAATTCAC TTATAAATGAGTATCCTTGAGTCTGGGTTACCTAACCCAGGATAATATTT TATAGCTGCATCCATTTGTTGTCCTTGTTTTTAATATCTGAGTAATATTC CATTGTATAAATGAACCACACTTTCTTGTTTTAATTTAATTTTATTGTTT TATTTATTCACTTTACAGTCCACTCACTGACCACCTCCAAGTCACCCCAT CCCACAGCCCTTCTTCCATCCCCCCTTACTTTCTCCTCTGATCAGGTGGG GGCACCTGTGTATTCCTCCCCCACCCAGGCACTTCCAGTCTCTGCAAGGC TAGGTGCTTCCTCTCCCACTGAGGCCAGACAAAGCGGCCCAGCTAGTAGA ACGTATCCCAAATACAGGCAACCACTTTTGGAATAGCCCCCCACCCCTTT TCCCGTTGTTTGGGATCCATATGAAGGCCAAGCTGCACATCTGCTACATA TGAGCTGGGAGACCAAATCCAGCCTGTGTATGTTCTTTAGTTGGCTGGTT CAGACTCTGGGAATCCCAAAGGTCCAGGTTAGTTGATGCTGTTGGTCTTC CTGTGGAGTTCCTATCCAATTTGGGGCCCACATCCTTCATCCTATTTTTC ATAAGAGACCCAAGCTCCACTGTT	NACGATGCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXTACAGAGAGGTAGTTGTGAAGCTCAG ACAGCTGTGTCCCTTTCGAAACAGACCTCTGAGATCCTTTGTGCTGCCTG TCACATCAGAGGAAGTGTAGGAGGGGGCTGGGGCAGGAAGCATCGTGCAC AGAGTGCGGCACACACAATGAGGTCTCTAATGGAGCTAATTCCAATCAGG CCACCATTGTCAGGTGTGTGCTCACAGCCACCCTCAGCAGCAGTGGGCAC AATGGCAGGCAATGAGCACCAGGAAAAAGATGTTGAGGGGACACAGCAAG GGGTCACTGCTGGCCCCAGAGTGAGGCCTGGTCCTGGATGACCCCTCAAA GGCCCTGGGTCCAGGCCAGAGCTGAGCGGTATACACTCTGAGCTTCAATC TCAGGTCTGTGAGAAGAGAGGCTACATACAGGTATGGCTCTAGTGAAGCC CTGGGACATGTCTGAGCCATTTGTTGCTTAAGAGCATAAAATCTGTGTTA TTGTTAGTTAGCCATACTAGGAAGTAAAAGATAAAGTTCCCTGGATTCTA GAAAATTCTGAGAGAATTGCTCTGTAACTGATGTTTGTTACGTCAGCTGT AACAAAGTGCCGGATAAAAAGTGACTTAAGAAAGGAAGGTTGTGGCTNAG CAATGGTGGCACATGCCTGGTATCCCNCACTTGGGTAGCGGAGGCAGAAG CAGGCAAATTTCTGAGTTTGAAGCCAGTCTGGGCTACAAAAG
quality values	Open. Hide. 0 3 9 9 9 9 9 16 17 22 30 37 27 27 15 15 15 27 25 16 10 10 10 23 23 47 31 30 29 21 17 7 9 9 10 9 11 13 16 24 24 20 18 18 13 14 21 34 59 59 36 36 33 31 33 31 31 27 27 21 15 10 13 13 15 21 28 59 39 40 40 48 48 48 48 48 59 59 59 59 57 57 57 57 57 57 53 53 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 51 51 51 51 57 57 57 68 68 68 57 57 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 59 57 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 52 62 62 62 62 52 52 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 68 68 68 59 59 59 59 59 59 59 59 68 59 59 59 59 59 59 59 59 59 57 57 57 57 57 54 54 54 57 59 59 57 57 57 57 57 57 57 68 57 57 54 50 57 48 48 57 59 59 59 59 57 57 59 59 59 59 59 59 59 59 59 57 54 54 59 59 59 57 57 57 57 57 57 57 57 48 54 54 57 59 59 59 68 54 57 46 46 37 43 43 48 48 57 59 43 43 43 59 59 54 48 48 57 48 48 43 43 43 43 43 39 39 40 59 59 44 43 37 43 43 37 39 39 43 43 47 39 30 24 22 22 22 30 34 41 39 47 37 35 35 37 39 43 39 39 39 35 32 37 37 43 39 43 34 34 23 23 23 34 34 29 30 16 16 12 14 12 19 19 36 32 26 20 23 23 28 18 25 17 17 17 26 24 37 35 27 27 30 30 21 29 12 14 14 24 27 22 30 23 27 14 13 13 21 12 12 11 16 16 28 28 28 31 32 31 25 30 22 30 20 15 15 12 12 12 15 15 22 20 22 24 28 28 20 20 18 25 27 19 24 25 17 13 8 8 8 14 14 24 14 21 19 27 15 19 12 12 12 18 16 13 13 17 21 15 18 23 10 10 9 9 9 9 14 13 10 11 15 14 8 17 12 12 12 16 16 25 22 22 22 23 18 16 16 18 18 22 27 27 35 23 23 10 10 10 11 9 9 9 9 9 9 9 10 19 14 15 13 15 13 10 11 11 16 15 12 12	Open. Hide. 0 3 7 8 8 13 10 9 9 9 21 21 19 10 10 10 15 25 32 33 41 42 42 42 39 37 37 41 27 19 8 8 7 7 7 11 18 15 10 12 12 19 16 23 31 37 44 36 36 33 41 33 33 42 41 25 23 9 6 6 6 7 10 15 23 34 43 47 28 31 31 35 36 36 50 38 36 36 37 42 59 59 59 59 59 59 57 57 57 57 68 68 68 68 59 54 48 48 42 47 50 51 68 68 68 68 68 59 59 59 59 57 57 57 57 59 48 48 59 57 68 68 68 68 68 68 68 68 68 68 68 51 51 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 52 45 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 62 62 62 43 43 43 43 43 26 43 43 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 57 57 57 57 59 59 68 68 68 59 59 57 57 57 57 57 57 68 68 59 59 57 57 59 57 52 59 59 59 59 68 68 68 68 68 68 68 59 59 57 57 59 59 57 57 57 57 57 57 57 57 57 57 57 52 54 57 57 59 57 54 54 59 59 59 59 59 57 57 54 54 54 57 57 57 57 59 54 54 54 59 59 48 48 48 59 59 59 59 59 59 68 59 59 59 59 57 57 54 54 54 57 57 48 48 48 57 59 59 57 47 47 57 57 57 59 57 57 57 57 57 57 59 59 54 54 54 59 59 59 48 57 43 47 46 48 48 48 48 54 57 57 57 57 48 48 43 48 46 46 46 59 47 57 48 48 43 43 43 48 48 43 43 43 43 40 41 47 47 47 30 30 17 17 17 25 25 31 59 47 41 39 39 39 37 37 32 24 18 24 23 32 32 39 39 46 59 59 43 43 37 39 32 32 30 32 32 47 37 37 30 30 24 27 23 25 25 30 28 25 13 13 13 30 26 31 20 19 22 34 32 43 31 25 24 36 26 26 14 17 15 22 32 31 27 22 23 26 31 35 29 29 32 27 28 26 21 13 13 15 21 22 20 18 18 21 21 25 13 14 14 14 14 21 21 29 32 35 35 25 29 17 22 18 29 31 32 31 13 10 9 9 9 15 14 22 15 21 13 12 12 11 11 11 18 23 11 11 11 13 18 19 19 19 20 13 11 14 11 11 14 17 17 17 28 34 34 24 28 25 25 32 24 20 12 12 9 9 9 15 10 10 9 11 10 10 8 8 8 8 10 10 12 8 3 0 3 9 8 20 25 26 19 13 12 12 12 12 12 12 15 15 26 20 18 15 9 9 9 13 15 10 12 3 0 3 11 11 16 12 7 6 6 6 6 10 13 14 17 18 15 12 10 9 9 9 10 11 11 10 9 8 8 6 6 6 6 8 8 12 8 10 8 8 8 9 12 10 6 6 6 6 6 10 10 11 11 11 11 15 12 12 13 8 8 8 8 10 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no504_c16.g1 MSMg01no504_c16.g1 CHROMAT_FILE:
MSMg01no504_c16.g1 PHD_FILE: MSMg01no504_c16.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:31:41 2005
         (527 letters)



>mm_chr2_174731637_174732563
          Length = 927

 Score = 1011 bits (523), Expect = 0.0
 Identities = 526/527 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   tacagagaggtagttgtgaagctcagacagctgtgtccctttcgaaacagacctctgaga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tacagagaggtagttgtgaagctcagacagctgtgtccctttcgaaacagacctctgaga 260

                                                                       
Query: 61  tcctttgtgctgcctgtcacatcagaggaagtgtaggagggggctggggcaggaagcatc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tcctttgtgctgcctgtcacatcagaggaagtgtaggagggggctggggcaggaagcatc 320

                                                                       
Query: 121 gtgcacagagtgcggcacacacaatgaggtctctaatggagctaattccaatcaggccac 180
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 321 gtgcacagagtgcggcacacacaatgaggtctctaatggagctaatttcaatcaggccac 380

                                                                       
Query: 181 cattgtcaggtgtgtgctcacagccaccctcagcagcagtgggcacaatggcaggcaatg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 cattgtcaggtgtgtgctcacagccaccctcagcagcagtgggcacaatggcaggcaatg 440

                                                                       
Query: 241 agcaccaggaaaaagatgttgaggggacacagcaaggggtcactgctggccccagagtga 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 agcaccaggaaaaagatgttgaggggacacagcaaggggtcactgctggccccagagtga 500

                                                                       
Query: 301 ggcctggtcctggatgacccctcaaaggccctgggtccaggccagagctgagcggtatac 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 ggcctggtcctggatgacccctcaaaggccctgggtccaggccagagctgagcggtatac 560

                                                                       
Query: 361 actctgagcttcaatctcaggtctgtgagaagagaggctacatacaggtatggctctagt 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 actctgagcttcaatctcaggtctgtgagaagagaggctacatacaggtatggctctagt 620

                                                                       
Query: 421 gaagccctgggacatgtctgagccatttgttgcttaagagcataaaatctgtgttattgt 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 gaagccctgggacatgtctgagccatttgttgcttaagagcataaaatctgtgttattgt 680

                                                          
Query: 481 tagttagccatactaggaagtaaaagataaagttccctggattctag 527
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 tagttagccatactaggaagtaaaagataaagttccctggattctag 727


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 27
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 527
Length of database: 927
Length adjustment: 10
Effective length of query: 517
Effective length of database: 917
Effective search space:   474089
Effective search space used:   474089
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information