MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-019O03
Chromosome	X (Build37)
Map Location	89,249,848 - 89,250,969
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC670074, LOC667972, LOC667976, Mageb2, EG278167, EG667988, EG667993, EG385489, 1700084M14Rik, EG236891, LOC629542, Mageb5, LOC673766, LOC633484, LOC674396, EG278087
Downstream gene	Mageb1, EG236892, EG236893, Mageb18, EG436259, EG668061, EG546347, LOC629568
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC670074 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	LOC667972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC667976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins pseudo : _no_value

name	Mageb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17146 MGI:105117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG278167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278167 MGI:3643982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins

name	EG667988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667988 MGI:3646464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins

name	EG667993 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667993 MGI:3643555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins pseudo : _no_value

name	EG385489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385489 MGI:3648366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1700084M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73487 MGI:1920737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 1 Protein

name	EG236891 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236891 MGI:3643138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 Proteins

name	LOC629542 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629542
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 12 Proteins

name	Mageb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74271 MGI:2148169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 13 Proteins

name	LOC673766 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC633484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633484
definition	note : melanoma antigen, family B pseudogene pseudo : _no_value

name	LOC674396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG278087 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278087 MGI:3645128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mageb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17145 MGI:105118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG236892 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236892 MGI:3643139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 Proteins

name	EG236893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236893 MGI:3643140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Mageb18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215641 MGI:3045344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436259 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436259 MGI:3648071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG668061 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668061 MGI:3645921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG546347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546347 MGI:3646197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC670074 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271765 GeneID:670074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to Predicted gene, EG546347 transcript_id : XM_001477083.1

name	Mageb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13624318 GeneID:17146 MGI:105117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family B, 2 transcript_id : NM_031171.1

name	EG278167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25030909 GeneID:278167 MGI:3643982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins product : predicted gene, EG278167 transcript_id : XM_205261.1

name	EG667988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407637 GeneID:667988 MGI:3646464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins product : predicted gene, EG667988 transcript_id : XM_993696.1

name	EG236891 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38087231 GeneID:236891 MGI:3643138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 Proteins product : predicted gene, EG236891 transcript_id : XM_141933.2

name	LOC629542 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407643 GeneID:629542
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 12 Proteins product : similar to Melanoma antigen, family B, 5 transcript_id : XM_204404.3

name	Mageb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407644 GeneID:74271 MGI:2148169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 13 Proteins product : melanoma antigen, family B, 5 transcript_id : XM_284719.3

name	EG278087 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:136255945 GeneID:278087 MGI:3645128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG278087 transcript_id : NM_001083629.1

name	Mageb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8659569 GeneID:17145 MGI:105118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family B, 1 transcript_id : NM_010759.1

name	EG236892 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407645 GeneID:236892 MGI:3643139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 Proteins product : predicted gene, EG236892 transcript_id : XM_141934.2

name	EG236893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20984657 GeneID:236893 MGI:3643140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG236893 transcript_id : XM_141935.1

name	Mageb18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372036 GeneID:215641 MGI:3045344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen family B, 18 transcript_id : NM_173783.3

name	EG668061 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407648 GeneID:668061 MGI:3645921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG668061 transcript_id : XM_994015.1

name	EG546347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539459 GeneID:546347 MGI:3646197
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546347 transcript_id : NM_001034103.1

name	LOC670074 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271766 GeneID:670074
definition	codon_start : 1 product : similar to Predicted gene, EG546347 protein_id : XP_001477133.1

name	Mageb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624319 GeneID:17146 MGI:105117
definition	codon_start : 1 product : melanoma antigen, family B, 2 protein_id : NP_112448.1

name	EG278167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25030910 GeneID:278167 MGI:3643982
definition	codon_start : 1 product : similar to putative novel member of the melanoma antigen, family B (Mageb) gene family protein_id : XP_205261.1

name	EG667988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407638 GeneID:667988 MGI:3646464
definition	codon_start : 1 product : similar to putative novel member of the melanoma antigen, family B (Mageb) gene family protein_id : XP_998790.1

name	EG236891 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38087232 GeneID:236891 MGI:3643138
definition	codon_start : 1 product : similar to putative novel member of the melanoma antigen, family B (Mageb) gene family protein_id : XP_141933.2

name	LOC629542 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:25030920 GeneID:629542
definition	codon_start : 1 product : hypothetical protein protein_id : XP_204404.1

name	Mageb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28528822 GeneID:74271 MGI:2148169
definition	codon_start : 1 product : melanoma antigen, family B, 5 protein_id : XP_284719.1

name	EG278087 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:136255946 GeneID:278087 MGI:3645128
definition	codon_start : 1 note : melanoma antigen, family B, 2 product : predicted gene, EG278087 protein_id : NP_001077098.1

name	Mageb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8659570 CCDS:CCDS30267.1 GeneID:17145 MGI:105118
definition	codon_start : 1 product : melanoma antigen, family B, 1 protein_id : NP_034889.1

name	EG236892 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407646 GeneID:236892 MGI:3643139
definition	codon_start : 1 product : similar to MAGE-B3 protein_id : XP_141934.2

name	EG236893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984658 GeneID:236893 MGI:3643140
definition	codon_start : 1 product : similar to melanoma antigen, family B, 1 protein_id : XP_141935.1

name	Mageb18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424659 CCDS:CCDS30268.1 GeneID:215641 MGI:3045344
definition	codon_start : 1 product : melanoma antigen family B, 18 protein_id : NP_776144.1

name	EG668061 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407649 GeneID:668061 MGI:3645921
definition	codon_start : 1 product : similar to Predicted gene, EG546347 protein_id : XP_999109.1

name	EG546347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77539460 GeneID:546347 MGI:3646197
definition	codon_start : 1 product : hypothetical protein LOC546347 protein_id : NP_001029275.1

name	LOC667972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667972
definition	number : 1 pseudo : _no_value

name	LOC667972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667972
definition	number : 2 pseudo : _no_value

name	LOC667972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667972
definition	number : 3 pseudo : _no_value

name	LOC667972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667972
definition	number : 4 pseudo : _no_value

name	LOC667976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667976
definition	number : 3 pseudo : _no_value

name	LOC667976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667976
definition	number : 2 pseudo : _no_value

name	LOC667976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667976
definition	number : 1 pseudo : _no_value

name	EG667993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667993
definition	number : 2 pseudo : _no_value

name	EG667993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667993
definition	number : 1 pseudo : _no_value

name	EG385489 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385489
definition	number : 1 pseudo : _no_value

name	LOC673766 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673766
definition	number : 1 pseudo : _no_value

name	LOC674396 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674396
definition	number : 2 pseudo : _no_value

name	LOC674396 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674396
definition	number : 1 pseudo : _no_value

name	EG436259 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436259
definition	number : 2 pseudo : _no_value

name	EG436259 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436259
definition	number : 1 pseudo : _no_value

name	LOC629568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629568
definition	number : 1 pseudo : _no_value

name	LOC629568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629568
definition	number : 2 pseudo : _no_value

name	1700084M14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271818 GeneID:73487 MGI:1920737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 1 Protein product : RIKEN cDNA 1700084M14 gene transcript_id : XR_001621.2

clone name	MSMg01-354I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-503B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-382K01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534F17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-457M24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184D09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-115I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261A01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163P02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-019O03.b	B6Ng01-019O03.g
ACC	DH852838	DH852839
length	1,173	1,112
definition	DH852838\|Mus musculus domesticus DNA, BAC clone: B6Ng01-019O03, 5' end.	DH852839\|Mus musculus domesticus DNA, BAC clone: B6Ng01-019O03, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctaacctgaggaataccgaatggctgagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tacacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgtggatgtggagaaagagaaacactcctccattgttggtg gaattgcaggcttgtacaacgactctggtaatcagtctggcggttcctca gaaaattggacatagtactactggaggatccaccaatacctctcctgggc atatatccagaagatgccccaactggtaaaaggacacatgctccactatg ttcatagcaaccttatttataatagccagaagctggaaagaacccagatg cccctcaacagagtaatggatacagaaaatgtggtacatttacataatgg agtactactcagctattaaaaagaatgaatatatgaaattcctagccaaa tgcatggacctggagggcatcatcctgtgaggtaacacattcacaaagga actcacacaatatgtactcaatgataagtggatattagcccaaaacctag gatacccaagatataagatacaatttgctaaacacatgaaactcaagaag aatgaagactgaagtgtggacactatgcccctccttagaaatgggaacaa aacacccatggaaggagttacagagacaagtttggagctgagatgaaagg atggaccatgtagagactgccatatacagggatccaccccataatcagca tccaaacgctgacaccattgcatacactagcaagattttattgaaaggac ccagatgtagctgtctcttgtgagactatgccagggcctagcaaacacag aagtggatgctcacagtcagctaatgaatggatcacagggctcccaatgg aaggagctagagaaagtacccaagaagctaaagggatctgcaaccctata agtggaacaacattatgactaaccagtaccccggagtcttggcttcagct gctatgtatcaaaagaatggctagtttgccatacctggaaagaaggccca ttggaaccaacctttatatcctcggtcaagggaccgcagggcaaaggtgg gtggtgtggggtaggggatgtgt	gaattcccttgccttctttcctcatatctggaggtgctgtaagcaggact cataatttgtcccacaaataattgtagtcttcttaagtgaaataacataa tgtaggagtggggtgttcccaaatatggcaacaacaaaaactatttatat gaaataaacaaaatttacttcaaaattaagtgttagtgagtctaaggcgt ttccagcagtacttacttgtgtttcatcatggggcttgaatgtagccttg gttctgaacacacaatatgcacactgtgtatattgccattacattgaaag ttacatgagtgttagcactcgatatatagcaacataatatcaattttcat caattttcatagatatatgaataaatcccatattatatttacattccatt atttctttcagcaaataacaagacatataccatgactttcttagtttatg caaggaatgtgggaaaaattaaatcataataaactagatatgccactcac ggttttgctgatttaacacccagacattacatttccatttgttcttaaat aataatagcaataataacaataataaaatgcagatcaagtcagtcaccac gaagtatgtagagtgtttgtgtgatactttagtagatgagtagtgaaact ctaggatataaatataaataagagatttaaaaataagtagtaagtagtgc agaaatttctaaatgagctgtaggtaacctgaagccaggcatttttgaat catttgggaattgcaatgtatttacaaaagagggtatatcatattaattg acggtgacctacatgagactatgaacttgtgaacaaaaagactaaggtaa ttattcattttggagttcagaaactaaaagctggacttgagtaatgatag tatatgcttttaatctcagcactctggagtcagaggcaagcagatctctg tgagttcgagttcagtgtgctctccagtgtgagttcaaggatggccagta ctatgcaaagaatccttgtctagaaccctgccccccaccccctaaaaata gctgtctggagaagtattaacatttgcttggatataagtaaacgaagtaa cactggcatctc
quality values	Open. Hide. 61 41 45 31 61 61 61 61 61 61 61 61 61 61 61 61 61 39 38 61 55 61 61 61 61 49 61 28 20 21 19 19 10 28 20 15 22 43 59 59 61 61 59 61 61 61 59 59 59 59 59 61 59 59 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 59 61 61 59 59 37 35 34 35 30 45 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 55 49 61 43 55 55 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 50 53 50 50 53 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 43 61 43 61 61 61 61 61 61 61 61 61 61 61 53 61 53 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 45 53 61 61 61 61 61 50 45 53 61 61 61 47 61 61 47 33 61 61 61 47 61 61 61 24 61 61 39 53 53 61 61 45 61 47 47 40 47 43 50 57 53 57 34 53 53 47 53 53 57 57 53 53 53 42 57 53 53 53 53 45 57 57 57 57 57 53 57 47 35 47 53 57 57 38 57 53 34 57 53 57 45 52 33 57 57 53 53 50 47 42 23 57 53 40 36 30 52 50 50 53 53 52 25 47 47 47 45 43 44 44 42 39 53 53 53 50 53 57 53 53 35 30 24 53 38 41 47 42 33 43 47 42 53 47 57 37 43 24 53 41 30 41 36 35 38 36 37 57 45 57 37 27 51 40 41 57 50 53 50 50 30 50 53 37 57 30 40 24 38 50 57 53 30 50 32 25 32 28 34 38 37 30 38 57 39 42 25 40 33 31 30 42 38 18 53 27 44 33 35 29 36 30 36 57 57 19 20 24 25 24 33 41 38 46 27 38 29 31 37 37 28 32 40 36 42 33 53 34 53 41 30 22 36 40 40 37 24 33 37 51 10 8 27 40 30 24 36 30 36 17 30 40 41 28 40 26 28 20 37 15 51 51 39 23 32 46 38 36 51 30 23 47 18 9 45 44 28 31 34 20 25 20 34 28 32 33 29 29 27 30 35 24 30 28 24 28 47 12 29 23 31 28 27 29 29 20 12 23 46 26 25 25 35 33 14 29 28 47 33 29 27 34 15 24 33 39 18 29 29 34 23 17 23 16 28 28 23 30 21 29 19 28 22 21 21 33 28 35 26 30 35 33 31 34 39 26 31 22 28 28 27 27 51 31 23 34 23 36 21 19 23 21 33 29 16 20 39 9 29 12 29 27 18 23 31 15 25 51 39 16 24 25 30 38 29 23 18 6 5 20 11 13 16 23 46 24 22 46 26 30 20 26 29 36 23 19 24 22 46 28 21 20 10 6 9 38 17 19 26 34 23 9 13 10 14 9 9 25 18 20 22 38 16 16 15 23 14 18 11 26 12 15 33 51 51 22 23 6 10 5 4 6 12 10 6 4 5 5 9 4 4 14 17 8 16 6 8 4 12 15 23 9 17 19 18 28 32 16 7 12 17 7 22 7 13 6 16 7 18 28 7 25 9 12 5 22 5 10 8 9 17 14 18 17 7 5 8 21 12 17 8 23 27 9 15 12 24 23 17 4 3 5 6 7 6 6 16 30 30 13 16 8 5 4 6 4 8 4 4 5 5 4 4 11 22 13 19 5 9 6 14 5 6 25 8 7 5 14 18 8 8 6 9 5 4 3 9 8 9 5 4 7 13 5 16 9 6 5 17 8 9 10 5 10 3 3 3	Open. Hide. 61 61 55 55 61 61 43 25 23 23 26 22 26 28 28 26 59 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 59 52 36 44 59 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 55 47 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 50 61 53 61 50 61 53 61 61 61 61 61 61 53 61 45 61 61 50 61 52 61 61 53 61 61 61 53 53 61 45 61 61 39 61 39 61 61 61 40 61 38 53 53 30 35 47 47 57 53 57 52 53 57 33 53 45 57 53 36 53 57 53 47 57 42 53 53 53 53 53 47 50 47 57 31 31 40 48 42 57 47 53 50 47 38 57 46 50 53 53 29 53 40 30 13 41 57 27 57 57 57 42 53 52 47 45 52 50 35 43 50 30 20 34 42 53 43 43 42 50 30 57 57 23 39 52 51 40 41 47 57 39 39 53 53 30 43 53 37 20 38 30 52 21 38 33 40 43 53 53 53 53 28 42 47 30 37 35 35 23 31 53 57 57 9 14 30 52 39 30 25 52 57 50 31 53 33 50 30 34 26 28 30 35 24 34 53 34 19 19 57 53 23 37 9 57 53 57 24 39 10 57 34 22 30 22 32 39 37 37 48 37 30 14 44 30 31 45 39 34 20 25 24 16 31 37 14 47 30 30 28 30 40 34 44 17 29 25 31 25 36 34 53 14 21 25 33 41 34 16 18 36 27 14 53 53 53 30 12 30 26 26 17 33 28 30 9 26 27 27 32 17 17 16 24 14 48 48 51 30 27 21 36 12 19 35 28 23 14 46 51 31 31 29 28 48 46 25 7 20 37 31 32 33 29 35 29 33 33 16 28 8 39 25 29 33 20 43 31 24 28 29 25 29 29 28 16 51 51 35 14 23 26 31 29 28 30 13 25 25 21 19 28 28 26 16 30 15 28 21 10 13 40 11 27 17 27 28 21 26 20 7 26 20 19 23 25 34 15 11 19 28 9 31 20 29 9 35 12 12 24 19 16 15 8 19 11 9 9 23 21 5 5 30 6 7 14 29 12 20 31 21 35 19 28 9 17 32 13 31 17 28 25 6 16 16 11 7 6 21 17 19 19 27 20 23 38 23 9 38 25 17 12 26 9 8 18 11 15 20 16 9 12 7 14 30 28 17 22 18 34 34 25 29 21 8 17 25 25 25 26 9 7 23 33 32 34 14 12 7 23 7 30 11 17 5 19 7 21 5 13 7 4 8 12 8 18 17 15 10 6 8 30 16 12 20 12 7 9 3 4 10 7 9 13 29 8 29 11 26 14 12 8 16 10 4 1 4 10 24 5 5 10 24 24 4 4 4 4 6 19

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_89249848_89250969
seq2: B6Ng01-019O03.g_67_1178 (reverse)

seq1  GAGATGCCAGTGGTTTACCCTCGTTTACTTATAATCCCCAAGCAAATGTT  50
      ||||||||||||  ||| | |||||||||||||    |||||||||||||
seq2  GAGATGCCAGTG--TTA-CTTCGTTTACTTATA---TCCAAGCAAATGTT  44

seq1  AATTACTTCTTCCAGACCAGCTTATTTTTTAGGGGGTGGGGGGCAGGGTT  100
      || |||||| |||||| |||||   |||||||||||||||||||||||||
seq2  AA-TACTTC-TCCAGA-CAGCT--ATTTTTAGGGGGTGGGGGGCAGGGTT  89

seq1  CTAGACAGGGATTCTTTGCATAGTACTGGCCATCCTGGAACTCACACTGG  150
      ||||||| |||||||||||||||||||||||||||| |||||||||||||
seq2  CTAGACAAGGATTCTTTGCATAGTACTGGCCATCCTTGAACTCACACTGG  139

seq1  AGAGCACACTGAACTCGAACTCACAGAGATCTGCTTGCCTCTGACTCCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCACACTGAACTCGAACTCACAGAGATCTGCTTGCCTCTGACTCCAG  189

seq1  AGTGCTGAGATTAAAAGCATATACTATCATTACTCAAGTCCAGCTTTTAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTGAGATTAAAAGCATATACTATCATTACTCAAGTCCAGCTTTTAG  239

seq1  TTTCTGAACTCCAAAATGAATAATTACCTTAGTCTTTTTGTTCACAAGTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGAACTCCAAAATGAATAATTACCTTAGTCTTTTTGTTCACAAGTT  289

seq1  CATAGTCTCATGTAGGTCACCGTCAATTAATATGATATACCCTCTTTTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAGTCTCATGTAGGTCACCGTCAATTAATATGATATACCCTCTTTTGT  339

seq1  AAATACATTGCAATTCCCAAATGATTC-AAAATGCCTGGCTTCAGGTTAC  399
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  AAATACATTGCAATTCCCAAATGATTCAAAAATGCCTGGCTTCAGGTTAC  389

seq1  CTACAGCTCATTTAGAAATTTCTGCACTACTTACTACTTATTTTTAAATC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACAGCTCATTTAGAAATTTCTGCACTACTTACTACTTATTTTTAAATC  439

seq1  TCTTATTTATATTTATATCCTAGAGTTTCACTACTCATCTACTAAAGTAT  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATTTATATTTATATCCTAGAGTTTCACTACTCATCTACTAAAGTAT  489

seq1  CACACAAACACTCTACATACTTCGTGGTGACTGACTTGATCTGCATTTTA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACAAACACTCTACATACTTCGTGGTGACTGACTTGATCTGCATTTTA  539

seq1  TTATTGTTATTATTGCTATTATTATTTAAGAACAAATGGAAATGTAATGT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTGTTATTATTGCTATTATTATTTAAGAACAAATGGAAATGTAATGT  589

seq1  CTGGGTGTTAAATCAGCAAAACCGTGAGTGGCATATCTAGTTTATTATGA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGTGTTAAATCAGCAAAACCGTGAGTGGCATATCTAGTTTATTATGA  639

seq1  TTTAATTTTTCCCACATTCCTTGCATAAACTAAGAAAGTCATGGTATATG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATTTTTCCCACATTCCTTGCATAAACTAAGAAAGTCATGGTATATG  689

seq1  TCTTGTTATTTGCTGAAAGAAATAATGGAATGTAAATATAATATGGGATT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGTTATTTGCTGAAAGAAATAATGGAATGTAAATATAATATGGGATT  739

seq1  TATTCATATATCTATGAAAATTGATGAAAATTGATATTATGTTGCTATAT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCATATATCTATGAAAATTGATGAAAATTGATATTATGTTGCTATAT  789

seq1  ATCGAGTGCTAACACTCATGTAACTTTCAATGTAATGGCAATATACACAG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGAGTGCTAACACTCATGTAACTTTCAATGTAATGGCAATATACACAG  839

seq1  TGTGCATATTGTGTGTTCAGAACCAAGGCTACATTCAAGCCCCATGATGA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCATATTGTGTGTTCAGAACCAAGGCTACATTCAAGCCCCATGATGA  889

seq1  AACACAAGTAAGTACTGCTGGAAACGCCTTAGACTCACTAACACTTAATT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACAAGTAAGTACTGCTGGAAACGCCTTAGACTCACTAACACTTAATT  939

seq1  TTGAAGTAAATTTTGTTTATTTCATATAAATAGTTTTTGTTGTTGCCATA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAGTAAATTTTGTTTATTTCATATAAATAGTTTTTGTTGTTGCCATA  989

seq1  TTTGGGAACACCCCACTCCTACATTATGTTATTTCACTTAAGAAGACTAC  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGGAACACCCCACTCCTACATTATGTTATTTCACTTAAGAAGACTAC  1039

seq1  AATTATTTGTGGGACAAATTATGAGTCCTGCTTACAGCACCTCCAGATAT  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTATTTGTGGGACAAATTATGAGTCCTGCTTACAGCACCTCCAGATAT  1089

seq1  GAGGAAAGAAGGCAAGGGAATTC  1122
      |||||||||||||||||||||||
seq2  GAGGAAAGAAGGCAAGGGAATTC  1112

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information