MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-024J24
Chromosome	X (Build37)
Map Location	52,022,865 - 52,023,551
singlet/doublet	singlet
Overlap gene	LOC666122
Upstream gene	4930502E18Rik, 1700013H16Rik, EG547172, Zfp36l3, Xlr, LOC100040719, LOC100040730, LOC100040260, LOC100040271, LOC100040765, LOC194788, LOC100040789, LOC666072, LOC100040317, LOC625476, LOC625508, LOC666096, LOC100040867, LOC100040894
Downstream gene	LOC666135, LOC100038960, EG666151, EG666161, EG666199, 4930527E24Rik, LOC626274, LOC625210, LOC100039055, LOC100039066, LOC676623
Link	Open Mouse BAC browser

Click to get alignment info.

name	4930502E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75013 MGI:1922263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700013H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75514 MGI:1922764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	EG547172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547172 MGI:3646091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Zfp36l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333473 MGI:3525151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22441 MGI:98976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040719 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 9 Proteins

name	LOC100040730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040260 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 26 Proteins

name	LOC100040271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040765 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC194788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC666072 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040317 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 1 Protein

name	LOC625476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC625508 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC666096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100040867 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100040894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC666122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC666135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100038960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666151 MGI:3645943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG666161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666161 MGI:3643207
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG666199 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666199 MGI:3644332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930527E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75140 MGI:1922390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 1 Protein

name	LOC626274 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC625210 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC100039055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC100039066 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC676623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	4930502E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626043 GeneID:75013 MGI:1922263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930502E18 gene transcript_id : NM_029142.1

name	1700013H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271603 GeneID:75514 MGI:1922764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 1700013H16 gene transcript_id : XM_135430.4

name	EG547172 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001197 GeneID:547172 MGI:3646091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG547172 transcript_id : XM_622034.2

name	Zfp36l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222289 GeneID:333473 MGI:3525151
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 36, C3H type-like 3 transcript_id : NM_001009549.1

name	Xlr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357146 GeneID:22441 MGI:98976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated complex transcript_id : NM_011725.3

name	LOC100040719 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271612 GeneID:100040719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 9 Proteins product : similar to X-linked lymphocyte-regulated protein pM1 transcript_id : XM_001475126.1

name	LOC100040260 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271604 GeneID:100040260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 26 Proteins product : similar to Atf1 protein transcript_id : XM_001474817.1

name	LOC100040271 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271606 GeneID:100040271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040271 transcript_id : XM_001474837.1

name	LOC100040317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271610 GeneID:100040317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 1 Protein product : similar to Xlr-related, meiosis regulated, transcript variant 2 transcript_id : XM_001474869.1

name	LOC100040317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271608 GeneID:100040317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Xlr-related, meiosis regulated, transcript variant 1 transcript_id : XM_001474852.1

name	LOC625508 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:83001215 GeneID:625508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_890086.1

name	LOC666096 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407432 GeneID:666096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_981599.1

name	LOC100040867 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271614 GeneID:100040867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_001475416.1

name	LOC100040894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271616 GeneID:100040894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_001475448.1

name	LOC666122 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407437 GeneID:666122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_981768.1

name	LOC666135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407439 GeneID:666135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Xlr-related, meiosis regulated transcript_id : XM_981842.1

name	EG666151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407443 GeneID:666151 MGI:3645943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG666151 transcript_id : XM_981963.1

name	EG666161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407445 GeneID:666161 MGI:3643207
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG666161 transcript_id : XM_982040.1

name	4930527E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271621 GeneID:75140 MGI:1922390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 1 Protein product : RIKEN cDNA 4930527E24 gene, transcript variant 3 transcript_id : XM_976915.2

name	4930527E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271619 GeneID:75140 MGI:1922390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : RIKEN cDNA 4930527E24 gene transcript_id : XM_001471966.1

name	LOC100039066 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271626 GeneID:100039066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100039066 transcript_id : XM_001472118.1

name	4930502E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626044 CCDS:CCDS30136.1 GeneID:75013 MGI:1922263
definition	codon_start : 1 product : hypothetical protein LOC75013 protein_id : NP_083418.1

name	1700013H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20946689 GeneID:75514 MGI:1922764
definition	codon_start : 1 product : hypothetical protein LOC75514 protein_id : XP_135430.1

name	EG547172 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001198 GeneID:547172 MGI:3646091
definition	codon_start : 1 product : similar to 60S ribosomal protein L38 protein_id : XP_622034.2

name	Zfp36l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222290 CCDS:CCDS30138.1 GeneID:333473 MGI:3525151
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 36-like 3 protein_id : NP_001009549.1

name	Xlr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756021 CCDS:CCDS30139.1 GeneID:22441 MGI:98976
definition	codon_start : 1 note : X-linked gene family of B-cell surface antigens product : X-linked lymphocyte-regulated protein pM1 protein_id : NP_035855.1

name	LOC100040719 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271613 GeneID:100040719
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475176.1

name	LOC100040260 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271605 GeneID:100040260
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474867.1

name	LOC100040271 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271607 GeneID:100040271
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474887.1

name	LOC100040317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271609 GeneID:100040317
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474902.1

name	LOC100040317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271611 GeneID:100040317
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474919.1

name	LOC625508 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83001216 GeneID:625508
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895179.1

name	LOC666096 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407433 GeneID:666096
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986693.1

name	LOC100040867 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271615 GeneID:100040867
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475466.1

name	LOC100040894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271617 GeneID:100040894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475498.1

name	LOC666122 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407438 GeneID:666122
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986862.1

name	LOC666135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407440 GeneID:666135
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986936.1

name	EG666151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407444 GeneID:666151 MGI:3645943
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987057.1

name	EG666161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407446 GeneID:666161 MGI:3643207
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987134.1

name	4930527E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271620 GeneID:75140 MGI:1922390
definition	codon_start : 1 product : hypothetical protein LOC75140 protein_id : XP_001472016.1

name	4930527E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271622 GeneID:75140 MGI:1922390
definition	codon_start : 1 product : hypothetical protein LOC75140 isoform 3 protein_id : XP_982009.2

name	LOC100039066 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271627 GeneID:100039066
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472168.1

name	LOC100040730 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040730
definition	number : 1 pseudo : _no_value

name	LOC100040730 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040730
definition	number : 2 pseudo : _no_value

name	LOC100040765 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040765
definition	number : 1 pseudo : _no_value

name	LOC194788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194788
definition	number : 1 pseudo : _no_value

name	LOC194788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194788
definition	number : 2 pseudo : _no_value

name	LOC194788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194788
definition	number : 3 pseudo : _no_value

name	LOC194788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194788
definition	number : 4 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 1 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 2 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 3 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 4 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 5 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 6 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 7 pseudo : _no_value

name	LOC100040789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040789
definition	number : 8 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 1 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 2 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 3 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 4 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 5 pseudo : _no_value

name	LOC666072 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666072
definition	number : 6 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 1 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 2 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 3 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 4 pseudo : _no_value

name	LOC625476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625476
definition	number : 5 pseudo : _no_value

name	LOC100038960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038960
definition	number : 1 pseudo : _no_value

name	LOC100038960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038960
definition	number : 2 pseudo : _no_value

name	LOC100038960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038960
definition	number : 3 pseudo : _no_value

name	LOC100038960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038960
definition	number : 4 pseudo : _no_value

name	LOC100038960 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038960
definition	number : 5 pseudo : _no_value

name	EG666199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666199
definition	number : 1 pseudo : _no_value

name	EG666199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666199
definition	number : 2 pseudo : _no_value

name	EG666199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666199
definition	number : 3 pseudo : _no_value

name	EG666199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666199
definition	number : 4 pseudo : _no_value

name	EG666199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666199
definition	number : 5 pseudo : _no_value

name	EG666199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666199
definition	number : 6 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 1 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 2 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 3 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 4 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 5 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 6 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 7 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 8 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 9 pseudo : _no_value

name	LOC626274 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271623 GeneID:626274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Xlr-like pseudo : _no_value transcript_id : XR_030541.1

name	LOC625210 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271624 GeneID:625210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Xlr-like pseudo : _no_value transcript_id : XR_035648.1

name	LOC100039055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271625 GeneID:100039055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Xlr-like pseudo : _no_value transcript_id : XR_030561.1

clone name	MSMg01-177A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075F15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-538A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-381I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-112F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-377J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-178N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313E05
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-145O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001D10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-024J24.b	B6Ng01-024J24.g
ACC	DH856203	DH856204
length	688	1,148
definition	DH856203\|Mus musculus domesticus DNA, BAC clone: B6Ng01-024J24, 5' end.	DH856204\|Mus musculus domesticus DNA, BAC clone: B6Ng01-024J24, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcatgaaaaacaaactgaagaccagtcttcattgtcctctacctgg tattgaaagtccagattgccgacatttgtatatataggccgcaaactgcc tccaaaaccagaggctcctctcagcctgagaagttctgggtcttcagaca taattcaggccaggctgtgtttatttatgcattgttttggtttagggaag tgaactctaactttgtatctcaggagtgtcagaaacctcatgtgcagctt ggacttgccttgaaactgaagtcctcagccttacaaatgtactggggcct gagggaacatgcctgctttatttttttttaattttattttcattgttgaa gattgaaaccagagtttcttgctgtagcagtaaaatatatgtccagccag gcagaactttataatttacatttgctttagatttgtattgcaatgaaaaa gattgaggaacttgcttgtgataataagaactatgattttatttggagat tgaaatgcagacaaagttgcttaattttatcaaaaacctgcaggaatcgg accaaaatgcagatcctcctatgattagatataaaccaaattgatgtcac agttaaagccaccatagcgtttttgtgtgtgtgtgtgagaaagagagaga gagagagagagagagagagagagagagagagagagagt	gaattcctaggacttgctggctgcttgtctagctgcatgttcagtgacag aacatgtcttaagggaataaggtagaaagtaaaagagcaacagccaacaa tctcctctgccctccacatatgtatacatgtaccacagacacaaacatgc aaaaaaataaaataaaaatgaagtttcattaatgtcacacctcttcaaaa agcaccattttcacctctataccatagaaaaaaataagtccatggggcta aatcaaaaatatttgcaagagtctgtgtcatgggtagactttgtgtgctg actctgcacctagtctcacaataccaacaggaaactcaactcccaggtgc tctagtactcccaagatcacaagaatggctttaacatcagaagtaactga gtccccaaggatccagggacacaggaactcctaccttgccagatgcatcc ccaacatctggagtaactcagtcccaaaggatccagggacacaggcattc ttgccttggcagtggcatggttccctattggtctgaaactatagctggat cagacctggggtactgcctttgtacccactcttaaaacacccagaaggag ctcaactctcgggtatctgaaatgcccaagatcacaggatcacaaaagaa gcatgactccacggagatcagacaaaccaagggacactccagttctgaca gaagatcacagctgagggcacaacatcttgcccaacaccctgtgtatctg acaccccccacataaaccagggaaagaaaaacaccctcccagacagaggc atgggttccttgcagcttgcatctgtgtccagagaaaaactagtgacttg gcaccccaccaaatcttgcaacaccaagaaaatcttcactccccggagct ctgacacaggatctcagagattggttataccagggtttgaggatccagag cagcttgacttccacgagcttagacataccagcatatcaggatcccagga tcccttgatccagagaacagctggactctgatgagttctgtcacaaccag gtttacaggagggagagctccaggtcgagactgcaggcagtagtacaaag aaatgaaattgtgtggaagggtagccacagaaaatatgccaagttgaa
quality values	Open. Hide. 61 47 24 38 61 38 35 49 61 61 55 61 61 61 52 41 61 61 61 61 61 61 61 61 61 49 59 38 43 37 43 49 59 59 43 52 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 59 61 59 59 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 55 59 61 61 61 61 59 55 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 53 50 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 50 61 61 61 61 61 61 61 61 61 46 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 47 43 57 57 47 47 57 57 53 52 57 53 53 57 53 53 47 53 53 57 57 57 38 53 47 53 57 53 53 52 50 57 57 53 53 47 47 57 53 47 42 47 53 57 53 53 38 57 53 53 57 57 52 57 57 50 52 41 37 52 57 53 57 57 53 57 57 53 57 57 57 57 57 39 57 53 57 52 57 53 57 43 57 47 57 46 57 57 57 57 53 57 53 57 53 57 53 57 53 57 53 57 52 57 57 57 53 57 44 57 39 57 53 47 34 57 46 57 47 57 46 57 46 53 37 27 19 22 10 23 8 17 7 15 9 4	Open. Hide. 43 37 13 38 50 23 31 19 16 11 19 11 16 25 49 55 43 50 55 55 49 50 61 55 55 55 55 52 52 52 52 52 52 55 55 52 39 55 61 55 52 49 38 43 52 55 59 59 52 52 59 59 59 59 59 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 59 59 52 52 59 52 49 59 59 45 52 49 39 45 59 59 61 61 61 61 59 59 61 59 59 59 61 59 59 59 59 59 59 52 59 59 59 52 59 52 59 35 52 52 36 33 49 59 52 59 59 41 59 59 52 59 52 59 61 61 49 59 59 52 52 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 59 43 52 59 59 59 52 59 59 59 59 52 59 59 61 59 59 59 59 59 61 55 55 55 61 55 55 55 41 55 52 35 55 55 55 55 55 55 55 55 52 55 49 55 55 61 52 55 61 55 52 55 52 55 52 55 55 55 55 52 52 52 52 55 55 52 61 55 55 55 55 52 55 55 61 52 55 55 55 61 61 61 61 55 55 55 61 55 55 55 55 55 61 55 61 61 61 61 61 61 55 61 55 55 55 61 55 61 55 55 55 55 50 55 50 47 50 43 50 50 61 55 55 55 55 50 50 50 50 55 43 55 55 50 50 61 61 61 61 55 61 55 49 50 55 55 55 61 55 55 50 55 50 61 55 55 55 55 50 43 47 50 53 53 52 53 47 43 50 43 61 53 50 50 52 50 50 43 61 50 47 61 53 50 61 61 61 52 53 53 52 61 50 50 32 61 50 50 50 50 50 50 50 61 61 50 61 53 50 50 53 50 50 50 61 43 61 53 53 47 50 53 61 43 53 52 53 45 47 61 61 61 61 61 61 61 61 61 61 61 53 61 61 46 47 50 50 61 50 47 42 35 47 42 53 53 61 43 53 52 50 53 46 53 57 53 57 50 47 52 47 52 53 50 50 32 47 57 53 53 36 47 53 47 57 53 52 53 57 45 53 57 57 34 53 53 53 52 43 53 47 42 47 46 57 57 57 57 50 57 53 47 53 53 52 53 53 53 53 53 50 53 53 47 47 52 53 53 57 57 57 47 38 38 57 53 53 53 53 53 57 47 47 50 52 50 53 50 53 53 53 53 53 47 47 53 53 37 43 38 53 53 52 53 57 57 47 42 41 53 53 42 46 57 57 41 42 53 30 47 53 46 35 53 53 53 53 53 43 35 19 33 47 37 53 57 34 41 36 52 53 17 57 46 31 57 53 53 36 53 50 57 57 53 53 46 38 53 38 37 42 50 53 53 28 25 23 40 53 38 57 52 27 38 33 53 34 48 35 53 33 21 57 29 36 48 40 53 36 53 53 52 27 57 38 28 40 35 38 33 37 33 53 40 57 22 40 30 27 34 29 30 28 40 33 33 40 28 40 57 40 33 33 37 43 33 57 46 22 23 30 33 53 44 47 33 37 43 47 44 37 40 35 31 32 36 46 38 23 29 22 35 30 29 30 29 40 31 32 31 6 45 24 27 28 34 25 32 32 30 40 47 44 33 44 31 51 32 29 33 29 28 29 51 29 30 36 37 48 29 24 29 30 29 29 29 17 27 29 46 46 46 51 41 29 29 30 44 26 46 29 29 29 29 27 37 30 33 37 29 16 34 33 37 36 36 31 24 36 46 38 20 24 51 29 22 24 31 28 23 18 20 16 18 24 28 30 34 51 32 25 33 22 33 26 12 18 26 25 23 31 35 32 29 23 24 29 23 28 29 26 29 28 21 27 24 27 29 15 35 51 41 41 40 28 28 28 20 18 31 22 18 23 22 23 24 28 22 32 51 44 28 17 24 26 25 38 17 19 27 15 26 28 26 22 22 29 21 25 40 9 26 16 40 51 34 38 25 34 18 29 25 24 20 22 28 51 38 27 22 14 32 14 28 27 19 27 23 20 9 9 10 12 27 16 12 8 26 28 22 6 6 7 8 22 15 15 17 20 6 5 11 18 23 30 27 15 12 33 15 9 44 11 17 28 6 23 21 14 20 8 29 10 19 19 15 25 22 19 18 17 31 19 17 24 23 24 9 21 29 9 20 11 29 14 17 20 9 12 13 12 20 15 16 23 17 29 29 11 13 16 18 26 10 18 12 19 13 12 33 22 20 11 9 21 24 12 36 25 9 10 7 3 5 10 26 7 6 18 5 9 11 14 11 24 19 23 14 12 13 10 12 10 9 11 25 19 10 9 4 19 8 15 10 20 11 11 3 2 3 10 10 23 11 15 8 4 27 8 11 5 1 4 4 19 11 32 9 7 4 18 3 7 5 4 21 5 7 6 14 4 1 4 5 17 11 6 8 14 7 8 4 1 4 2 3 5 3 17 6 14 3 22 7 6 14 22 13 7 5 8 6 4 3 6 16 7 10 4 7 10 9 4 14 24 13 12 15 4 18 20 4 3 3 4 18 4 3 3 3 4 3 10 12 6 4 5 4 6 4 5 10 13

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_52022865_52023551
seq2: B6Ng01-024J24.b_47_733

seq1  GAATTCATGAAAAACAAACTGAAGACCAGTCTTCATTGTCCTCTACCTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGAAAAACAAACTGAAGACCAGTCTTCATTGTCCTCTACCTGG  50

seq1  TATTGAAAGTCCAGATTGCCGACATTTGTATATATAGGCCGCAAACTGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGAAAGTCCAGATTGCCGACATTTGTATATATAGGCCGCAAACTGCC  100

seq1  TCCAAAACCAGAGGCTCCTCTCAGCCTGAGAAGTTCTGGGTCTTCAGACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAAACCAGAGGCTCCTCTCAGCCTGAGAAGTTCTGGGTCTTCAGACA  150

seq1  TAATTCAGGCCAGGCTGTGTTTATTTATGCATTGTTTTGGTTTAGGGAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTCAGGCCAGGCTGTGTTTATTTATGCATTGTTTTGGTTTAGGGAAG  200

seq1  TGAACTCTAACTTTGTATCTCAGGAGTGTCAGAAACCTCATGTGCAGCTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACTCTAACTTTGTATCTCAGGAGTGTCAGAAACCTCATGTGCAGCTT  250

seq1  GGACTTGCCTTGAAACTGAAGTCCTCAGCCTTACAAATGTACTGGGGCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTTGCCTTGAAACTGAAGTCCTCAGCCTTACAAATGTACTGGGGCCT  300

seq1  GAGGGAACATGCCTGCTTTATTTTTTTTTAATTTTATTTTCATTGTTGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGAACATGCCTGCTTTATTTTTTTTTAATTTTATTTTCATTGTTGAA  350

seq1  GATTGAAACCAGAGTTTCTTGCTGTAGCAGTAAAATATATGTCCAGCCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGAAACCAGAGTTTCTTGCTGTAGCAGTAAAATATATGTCCAGCCAG  400

seq1  GCAGAACTTTATAATTTACATTTGCTTTAGATTTGTATTGCAATGAAAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAACTTTATAATTTACATTTGCTTTAGATTTGTATTGCAATGAAAAA  450

seq1  GATTGAGGAACTTGCTTGTGATAATAAGAACTATGATTTTATTTGGAGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGAGGAACTTGCTTGTGATAATAAGAACTATGATTTTATTTGGAGAT  500

seq1  TGAAATGCAGACAAAGTTGCTTAATTTTATCAAAAACCTGCAGGAATCGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAATGCAGACAAAGTTGCTTAATTTTATCAAAAACCTGCAGGAATCGG  550

seq1  ACCAAAATGCAGATCCTCCTATGATTAGATATAAACCAAATTGATGTCAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAAAATGCAGATCCTCCTATGATTAGATATAAACCAAATTGATGTCAC  600

seq1  AGTTAAAGCCACCATAGCGTTTTTGTGTGTGTGTGTGAGAAAGAGAGAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAAAGCCACCATAGCGTTTTTGTGTGTGTGTGTGAGAAAGAGAGAGA  650

seq1  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG  687
      |||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG  687

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information