MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-027N16
Chromosome	X (Build37)
Map Location	32,995,261 - 32,996,411
singlet/doublet	singlet
Overlap gene	EG665074
Upstream gene	LOC385298, LOC100039460, LOC100040781, LOC100039515, LOC100039522, LOC100039473, LOC100039550, LOC100039557, LOC100039573, LOC100039585
Downstream gene	LOC100039497, EG210457, Dock11, Il13ra1, Zcchc12, LOC547166, Lonrf3, EG621901
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC385298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100039460 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100039515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039522 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100039550 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039557 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	EG665074 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665074 MGI:3648576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 ESTs

name	LOC100039585 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG210457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210457 MGI:3648336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	Dock11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75974 MGI:1923224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il13ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16164 MGI:105052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72693 MGI:1919943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC547166 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 8 Proteins pseudo : _no_value

name	Lonrf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74365 MGI:1921615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621901 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621901 MGI:3644556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271471 GeneID:100040781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001475289.1

name	LOC100039515 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271476 GeneID:100039515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC100039515 transcript_id : XM_001473228.1

name	LOC100039473 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271474 GeneID:100039473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472945.1

name	LOC100039550 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271482 GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : Xlr-related, meiosis regulated Xmr, transcript variant 2 transcript_id : XM_001473275.1

name	LOC100039550 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271480 GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : Xlr-related, meiosis regulated Xmr, transcript variant 1 transcript_id : XM_001473259.1

name	LOC100039557 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271484 GeneID:100039557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC100039557 transcript_id : XM_001473294.1

name	EG665074 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271491 GeneID:665074 MGI:3648576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 ESTs product : predicted gene, EG665074 transcript_id : XM_974384.2

name	LOC100039585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271489 GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001473346.1

name	LOC100039585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271487 GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001473331.1

name	EG210457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83000804 GeneID:210457 MGI:3648336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG210457 transcript_id : XM_141682.3

name	Dock11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125660463 GeneID:75974 MGI:1923224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dedicator of cytokinesis 11 transcript_id : NM_001009947.3

name	Il13ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129910 GeneID:16164 MGI:105052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 13 receptor, alpha 1 transcript_id : NM_133990.4

name	Zcchc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803251 GeneID:72693 MGI:1919943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 12 transcript_id : NM_028325.2

name	Lonrf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043954 GeneID:74365 MGI:1921615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LON peptidase N-terminal domain and ring finger 3 transcript_id : NM_028894.1

name	EG621901 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407282 GeneID:621901 MGI:3644556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG621901 transcript_id : XM_896717.2

name	LOC100040781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271472 GeneID:100040781
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475339.1

name	LOC100039515 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271477 GeneID:100039515
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473278.1

name	LOC100039473 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271475 GeneID:100039473
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472995.1

name	LOC100039550 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271481 GeneID:100039550
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473309.1

name	LOC100039550 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271483 GeneID:100039550
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473325.1

name	LOC100039557 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271485 GeneID:100039557
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473344.1

name	LOC100039585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271488 GeneID:100039585
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473381.1

name	LOC100039585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271490 GeneID:100039585
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473396.1

name	EG665074 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271492 GeneID:665074 MGI:3648576
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979478.2

name	EG210457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83000805 GeneID:210457 MGI:3648336
definition	codon_start : 1 product : similar to testis derived transcript protein_id : XP_141682.3

name	Dock11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125660464 GeneID:75974 MGI:1923224
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0051020 - GTPase binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0017048 - Rho GTPase binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IDA] codon_start : 1 note : spleen specific 238 kDa protein with PH domain product : dedicator of cytokinesis 11 protein_id : NP_001009947.2

name	Il13ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254373 CCDS:CCDS30057.1 GeneID:16164 MGI:105052
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 product : interleukin 13 receptor, alpha 1 protein_id : NP_598751.3

name	Zcchc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312230 CCDS:CCDS30058.1 GeneID:72693 MGI:1919943
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, CCHC domain containing 12 protein_id : NP_082601.1

name	Lonrf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043955 CCDS:CCDS30059.1 GeneID:74365 MGI:1921615
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004176 - ATP-dependent peptidase activity [Evidence IEA]; GO:0005185 - neurohypophyseal hormone activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006510 - ATP-dependent proteolysis [Evidence IEA] codon_start : 1 product : ring finger protein 127 protein_id : NP_083170.1

name	EG621901 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407283 GeneID:621901 MGI:3644556
definition	codon_start : 1 product : similar to Novel transcript protein_id : XP_901810.2

name	LOC385298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385298
definition	number : 1 pseudo : _no_value

name	LOC385298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385298
definition	number : 2 pseudo : _no_value

name	LOC385298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385298
definition	number : 3 pseudo : _no_value

name	LOC100039460 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039460
definition	number : 2 pseudo : _no_value

name	LOC100039460 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039460
definition	number : 1 pseudo : _no_value

name	LOC100039497 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039497
definition	number : 1 pseudo : _no_value

name	LOC100039522 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271478 GeneID:100039522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_031104.1

name	LOC100039573 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271486 GeneID:100039573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_031148.1

name	LOC547166 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271479 GeneID:547166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 8 Proteins product : similar to 60S ribosomal protein L13a (Transplantation antigen P198) (Tum-P198 antigen) pseudo : _no_value transcript_id : XR_031016.1

clone name	MSMg01-178I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-304H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-064D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140G24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-163B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-411E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494C05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-108P19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-355A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-455B06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-272H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-027N16.b	B6Ng01-027N16.g
ACC	DH858489	DH858490
length	1,029	1,169
definition	DH858489\|Mus musculus domesticus DNA, BAC clone: B6Ng01-027N16, 5' end.	DH858490\|Mus musculus domesticus DNA, BAC clone: B6Ng01-027N16, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcccagcacccacattgcagctaacaactgtctttaagtccagttg cagggtaactaatgcctgcttctgagctctgcaggctcaaggcacaagtg tgagactcatacatatacgtgagctaagcatttatatataaaatcttttt taaagtctcacaaattttaaaataaactaaagcaacccagatgaaagcag gaatcaaattttttaaaatctctttttcccttccttccttccttccttcc ttccttcctttctttcttccttcctactttttttttaaagtaggatatca catatcctaggagttactcagaatcattatttttttctaaaggtttattt ttattcatgtgtatatgtgtgttattgtttatataagtgttacatgtgta cagctctacatgttgactaaaagagggtgtcagacccattggagctatgg gcagttatgagctgcccaatatgggtgtgtgggactgaattctagtcccc tagaagagcagcaaacactctttacttacccagtaatctctctagtccct cagacataccatgcactcacagttagcctttaatttctgatcctcacacc cctacatccaaagatctccctgtaccatcatgaccagcaggatgaaatct cttgaaaacctggaataagtttgttaataacagcacatgagcaggagaga gctaagtgttctaaataagtcaagcttaaagaagaaagttaacattacat tctccataaatatcagaataccatttatgatacatttatccactgtatat atgatatatattttcccatatccatatgatatatatatctccattcaagc actaaattgacatgtatggtatgcatttgtttaatatagatgctagcatt taagtctttgataagtcacaatccatataccacagagattagtaaagagt atgggactaaagtagagggaagatattcaaggagcaaaatagattataga cttattggtggggatatatggggaatgga	gaattctcacctgaggaatactgaatggccgagaagcacctgaaaaagtg ttcagcatccttaatcatcagagaaatgcaaatcaaaataaccctgagat tccacttcacaccagtcagaatggctaagatcataaattcaggtgacagc agatgctggcaaggatgtggagaaagaggaacactcatccattgttggtg ggattgcaagcttttacaaccactctggaaatcagtctggtggttcctca taaaattgcacataatactaccggagaatcctgcaatacctcttctgggc atatatccagaaaatgttccaactggtgagaaggacacatgctcccctat gttcatagcaggattatttataatagccagaagctggaaagaacccagat gtccctcaacagaggaatggatacaaaaaatttggtacatttacttaatg gtgtactactaagctattaaaaggaatgaatttatgaaattgctaggcaa atgtttggacctggagggcattatcctgagtgaggtaacacaatcacaaa agaactcacatgatatgtactcactgataagtggatattagcccagaaac ttagtatacccgagatgtgagatacaatttgcaaaacacatgaaactgta gaagaatgaagaccaaagtgtggacactttgccccttcttagcattgaga ataaacgcccatgaaaggagttacagagacaaagtttggagcagagacga aaggatggaccatctagagactgccatatccagggattcaccccataatc agccttccaaacgatgacaccaatgcatacactagcaagcgtttgctgaa ggaacttgatatagctgtcttttgtgagactaggctgcggcctagaaaac acagaagtggatgctgacagtcagctatggatggatcacaggccccaatg gaaggagctagagaaagtattcaaggtgctttagagatctgcactctgta gatgcacaacattatgaactagtgtccctgtagcctcttgatcaagctgc atagtaacaaagaaggccaagtcggccatcactggaaagaagtccaatgg attgcactttatttccttatacagggaaacccgggccaaaacgggatatg tttagtagagatgacggtg
quality values	Open. Hide. 61 61 24 32 61 61 50 24 24 61 55 55 61 61 47 35 61 41 61 61 61 47 47 61 43 43 12 13 28 10 10 18 26 28 21 19 36 59 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 52 52 52 30 30 37 28 49 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 59 59 61 61 59 55 59 61 61 61 61 61 59 59 61 61 59 59 61 61 61 59 59 61 61 61 61 61 59 61 61 59 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 59 59 59 61 61 59 55 55 59 55 55 59 61 61 61 61 61 59 55 61 61 59 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 49 52 49 59 41 49 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 50 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 53 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 43 61 50 53 61 61 61 61 53 61 61 61 61 61 61 61 50 61 53 61 61 61 61 61 61 61 61 61 47 52 61 61 61 61 53 61 61 61 52 53 46 52 53 53 53 53 47 47 53 61 37 43 61 34 61 53 37 36 61 61 61 50 52 53 53 52 53 46 52 57 57 40 43 52 40 53 50 50 47 53 47 43 46 32 45 52 53 46 47 31 30 47 57 47 42 40 53 52 53 53 53 53 42 57 53 47 47 53 50 57 47 57 50 40 57 53 45 52 53 46 47 53 50 43 32 35 53 45 50 38 53 52 42 52 45 53 50 53 33 52 45 52 57 53 29 52 39 52 45 43 50 38 51 40 45 37 9 47 50 37 33 57 53 39 33 57 32 38 42 32 52 37 31 36 50 36 57 57 33 52 47 17 57 53 52 42 50 39 42 50 39 36 42 42 28 32 22 53 53 45 39 21 33 24 32 17 57 24 38 30 38 27 33 29 41 36 38 36 32 42 30 24 57 57 34 28 50 40 23 38 38 16 20 57 53 29 33 32 53 23 44 28 53 21 33 24 28 24 29 19 28 53 25 29 37 33 21 39 24 57 57 53 29 57 41 24 40 40 23 35 29 14 31 44 37 37 41 17 29 20 48 29 27 28 29 40 37 37 28 36 11 37 40 33 14 43 29 40 13 29 29 6 14 17 5 7 19 25 21 21 29 44 25 21 29 48 38 9 32 27 33 31 19 25 51 41 32 26 47 24 37 46 19 24 28 29 28 29 21 17 24 14 29 15 29 15 17 51 34 27 29 16 26 37 25 51 33 16 18 6 30 29 39 20 26 20 37 25 28 26 33 33 31 31 28 16 30 16 13 7 29 18 12 29 22 19 12 37 7 12 9 29 51 25 22 28 23 33 15 29 23 51 9 46 16 28 19 46 29 15 29 14 15 36 14 41 28 28 29 9 26 10 13 25 35 34 26 31 23 23 21 17 18 20 41 51 20 18 15 15 43 28 23 10 15 10 5 13 15 32 7 5 32 11 27 16 5 23 31 36 5 9 6 8 9 6 10 29 41 26 18 14 5 12 10 14 9	Open. Hide. 61 47 47 47 49 10 10 13 11 18 11 20 17 14 10 25 34 52 52 52 55 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 45 29 30 17 18 26 24 37 52 59 59 61 61 61 61 61 61 61 61 59 59 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 50 53 53 50 50 50 61 61 61 52 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 50 47 43 45 52 50 50 50 52 61 61 61 61 53 61 61 53 61 61 61 50 61 61 53 61 61 53 61 47 61 61 61 53 61 47 47 61 61 47 61 53 61 61 42 40 50 61 61 61 61 61 53 53 40 53 53 53 57 52 53 57 57 57 57 57 53 53 50 52 53 47 43 53 53 47 40 40 57 53 47 53 53 53 53 39 42 47 53 50 53 47 47 47 53 28 42 38 53 53 57 53 45 47 38 52 42 47 53 53 57 57 53 52 27 53 57 53 47 42 40 33 53 53 57 37 47 34 53 57 39 24 28 57 43 26 52 17 19 52 47 37 37 50 23 44 45 43 41 47 45 53 40 57 45 50 34 32 37 47 44 45 52 23 45 43 32 20 32 37 35 47 47 24 42 24 31 57 53 50 18 57 33 31 37 41 35 37 39 37 47 50 28 36 41 45 57 43 16 53 45 29 52 45 24 37 24 26 57 19 29 30 28 53 40 27 35 57 53 53 47 52 14 30 37 30 57 30 30 23 14 53 42 25 24 52 32 37 53 53 34 14 53 23 37 35 37 35 25 40 27 35 36 31 42 28 37 18 37 33 33 28 34 24 53 19 32 23 9 16 29 18 47 48 52 45 30 31 25 33 40 37 22 22 18 11 12 8 31 12 19 35 34 31 21 32 29 24 35 22 20 28 27 31 20 28 37 17 23 30 24 31 26 34 36 29 17 27 28 31 30 30 17 11 46 10 29 28 32 24 34 17 20 32 23 30 17 21 30 22 29 31 34 30 26 17 23 29 35 16 12 13 5 7 11 20 19 25 29 10 30 8 29 26 13 47 19 29 29 15 18 27 28 28 28 11 5 30 47 47 29 26 21 28 25 28 38 30 22 30 25 30 23 21 30 33 25 26 30 19 24 23 28 29 24 13 22 34 20 43 25 24 29 28 28 33 11 22 14 12 12 10 30 18 9 33 46 26 9 33 31 34 25 10 8 29 5 17 8 21 29 22 16 15 7 10 39 29 7 4 8 21 28 27 19 22 31 12 6 21 21 10 5 10 7 5 16 10 16 12 12 30 20 9 34 24 22 14 16 29 17 25 8 21 12 16 12 25 17 21 10 31 19 23 23 27 31 22 33 28 14 15 36 19 9 5 5 8 51 29 14 35 15 12 6 15 10 10 19 21 23 12 11 10 6 5 5 13 13 15 33 18 10 7 5 13 9 9 6 4 8 33 7 5 5 9 4 11 8 11 7 11 11 13 19 16 22 13 25 10 15 19 6 17 9 19 10 14 31 13 9 19 17 5 4 4 12 5 4 5 4 4 12 8 15 20 9 7 6 4 8 6 3 8 15 15 12 13 5 4 5 10 6 6 5 12 10 28 7 12 11 11 7 4 4 29 29 8 19 14 21 22 7 5 9 8 16 20 5 9 7 5 4 5 3 4 5 12 8 9 2 4 3 4 5 5 4 11 5 6 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_32995261_32996411
seq2: B6Ng01-027N16.b_47_1075

seq1  GAATTCCCAGCACCCACATTGCAGCTAACAACTGTCTTTAAGTCCAGTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCAGCACCCACATTGCAGCTAACAACTGTCTTTAAGTCCAGTTG  50

seq1  CAGGGTAACTAATGCCTGCTTCTGAGCTCTGCAGGCTCAAGGCACAAGTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGTAACTAATGCCTGCTTCTGAGCTCTGCAGGCTCAAGGCACAAGTG  100

seq1  TGAGACTCATACATATACGTGAGCTAAGCATTTATATATAAAATCTTTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGACTCATACATATACGTGAGCTAAGCATTTATATATAAAATCTTTTT  150

seq1  TAAAGTCTCACAAATTTTAAAATAAACTAAAGCAACCCAGATGAAAGCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGTCTCACAAATTTTAAAATAAACTAAAGCAACCCAGATGAAAGCAG  200

seq1  GAATCAAATTTTTTAAAATCTCTTTTTCCCTTCCTTCCTTCCTTCCTTCC  250
      ||||||||||||||||||||||||||||    ||||||||||||||||||
seq2  GAATCAAATTTTTTAAAATCTCTTTTTC----CCTTCCTTCCTTCCTTCC  246

seq1  TTCCTTCCTTCCTTTCTTTCTTCCTTCCTACTTTTTTTTTAAAGTAGGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTCCTTCCTTTCTTTCTTCCTTCCTACTTTTTTTTTAAAGTAGGAT  296

seq1  ATCACATATCCTAGGAGTTACTCAGAATCATTATTTTTTTCTAAAGGTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACATATCCTAGGAGTTACTCAGAATCATTATTTTTTTCTAAAGGTTT  346

seq1  ATTTTTATTCATGTGTATATGTGTGTTATTGTTTATATAAGTGTTACATG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTATTCATGTGTATATGTGTGTTATTGTTTATATAAGTGTTACATG  396

seq1  TGTACAGCTCTACATGTTGACTAAAAGAGGGTGTCAGACCCATTGTAGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  TGTACAGCTCTACATGTTGACTAAAAGAGGGTGTCAGACCCATTGGAGCT  446

seq1  ATGGGCAGTTATGAGCTGCCCAATATGGGTGTGTGGGACTGAATTCTAGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGCAGTTATGAGCTGCCCAATATGGGTGTGTGGGACTGAATTCTAGT  496

seq1  CCCCTAGAAGAGCAGCAAACACTCTTTACTTACCCAGTAATCTCTCTAGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTAGAAGAGCAGCAAACACTCTTTACTTACCCAGTAATCTCTCTAGT  546

seq1  CCCTCAGACATACCATGCACTCACAGTTAGCCTTTAATTTCTGATCCTCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCAGACATACCATGCACTCACAGTTAGCCTTTAATTTCTGATCCTCA  596

seq1  CACCCCTACATCCAAAGATCTCCCTGTACCATCATGACCAGCAGGATGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCCTACATCCAAAGATCTCCCTGTACCATCATGACCAGCAGGATGAA  646

seq1  ATCTCTTGAAAACCTGGAATAAGTTTGTTAATAACAGCACATGAGCAGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCTTGAAAACCTGGAATAAGTTTGTTAATAACAGCACATGAGCAGGA  696

seq1  GAGAGCTAAGTGTTCTAAATAAGTCAAGCTTAAAGAAGAAAGTTAACATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGCTAAGTGTTCTAAATAAGTCAAGCTTAAAGAAGAAAGTTAACATT  746

seq1  ACATTCTCCATAAATATCAGAATACCATTTATGATACATTTATCCACTGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTCTCCATAAATATCAGAATACCATTTATGATACATTTATCCACTGT  796

seq1  ATATATGATATATATTTTCCCATATCCATATGATATATATATCTCCATTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATGATATATATTTTCCCATATCCATATGATATATATATCTCCATTC  846

seq1  AAGCACTAAAATGACATGTATGGTATGCATTTGTTTAAATATAGATGCTA  900
      |||||||||| ||||||||||||||||||||||||| |||||||||||||
seq2  AAGCACTAAATTGACATGTATGGTATGCATTTGTTT-AATATAGATGCTA  895

seq1  GCATTTAAGTCTTTGATAAGTCACAATCCATATAACCACAGAGATTAGGT  950
      ||||||||||||||||||||||||||||||||| ||||||||||||| ||
seq2  GCATTTAAGTCTTTGATAAGTCACAATCCATAT-ACCACAGAGATTA-GT  943

seq1  AAAGAGTATGGAACTAAAGTAGAGGGAAGAATATTCAAAGGAGCAAAAAT  1000
      ||||||||||| ||||||||||||||||| |||||| ||||||| |||||
seq2  AAAGAGTATGGGACTAAAGTAGAGGGAAG-ATATTC-AAGGAGC-AAAAT  990

seq1  AGAATTATAGACTTATTGGTGGGGATATATGGGGATTGGAAGTGAAGACT  1050
      || |||||||||||||||||||||||||||||||| ||||          
seq2  AG-ATTATAGACTTATTGGTGGGGATATATGGGGAATGGA----------  1029

seq1  AAATAAAGATGGGGAAGGAACAGGAAGTGGAGTCGAATGCCTGTGGCGAG  1100
                                                        
seq2  --------------------------------------------------  1029

seq1  GGAGAGTTATAACTAAGGATTATTTGTGGGTGGTTGTATGCCGTTAATGG  1150
                                                        
seq2  --------------------------------------------------  1029

seq1  A  1151
       
seq2  -  1029

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information