MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-052H18
Chromosome	X (Build37)
Map Location	58,408,164 - 58,409,345
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Atp11c, LOC666517, LOC631784, LOC100039611, LOC100039621, Gm715, Hspa9-ps1, EG236831, LOC666559, LOC671636, Sox3, EG631922, Rpl7l1-ps, LOC627159
Downstream gene	EG631990, LOC632000, LOC100039759, EG245440, LOC100039778, Ldoc1, LOC654353, EG627299, LOC666654, LOC385367
Link	Open Mouse BAC browser

Click to get alignment info.

name	Atp11c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320940 MGI:1859661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC666517 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 6 Proteins pseudo : _no_value

name	LOC631784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gm715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279618 MGI:2685561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins

name	Hspa9-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15527 MGI:96246
definition	gene_synonym : 70kDa; Hsc74-ps1; Hsp74-ps1; Hsp74b; Hspa9b note : heat shock protein 9, pseudogene 1 pseudo : _no_value

name	EG236831 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236831 MGI:3648723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC666559 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 262 ESTs, 2 Proteins pseudo : _no_value

name	LOC671636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Sox3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20675 MGI:98365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG631922 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631922 MGI:3646842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Rpl7l1-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:207216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC627159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 8 Proteins

name	EG631990 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631990 MGI:3644361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC632000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC100039759 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG245440 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245440 MGI:3647289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 19 Proteins

name	LOC100039778 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Ldoc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434784 MGI:2685212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC654353 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654353
definition	note : eukaryotic translation initiation factor 4E pseudogene pseudo : _no_value

name	EG627299 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627299 MGI:3648616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 1 Protein

name	LOC666654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC385367 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Atp11c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83745142 GeneID:320940 MGI:1859661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Atpase, class VI, type 11C transcript_id : NM_001001798.2

name	Atp11c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83745136 GeneID:320940 MGI:1859661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Atpase, class VI, type 11C transcript_id : NM_001037863.1

name	LOC631784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142354747 GeneID:631784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC631784 transcript_id : NM_001039240.2

name	LOC100039621 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271644 GeneID:100039621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039621 transcript_id : XM_001473214.1

name	Gm715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271650 GeneID:279618 MGI:2685561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 4 Proteins product : gene model 715, (NCBI) transcript_id : XM_205232.5

name	Sox3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678070 GeneID:20675 MGI:98365
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 3 transcript_id : NM_009237.1

name	EG631922 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271648 GeneID:631922 MGI:3646842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG631922 transcript_id : XM_001473355.1

name	EG245440 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271653 GeneID:245440 MGI:3647289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 19 Proteins product : predicted gene, EG245440 transcript_id : XM_001473465.1

name	Ldoc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66348057 GeneID:434784 MGI:2685212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper, down-regulated in cancer 1 transcript_id : NM_001018087.1

name	EG627299 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271655 GeneID:627299 MGI:3648616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 1 Protein product : predicted gene, EG627299 transcript_id : XM_891956.3

name	Atp11c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49355804 GeneID:320940 MGI:1859661
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Atpase 11c, p type product : Atpase, class VI, type 11C isoform b protein_id : NP_001001798.1

name	Atp11c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745137 GeneID:320940 MGI:1859661
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Atpase 11c, p type product : Atpase, class VI, type 11C isoform a protein_id : NP_001032952.1

name	LOC631784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:85986649 GeneID:631784
definition	codon_start : 1 product : hypothetical protein LOC631784 protein_id : NP_001034329.1

name	LOC100039621 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271645 GeneID:100039621
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473264.1

name	Gm715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746741 GeneID:279618 MGI:2685561
definition	codon_start : 1 product : similar to RIKEN cDNA 1810013L24 gene protein_id : XP_205232.2

name	Sox3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678071 CCDS:CCDS30161.1 GeneID:20675 MGI:98365
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030900 - forebrain development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048515 - spermatid differentiation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : transcription factor product : SRY-box containing gene 3 protein_id : NP_033263.1

name	EG631922 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271649 GeneID:631922 MGI:3646842
definition	codon_start : 1 product : similar to Heat shock factor protein 1 (HSF 1) (Heat shock transcription factor 1) (HSTF 1) protein_id : XP_001473405.1

name	EG245440 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271654 GeneID:245440 MGI:3647289
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473515.1

name	Ldoc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66348058 CCDS:CCDS30163.1 GeneID:434784 MGI:2685212
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : breast cancer, up-regulated 1 product : leucine zipper, down-regulated in cancer 1 protein_id : NP_001018097.1

name	EG627299 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271656 GeneID:627299 MGI:3648616
definition	codon_start : 1 product : similar to nuclear receptor co-repressor protein_id : XP_897049.3

name	LOC100039611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039611
definition	number : 2 pseudo : _no_value

name	LOC100039611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039611
definition	number : 1 pseudo : _no_value

name	EG236831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:236831
definition	number : 1 pseudo : _no_value

name	LOC671636 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671636
definition	number : 1 pseudo : _no_value

name	LOC671636 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671636
definition	number : 2 pseudo : _no_value

name	Rpl7l1-ps (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:207216
definition	number : 1 pseudo : _no_value

name	EG631990 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631990
definition	number : 1 pseudo : _no_value

name	LOC100039759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039759
definition	number : 3 pseudo : _no_value

name	LOC100039759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039759
definition	number : 2 pseudo : _no_value

name	LOC100039759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039759
definition	number : 1 pseudo : _no_value

name	LOC100039778 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039778
definition	number : 1 pseudo : _no_value

name	LOC666654 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666654
definition	number : 1 pseudo : _no_value

name	LOC385367 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385367
definition	number : 1 pseudo : _no_value

name	LOC666517 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271647 GeneID:666517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 6 Proteins product : similar to interferon-inducible protein 16 pseudo : _no_value transcript_id : XR_031128.1

name	LOC666559 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271646 GeneID:666559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 262 ESTs, 2 Proteins product : similar to farnesyl pyrophosphate synthase pseudo : _no_value transcript_id : XR_031145.1

name	LOC627159 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271651 GeneID:627159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 8 Proteins product : similar to Steroid hormone receptor ERR2 (Estrogen-related receptor, beta) (ERR-beta) (Estrogen receptor-like 2) (ERR beta-2) transcript_id : XR_001579.2

name	LOC632000 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271652 GeneID:632000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to CG4090-PA pseudo : _no_value transcript_id : XR_031221.1

clone name	MSMg01-114K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413E11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464B19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-505I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239B11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-052H18.b	B6Ng01-052H18.g
ACC	DH875829	DH875830
length	1,169	812
definition	DH875829\|Mus musculus domesticus DNA, BAC clone: B6Ng01-052H18, 5' end.	DH875830\|Mus musculus domesticus DNA, BAC clone: B6Ng01-052H18, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccataaatattttataaataagagattcatcacaatgaatatggc ttcttaatgggctaagaggagctctgtgtgctagaaaagatgtgggctcc atggcctgccatttgctcctttactgagaagcagtcatcattgatcactg tcacttatgacatgacaggcagttcactagtttttggttttgatttggtt ttattttcattgctattgtttgtgttttgttttaaccataatggaaataa gcagtataaacatcaacttctaacatattgggacagttataaggatctat agcaaagaaagtattttcatgaaaactgttagtctcatacaataactgca tgtgttctggaaaaataaactatattaatttgctagtatgagtgtatccc aaccatatcatttcttttataacaggtttaaataattaaagataattact tatcttaacacctgatttaataataaagaggaataaattaaaaggtttgt gtagaatgagagaaatgttaaaaacataaaaactatatggacctaccaat taattgtcaattcttcctgtatcatcaactaataaataagataaaatttc tcaggaagaagaaattttcaacactgagtactttacagaacacaaaccta aagttgcaggaagcaacaggacatttctacatctactttgtgtcaaactc tgtcctgtccctaagaaagcatgcaaacaggttacaaagctaataagcac ctgagttcagatttgagcttacctcttttgtgtcctctctatcatacata ctaaaaaaataaacgatccatcacaagtatactacacgctgaaaatcctc atcactactgtttgactttatccttcttccccacaaacattctaggtact atctgagccagatctgtggatttcaaatcctcattaaacacaacatactt ccagctggtgtatctttgcactaggctactgcactgtattatcactgtgc atttcacttcacctacagttcaacttgtaagctacacaatcagcctttgg attgtttttcatctcctccacaatgcacaatgttaatagcctggtggcga atgcagtaatgacatccaattggagtagattcccttgatcattactcact ggtggcctgtctgccaagt	gaattcctgatctttccaagacttttatcatatatcatcaggatgggtgt tggattttgtcatatgctttcttagcatcctatgtgtttttttcctttga gtttgtttatatagtttatatatttatattgtttatatagtgggttacat tgatggatttacatatattaaaccatccctgcatccctgggatgaagcct acttgatcatgatggatgattgttttgatgtgtttttggattcagtttgt gagaattttattgagtatttttgcatcgatattcataagggaaattggtc tgactgaagttctcttttttagttgggtctttgtgtggtttaggtatcag aataattgtggcttcatagaatgaattgggtagagtaccttctgtttcta ttttgtgaaatagtttgaggagaattggaattaggtcttctttgaaggtc tgatagaagtctgcattaaacctatctggtcctgggcttttttttttttt tttttttttttttttttttttttttggggtgggagggtattaatgactgc tttttttttctttaggggaaatggggctgtttatattgttaatgtgatcc gaatttaactttgggacccggtatctgtctagaaatttttccttttcatc caagttttccagttttggtgaataaaaccttttggaaaggatctgatggg gtttggaatttttcgaaactgttgttagcccccttttccttctaaattgt taattaaaatgcggtccctgggcccctaatgagctgggtaagtgttatct atctggaaattt
quality values	Open. Hide. 61 41 24 43 61 61 38 19 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 47 61 52 49 32 44 23 28 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 39 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 52 61 61 57 42 57 57 57 53 57 53 57 57 57 53 57 57 57 57 57 57 57 57 57 53 57 57 53 53 47 43 57 57 53 53 57 53 57 57 53 47 53 57 47 57 57 50 57 57 57 53 57 53 53 52 53 53 53 57 40 57 57 53 53 57 50 57 57 57 52 57 57 50 53 33 53 47 57 52 43 57 57 57 53 50 45 36 57 57 47 38 57 47 38 57 57 39 38 57 57 57 53 38 57 53 50 53 57 57 43 34 53 53 50 53 57 57 45 53 41 34 57 57 53 50 50 50 57 53 53 57 53 45 57 57 37 46 57 52 50 52 30 57 53 50 42 50 52 53 53 45 41 57 52 45 45 53 57 57 53 52 50 52 24 53 50 50 45 52 53 57 53 52 41 41 38 44 50 34 46 40 53 53 50 53 38 42 52 50 46 26 38 57 53 50 35 37 24 53 57 52 29 42 40 42 53 40 35 57 33 40 33 44 43 16 52 37 42 28 57 53 40 44 48 25 37 42 32 53 27 41 33 37 48 44 53 52 20 33 31 37 32 35 48 30 57 30 27 48 29 47 37 33 37 32 40 40 43 28 57 57 44 30 29 35 29 32 53 40 53 40 53 33 41 37 37 24 30 30 41 27 44 32 48 36 39 51 51 46 46 46 31 29 39 51 31 32 27 40 30 29 41 27 33 39 30 40 31 31 30 38 34 29 25 29 29 29 39 28 33 23 37 39 33 41 51 46 29 30 33 43 29 37 30 33 37 28 29 31 33 30 24 43 16 51 41 23 35 23 29 51 36 24 26 29 30 17 36 29 28 29 35 51 46 31 27 30 30 46 29 20 21 23 29 29 28 21 18 8 6 12 27 23 26 18 27 23 23 36 12 29 28 22 16 26 15 28 29 28 14 33 27 15 14 51 29 28 25 51 20 27 29 39 34 28 23 30 27 21 51 27 23 26 26 29 7 21 23 28 25 27 22 27 28 30 15 20 34 27 34 20 8 9 5 9 13 28 23 51 32 22 12 19 13 24 17 22 27 28 31 23 22 21 36 22 21 31 28 18 7 6 4 10 23 17 20 12 19 14 17 11 8 18 18 18 35 28 12 13 7 20 22 25 13 14 25 30 6 18 10 31 27 22 27 20 30 12 19 5 6 15 12 30 17 18 14 14 20 6 10 9 29 9 12 9 9 19 19 14 29 33 10 8 30 13 7 13 6 30 37 34 3 4 8 10 12 8 6 5 7 10 19 4 16 11 23 12 13 11 6 10 4 9 10 24 15 11 10 6 5 12 11 23 16 11 21 8 7 12 19 3 1 3 19 4 12 19 15 23 7 5 7 4 8 4 4 15 5 13 9 17 5 4 5 12 9 16 3 3 7 9 20 10 8 16 30 20 6 8 14 7 9 9 7 7 4 21 8 10 6 6 5 4 3 10 7 18 13 10 16 7 15 4 4 4 7 14 20 6 16 6 6	Open. Hide. 61 49 49 49 61 52 36 28 43 19 20 27 32 43 43 61 37 28 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 52 61 59 59 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 55 61 61 61 61 61 61 61 55 61 61 61 61 55 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 38 26 19 12 34 37 26 37 37 55 49 26 50 50 55 43 37 43 49 49 28 49 26 31 31 37 50 50 37 43 43 37 55 55 55 34 36 24 17 55 43 26 14 37 33 29 19 15 20 10 11 11 18 25 13 19 14 18 19 17 16 19 18 8 11 9 8 10 9 18 18 35 22 24 27 16 17 16 31 25 22 24 14 21 16 24 50 29 25 10 10 20 11 28 31 21 13 14 10 24 20 11 14 17 32 8 38 14 12 13 16 11 5 10 17 27 22 26 24 14 20 15 8 16 21 25 38 16 21 30 38 14 27 30 10 18 21 18 10 19 10 14 19 10 13 17 22 12 8 13 16 12 9 14 6 8 27 19 20 12 11 13 21 22 12 25 10 30 32 34 31 8 24 10 12 12 18 27 16 12 9 17 20 19 13 14 10 8 13 8 10 12 10 9 14 21 14 7 7 15 23 12 23 17 17 15 20 12 17 8 7 12 8 16 22 30 33 23 23 20 10 20 14 8 8 15 8 4 5 7 6 6 12 20 14 20 16 10 12 10 8 7 16 12 24 24 10 12 14 18 9 5 8 17 16 11 9 18 10 10 20 13 12 8 19 19 7 15 16 16 24 19 8 14 10 8 10 8 24 24 30 7 14 9 12 10 17 13 15 12 12 8 8 10 8 7 8 8 13 23 12 9 13 11 8 8 10 7 14 15 22 18 14 27 10 10 12 14 8 5 14 10 10 19 12

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_58408164_58409345
seq2: B6Ng01-052H18.b_47_1215 (reverse)

seq1  ACTTGGCAG-CAGGCCACCAAGTGAGTTATTGATCCAGGGGAATCTACTC  49
      ||||||||| ||||||||| |||||| || |||| || ||||||||||||
seq2  ACTTGGCAGACAGGCCACC-AGTGAG-TAATGAT-CAAGGGAATCTACTC  47

seq1  CAATTTGGATTGTCACTACTGCATTTCTGCCACCAGGCTATTAACATTGT  99
      ||| ||||| ||||| |||||||||   ||||||||||||||||||||||
seq2  CAA-TTGGA-TGTCATTACTGCATT--CGCCACCAGGCTATTAACATTGT  93

seq1  GCATTTGTGGA-GAGATGAAAAAC-ATTCAAAGGCTGATTTGTGTAGCTT  147
      ||| ||||||| |||||||||||| || |||||||||| |||||||||||
seq2  GCA-TTGTGGAGGAGATGAAAAACAATCCAAAGGCTGA-TTGTGTAGCTT  141

seq1  AACAAGTTTGAACTGTAAGGTGAAGTGAAATGCACAGTGATAATTAACAG  197
       ||||| ||||||||| |||||||||||||||||||||||||||  ||||
seq2  -ACAAG-TTGAACTGT-AGGTGAAGTGAAATGCACAGTGATAAT--ACAG  186

seq1  TGCAGTAGCCTAGTTGCAAAGATACACCAGCTGGAAGTATGTTGTGTTTA  247
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TGCAGTAGCCTAG-TGCAAAGATACACCAGCTGGAAGTATGTTGTGTTTA  235

seq1  ATGAGGATTTGAAATCCACAGATCTGGCTCAGATAGTACCTAGAATGTTT  297
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  ATGAGGATTTGAAATCCACAGATCTGGCTCAGATAGTACCTAGAATG-TT  284

seq1  TGTGGGGAAGAAGGATAAAGTCAAACAGTAGTGATGAGGATTTTCAGCGT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGGGAAGAAGGATAAAGTCAAACAGTAGTGATGAGGATTTTCAGCGT  334

seq1  GTAGTATACTTGTGATGGATCGTTTATTTTTTTAGTATGTATGATAGAGA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGTATACTTGTGATGGATCGTTTATTTTTTTAGTATGTATGATAGAGA  384

seq1  GGACACAAAAGAGGTAAGCTCAAATCTGAACTCAGGTGCTTATTAGCTTT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACACAAAAGAGGTAAGCTCAAATCTGAACTCAGGTGCTTATTAGCTTT  434

seq1  GTAACCTGTTTGCATGCTTTCTTAGGGACAGGACAGAGTTTGACACAAAG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAACCTGTTTGCATGCTTTCTTAGGGACAGGACAGAGTTTGACACAAAG  484

seq1  TAGATGTAGAAATGTCCTGTTGCTTCCTGCAACTTTAGGTTTGTGTTCTG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATGTAGAAATGTCCTGTTGCTTCCTGCAACTTTAGGTTTGTGTTCTG  534

seq1  TAAAGTACTCAGTGTTGAAAATTTCTTCTTCCTGAGAAATTTTATCTTAT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGTACTCAGTGTTGAAAATTTCTTCTTCCTGAGAAATTTTATCTTAT  584

seq1  TTATTAGTTGATGATACAGGAAGAATTGACAATTAATTGGTAGGTCCATA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTAGTTGATGATACAGGAAGAATTGACAATTAATTGGTAGGTCCATA  634

seq1  TAGTTTTTATGTTTTTAACATTTCTCTCATTCTACACAAACCTTTTAATT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTTTTATGTTTTTAACATTTCTCTCATTCTACACAAACCTTTTAATT  684

seq1  TATTCCTCTTTATTATTAAATCAGGTGTTAAGATAAGTAATTATCTTTAA  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCCTCTTTATTATTAAATCAGGTGTTAAGATAAGTAATTATCTTTAA  734

seq1  TTATTTAAACCTGTTATAAAAGAAATGATATGGTTGGGATACACTCATAC  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTAAACCTGTTATAAAAGAAATGATATGGTTGGGATACACTCATAC  784

seq1  TAGCAAATTAATATAGTTTATTTTTCCAGAACACATGCAGTTATTGTATG  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCAAATTAATATAGTTTATTTTTCCAGAACACATGCAGTTATTGTATG  834

seq1  AGACTAACAGTTTTCATGAAAATACTTTCTTTGCTATAGATCCTTATAAC  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTAACAGTTTTCATGAAAATACTTTCTTTGCTATAGATCCTTATAAC  884

seq1  TGTCCCAATATGTTAGAAGTTGATGTTTATACTGCTTATTTCCATTATGG  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCCAATATGTTAGAAGTTGATGTTTATACTGCTTATTTCCATTATGG  934

seq1  TTAAAACAAAACACAAACAATAGCAATGAAAATAAAACCAAATCAAAACC  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAACAAAACACAAACAATAGCAATGAAAATAAAACCAAATCAAAACC  984

seq1  AAAAACTAGTGAACTGCCTGTCATGTCATAAGTGACAGTGATCAATGATG  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACTAGTGAACTGCCTGTCATGTCATAAGTGACAGTGATCAATGATG  1034

seq1  ACTGCTTCTCAGTAAAGGAGCAAATGGCAGGCCATGGAGCCCACATCTTT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCTTCTCAGTAAAGGAGCAAATGGCAGGCCATGGAGCCCACATCTTT  1084

seq1  TCTAGCACACAGAGCTCCTCTTAGCCCATTAAGAAGCCATATTCATTGTG  1147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGCACACAGAGCTCCTCTTAGCCCATTAAGAAGCCATATTCATTGTG  1134

seq1  ATGAATCTCTTATTTATAAAATATTTATGGAATTC  1182
      |||||||||||||||||||||||||||||||||||
seq2  ATGAATCTCTTATTTATAAAATATTTATGGAATTC  1169

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information