MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-080P23
Chromosome	X (Build37)
Map Location	18,444,108 - 18,445,195
singlet/doublet	singlet
Overlap gene	EG628855
Upstream gene	EG436196, EG331391, Dusp21, LOC100043951, Utx, LOC100043952, 4930578C19Rik, LOC100043098
Downstream gene	LOC385333, EG628871, LOC100043953, BC049702, LOC675558
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG436196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436196 MGI:3646107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	EG331391 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331391 MGI:3643621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	Dusp21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73547 MGI:1920797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Utx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22289 MGI:1095419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043952 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	4930578C19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75905 MGI:1923155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein

name	EG628855 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628855 MGI:3647357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC385333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG628871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628871 MGI:3645666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100043953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	BC049702 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278255 MGI:3037654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675558 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG436196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271054 GeneID:436196 MGI:3646107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : predicted gene, EG436196 transcript_id : XM_488332.2

name	EG331391 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271056 GeneID:331391 MGI:3643621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : predicted gene, EG331391 transcript_id : XM_285437.3

name	Dusp21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037324 GeneID:73547 MGI:1920797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 21 transcript_id : NM_028568.1

name	Utx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859491 GeneID:22289 MGI:1095419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitously transcribed tetratricopeptide repeat gene, X chromosome transcript_id : NM_009483.1

name	4930578C19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347804 GeneID:75905 MGI:1923155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930578C19 gene transcript_id : NM_175228.3

name	LOC100043098 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271001 GeneID:100043098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein product : hypothetical protein LOC100043098 transcript_id : XM_001477741.1

name	EG628855 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271058 GeneID:628855 MGI:3647357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG628855 transcript_id : XM_893647.3

name	BC049702 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379409 GeneID:278255 MGI:3037654
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049702 transcript_id : NM_207524.2

name	EG436196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271055 GeneID:436196 MGI:3646107
definition	codon_start : 1 product : similar to KIAA0026 protein_id : XP_488332.2

name	EG331391 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271057 GeneID:331391 MGI:3643621
definition	codon_start : 1 product : similar to KIAA0026 protein_id : XP_285437.3

name	Dusp21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037325 CCDS:CCDS30036.1 GeneID:73547 MGI:1920797
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : novel dual specificity phosphatase, catalytic domain containing protein product : dual specificity phosphatase 21 protein_id : NP_082844.1

name	Utx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859492 CCDS:CCDS30037.1 GeneID:22289 MGI:1095419
definition	GO_component : GO:0005742 - mitochondrial outer membrane translocase complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 product : ubiquitously transcribed tetratricopeptide repeat gene, X chromosome protein_id : NP_033509.1

name	4930578C19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424860 CCDS:CCDS30038.1 GeneID:75905 MGI:1923155
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC75905 protein_id : NP_780437.1

name	LOC100043098 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271002 GeneID:100043098
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477791.1

name	EG628855 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271059 GeneID:628855 MGI:3647357
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898740.3

name	BC049702 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430510 CCDS:CCDS30039.1 GeneID:278255 MGI:3037654
definition	codon_start : 1 product : hypothetical protein LOC278255 protein_id : NP_997407.1

name	LOC100043951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043951
definition	number : 1 pseudo : _no_value

name	LOC100043952 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043952
definition	number : 2 pseudo : _no_value

name	LOC100043952 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043952
definition	number : 1 pseudo : _no_value

name	LOC385333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385333
definition	number : 1 pseudo : _no_value

name	LOC385333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385333
definition	number : 2 pseudo : _no_value

name	EG628871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628871
definition	number : 1 pseudo : _no_value

name	EG628871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628871
definition	number : 2 pseudo : _no_value

name	EG628871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628871
definition	number : 3 pseudo : _no_value

name	EG628871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628871
definition	number : 4 pseudo : _no_value

name	LOC100043953 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043953
definition	number : 1 pseudo : _no_value

name	LOC675558 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675558
definition	number : 1 pseudo : _no_value

name	LOC675558 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675558
definition	number : 2 pseudo : _no_value

name	LOC675558 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675558
definition	number : 3 pseudo : _no_value

clone name	MSMg01-474A05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-127M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-387O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062D10
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-080P23.b	B6Ng01-080P23.g
ACC	DH895975	DH895976
length	1,087	702
definition	DH895975\|Mus musculus domesticus DNA, BAC clone: B6Ng01-080P23, 5' end.	DH895976\|Mus musculus domesticus DNA, BAC clone: B6Ng01-080P23, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttttgaaatcctttcaccagggaaatttgatgacactcataagg gtgtttttagcactaatactagactggcttagaggacacctgctatgtga cttcatgtgtctgataatttcctgctcatactatgggctctctgagggca gagtggtgcctatcttgtctgttgtatataatgtctagtacctactaaga taattgcgcagtgggttttgtgaataatgaaatgaatgaagttggttttg tttgtttgtttacgggttgccttcttcccaaactgagttttctttgagtc aagactcctgtttctctaagtaggttcctttgttgttttaccttgggtca ccagttcaaacatgtcaagaaagaaatgagtgttttctaagatttttgca cacctcatctcttgacattgtgacacaacattgtcacttataaagttcac accaagaactatgtaatcaaattacaaaaatattcacaaaacctataatt tatttatgtgataattctgtattaatccacattagtagctgaagtactca tacacatctaagttttcaaagtataatgtaatggttttacttataatttt acaagtttatgatggggtggaaatgctatccttttggtgctttagatttt aagttcggttctattcctggagtagtgaagagatgacggacagaagcagt gagctatagctcctgctcagccctgatcgccagagaaaactactaacact ctatacagtgctatgttaataagcgagacacacagtatgataggtatgtc aaatgcacttgctacttactgagattttttatttatgatgagctcatgtg tatttaacgctattttcatttgaaaagcatctttacattttaaaaaggtt gttagagaatgcatactatgagcaggcttatgacagactgtacaatagat catgggtaaaaccaggaaaggtccttgatcttatgaaacttatatagggt tatttggaagaatatgttctaccagatagctaacctaatagtttacattg cattcagaaataaaaactaggatattgcagtaataaa	gaattcaatttcttgtatttgttgagacttgctttgtgactgactatagg gtctgtttggagagaattccattaggtgcagaaaagaaagtatattattt tgtgtttgggttaaatattctatagatgtctgttaggtccatctgattca taacatgttagttttattgtttctctgtttagttttggtctggatgatct gtcaacttgtgactatggggtgttgaattctcctaccactagtatgtggg gctcaatgtgtgatttaagctttagtaatgtttcttttacaaatgtgggt gcccttgtatttgaggcatagatattcagaattaaaatatcatcttcata gattttttccttttatgactatgaagtttccttctccaactcttttgatt acttttggttaaagtctatattattagatattagaattgctacttcaatt tgcttcttgtgtccatttgcttagaaaacttttgcccagtcctttactct gaggcaatgtctatctttattgctgagatatgtttcttgtatgcagcaga atcctgtttttgcattcattctgttagtttgtgtcattttattgggggaa ttgattccactgatgttgagagttactaatgaccagtgattgttaatttt ctgctatttttgatgttggtggtattcatgtgtgtgtgtgtgtgtggttt at
quality values	Open. Hide. 43 43 21 37 61 47 61 61 61 61 43 55 55 50 47 61 61 61 61 61 49 36 55 49 49 22 30 24 14 30 31 37 49 59 30 52 49 59 61 61 59 59 59 59 45 59 52 52 45 61 59 59 61 61 61 59 59 59 43 43 59 49 59 61 59 59 61 59 61 59 59 49 59 59 59 59 59 59 59 61 61 49 61 59 61 61 61 61 59 59 59 61 59 59 59 61 61 59 59 59 59 59 59 61 52 61 61 61 61 61 61 59 61 61 59 59 59 44 55 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 59 61 61 59 59 59 59 61 59 61 61 61 59 59 61 59 59 61 59 59 61 59 59 61 61 61 61 59 59 61 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 59 55 59 59 59 59 61 59 59 59 44 55 59 59 44 61 59 59 59 61 59 61 61 59 59 59 61 59 59 61 59 61 59 55 59 55 55 59 59 61 59 59 59 59 61 59 59 49 59 59 59 59 59 59 59 59 59 61 59 59 59 59 59 59 59 59 59 59 59 61 52 61 59 59 59 61 59 61 59 61 61 61 61 61 61 61 59 59 59 61 59 61 61 59 61 61 59 59 61 59 59 59 59 59 52 59 59 59 59 59 61 61 61 61 61 59 59 59 59 61 61 61 61 61 59 59 52 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 52 59 59 59 61 59 59 59 43 59 59 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 55 55 55 55 61 61 61 55 61 61 61 55 55 55 52 55 55 61 61 55 55 55 55 55 49 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 53 61 53 53 50 61 61 61 53 61 61 61 61 61 61 53 53 53 53 53 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 53 61 61 61 61 61 61 61 61 53 61 53 61 61 61 52 61 61 61 50 61 50 61 61 61 40 61 61 61 61 61 61 61 33 47 57 53 53 57 57 53 57 53 46 42 57 57 43 57 47 40 57 57 53 53 53 57 57 53 53 53 53 50 57 57 51 50 57 30 57 57 53 57 57 53 47 53 57 57 57 57 57 57 42 57 57 53 53 53 47 57 53 53 43 47 57 57 38 57 57 57 57 37 26 52 53 53 57 37 53 45 37 33 57 57 30 50 41 52 53 53 53 34 37 14 53 53 42 50 38 53 43 41 52 53 52 52 19 37 47 41 47 47 37 41 26 53 42 38 42 45 52 36 43 46 43 33 45 30 52 47 19 47 45 37 52 53 52 34 53 52 42 40 53 37 50 52 34 38 32 53 34 50 37 30 23 37 52 52 32 42 52 52 50 36 41 39 27 40 57 12 57 57 57 39 33 29 40 47 40 24 29 29 25 38 53 40 40 32 37 33 39 20 53 40 44 37 52 26 31 30 11 14 17 20 37 18 43 35 53 33 40 35 38 48 24 35 33 53 34 32 36 40 37 40 44 21 33 23 51 21 38 28 47 32 48 32 35 34 24 47 30 30 41 14 44 31 31 32 33 38 13 45 25 32 24 48 31 27 43 34 47 51 46 47 30 37 21 47 31 29 28 29 29 14 47 29 24 47 29 31 31 35 33 29 43 23 25 36 46 35 33 30 33 29 36 30 20 32 43 39 18 27 15 22 43 36 26 19 46 43 29 20 21 30 28 34 20 51 26 23 29 10 14 51 51 30 23 36 38 36 25 33 27 6 30 24 23 15 9 23 46 25 30 24 18 29 33 23 32 17 22 28 28 24 28 22 14 25 23 18 31 21 15 39 20 35 26 29 30 12 6 23 28 34 41 20 19 19 9 10 10 12 28 34 36 20 25 5 12 42 10 11 23 51 51 33 24 38 26 21 29 33 51 23 14 23 23 22 31 16 10 29 32 23 27 30 21 16 5 4 12 44 17 32 26 15 9 19 13 11 11 24 28 14 16 6 14 6 5 9 6 13 14 7 7 17 16 11 17 15 29 18 23 30 28 12 7 23 8 19 30 23 6 5 1 3 3 5 6 8 5 13 12 29 18 10 8 29 27 8 13 22 5 11 12 25 30 5 9 5 3 9 17 31 13 6 7 9 18 13 9 13 6 24 5 5 9 7 7 6 8 7 22 10 17 11 14 9 5 17 7 14	Open. Hide. 59 59 59 59 59 59 13 19 23 21 24 18 26 23 44 52 59 59 55 59 59 59 59 61 61 55 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 61 59 59 59 59 44 43 36 55 43 43 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 49 61 59 61 61 59 52 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 59 59 61 61 59 61 59 59 59 59 59 61 61 61 59 55 59 59 59 49 61 59 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 59 61 61 59 61 61 61 61 59 61 61 59 59 59 59 59 55 55 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 59 59 59 59 59 59 59 59 59 61 61 61 61 61 59 61 59 59 59 61 61 61 61 59 59 59 59 59 52 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 59 43 59 59 59 61 61 61 61 61 61 61 61 61 59 59 59 52 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 47 47 42 61 61 61 53 52 61 61 61 61 57 57 53 52 43 38 43 52 57 57 47 47 53 53 57 53 53 53 53 36 42 50 53 57 53 57 53 53 53 53 53 53 43 57 57 50 53 57 53 53 53 53 57 30 52 50 53 50 32 53 57 57 52 38 57 53 40 48 40 52 53 27 38 53 53 30 57 52 33 57 52 52 53 42 57 57 53 57 41 50 16 14 46 57 30 50 57 57 50 52 45 45 41 52 43 57 57 41 25 53 47 50 38 21 57 57 53 50 33 57 52 53 53 53 28 53 33 11 24 27 23 8 11 27 38 18 39 48 32 35 52 41 29 41 25 53 27 52 38 50 52 38 33 50 52 38 40 48 42 27 44 37 53 33 53 31 18 28 32 23 10 14 12 8 8 14 7 53 36 53 33 32 52 26 47 52 37 27 40 40 33 30 8 11 29 51 29 20 33 12 53 9 25 25 36 31 57 27 53 24 43 14 43 30 40 23 34 17 26 12 29 19 10 23 8 26 12 7 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_18444108_18445195
seq2: B6Ng01-080P23.b_45_1131 (reverse)

seq1  TTTATTACTGC-ATATCTTAGTTTTTATTTCTGATTGCAATTGTAACTAT  49
      ||||||||||| ||||| |||||||||||||||| ||||||   ||||||
seq2  TTTATTACTGCAATATCCTAGTTTTTATTTCTGAATGCAATGTAAACTAT  50

seq1  TTGTGTAACTATCTGGTTAGAACATA-TCTTCCATATAACCCTATATAAG  98
      | |  || |||||||| ||||||||| ||||||| |||||||||||||||
seq2  TAGGTTAGCTATCTGG-TAGAACATATTCTTCCAAATAACCCTATATAAG  99

seq1  TTTCATAAGATCAAGGACCTTTCCTGGTTTTACCCATTGATCTATTTGTA  148
      |||||||||||||||||||||||||||||||||||| ||||||| |||||
seq2  TTTCATAAGATCAAGGACCTTTCCTGGTTTTACCCA-TGATCTA-TTGTA  147

seq1  CAGTCTGTCATAAGCCTGCTCATAGTATGCATTCTCTAACAACCTTTTTA  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTGTCATAAGCCTGCTCATAGTATGCATTCTCTAACAACCTTTTTA  197

seq1  AAATGTAAAGATGCTTTTCAAATGAAAATAGCGTTAAATACACATGAGCT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTAAAGATGCTTTTCAAATGAAAATAGCGTTAAATACACATGAGCT  247

seq1  CATCATAAATAAAAAATCTCAGTAAGTAGCAAGTGCATTTGACATACCTA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCATAAATAAAAAATCTCAGTAAGTAGCAAGTGCATTTGACATACCTA  297

seq1  TCATACTGTGTGTCTCGCTTATTAACATAGCACTGTATAGAGTGTTAGTA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATACTGTGTGTCTCGCTTATTAACATAGCACTGTATAGAGTGTTAGTA  347

seq1  GTTTTCTCTGGCGATCAGGGCTGAGCAGGAGCTATAGCTCACTGCTTCTG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTCTCTGGCGATCAGGGCTGAGCAGGAGCTATAGCTCACTGCTTCTG  397

seq1  TCCGTCATCTCTTCACTACTCCAGGAATAGAACCGAACTTAAAATCTAAA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGTCATCTCTTCACTACTCCAGGAATAGAACCGAACTTAAAATCTAAA  447

seq1  GCACCAAAAGGATAGCATTTCCACCCCATCATAAACTTGTAAAATTATAA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCAAAAGGATAGCATTTCCACCCCATCATAAACTTGTAAAATTATAA  497

seq1  GTAAAACCATTACATTATACTTTGAAAACTTAGATGTGTATGAGTACTTC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAACCATTACATTATACTTTGAAAACTTAGATGTGTATGAGTACTTC  547

seq1  AGCTACTAATGTGGATTAATACAGAATTATCACATAAATAAATTATAGGT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTACTAATGTGGATTAATACAGAATTATCACATAAATAAATTATAGGT  597

seq1  TTTGTGAATATTTTTGTAATTTGATTACATAGTTCTTGGTGTGAACTTTA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTGAATATTTTTGTAATTTGATTACATAGTTCTTGGTGTGAACTTTA  647

seq1  TAAGTGACAATGTTGTGTCACAATGTCAAGAGATGAGGTGTGCAAAAATC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTGACAATGTTGTGTCACAATGTCAAGAGATGAGGTGTGCAAAAATC  697

seq1  TTAGAAAACACTCATTTCTTTCTTGACATGTTTGAACTGGTGACCCAAGG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAAAACACTCATTTCTTTCTTGACATGTTTGAACTGGTGACCCAAGG  747

seq1  TAAAACAACAAAGGAACCTACTTAGAGAAACAGGAGTCTTGACTCAAAGA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAACAACAAAGGAACCTACTTAGAGAAACAGGAGTCTTGACTCAAAGA  797

seq1  AAACTCAGTTTGGGAAGAAGGCAACCCGTAAACAAACAAACAAAACCAAC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCAGTTTGGGAAGAAGGCAACCCGTAAACAAACAAACAAAACCAAC  847

seq1  TTCATTCATTTCATTATTCACAAAACCCACTGCGCAATTATCTTAGTAGG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATTCATTTCATTATTCACAAAACCCACTGCGCAATTATCTTAGTAGG  897

seq1  TACTAGACATTATATACAACAGACAAGATAGGCACCACTCTGCCCTCAGA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTAGACATTATATACAACAGACAAGATAGGCACCACTCTGCCCTCAGA  947

seq1  GAGCCCATAGTATGAGCAGGAAATTATCAGACACATGAAGTCACATAGCA  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCCATAGTATGAGCAGGAAATTATCAGACACATGAAGTCACATAGCA  997

seq1  GGTGTCCTCTAAGCCAGTCTAGTATTAGTGCTAAAAACACCCTTATGAGT  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTCCTCTAAGCCAGTCTAGTATTAGTGCTAAAAACACCCTTATGAGT  1047

seq1  GTCATCAAATTTCCCTGGTGAAAGGATTTCAAAAGAATTC  1088
      ||||||||||||||||||||||||||||||||||||||||
seq2  GTCATCAAATTTCCCTGGTGAAAGGATTTCAAAAGAATTC  1087

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information