MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-085F22
Chromosome	X (Build37)
Map Location	77,575,009 - 77,575,897
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG667736, LOC100041373, EG636104, 2410003J06Rik, LOC667749, LOC211702, LOC667755, LOC211705, LOC654474, LOC629153
Downstream gene	LOC546338, LOC100042229, LOC667776, EG629182, Tmem47, LOC100041462, LOC100041474
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG667736 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667736 MGI:3643055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100041373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG636104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636104 MGI:3645063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	2410003J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 44 ESTs, 18 Proteins

name	LOC667749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC211702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:211702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC667755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	LOC211705 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:211705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins pseudo : _no_value

name	LOC654474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654474
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	LOC629153 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC546338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546338
definition	note : heterogeneous nuclear ribonucleoprotein A3 pseudogene pseudo : _no_value

name	LOC100042229 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC667776 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 462 ESTs, 14 Proteins pseudo : _no_value

name	EG629182 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629182 MGI:3648228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Tmem47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192216 MGI:2177570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100041474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG667736 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271782 GeneID:667736 MGI:3643055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG667736 transcript_id : XM_992119.2

name	LOC100041373 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271719 GeneID:100041373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100041373 transcript_id : XM_001476267.1

name	EG636104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271721 GeneID:636104 MGI:3645063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG636104 transcript_id : XM_001476286.1

name	2410003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271784 GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 18 Proteins product : RIKEN cDNA 2410003J06 gene, transcript variant 1 transcript_id : XM_135953.7

name	2410003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407568 GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 42 ESTs, 18 Proteins product : RIKEN cDNA 2410003J06 gene, transcript variant 2 transcript_id : XM_893039.2

name	LOC100042229 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271787 GeneID:100042229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042229 transcript_id : XM_001477903.1

name	Tmem47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270284 GeneID:192216 MGI:2177570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 47 transcript_id : NM_138751.1

name	Tmem47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365049 GeneID:192216 MGI:2177570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 47 transcript_id : NM_175771.3

name	LOC100041462 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271724 GeneID:100041462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to synaptosomal-associated protein 23 transcript_id : XM_001476422.1

name	EG667736 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271783 GeneID:667736 MGI:3643055
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997213.2

name	LOC100041373 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271720 GeneID:100041373
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476317.1

name	EG636104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271722 GeneID:636104 MGI:3645063
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476336.1

name	2410003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984446 GeneID:71967 MGI:1919217
definition	codon_start : 1 product : hypothetical protein LOC71967 isoform 1 protein_id : XP_135953.1

name	2410003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001575 GeneID:71967 MGI:1919217
definition	codon_start : 1 product : hypothetical protein LOC71967 isoform 2 protein_id : XP_898132.1

name	LOC100042229 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271788 GeneID:100042229
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477953.1

name	Tmem47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270285 CCDS:CCDS30254.1 GeneID:192216 MGI:2177570
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 10 product : transmembrane protein 47 protein_id : NP_620090.1

name	Tmem47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28461139 CCDS:CCDS30254.1 GeneID:192216 MGI:2177570
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 10 product : transmembrane protein 47 protein_id : NP_786965.1

name	LOC100041462 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271725 GeneID:100041462
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476472.1

name	LOC667749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667749
definition	number : 1 pseudo : _no_value

name	LOC211702 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211702
definition	number : 1 pseudo : _no_value

name	LOC667755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667755
definition	number : 1 pseudo : _no_value

name	LOC667755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667755
definition	number : 2 pseudo : _no_value

name	LOC629153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629153
definition	number : 1 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 4 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 3 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 2 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 1 pseudo : _no_value

name	LOC211705 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271723 GeneID:211705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins product : similar to prohibitin pseudo : _no_value transcript_id : XR_032681.1

name	LOC667776 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271789 GeneID:667776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 462 ESTs, 14 Proteins product : similar to Non-POU-domain-containing, octamer binding protein pseudo : _no_value transcript_id : XR_033448.1

name	EG629182 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271790 GeneID:629182 MGI:3648228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG629182 pseudo : _no_value transcript_id : XR_033453.1

clone name	MSMg01-292K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141F14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-327O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F21
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-085F22.b	B6Ng01-085F22.g
ACC	DH899060	DH899061
length	1,185	889
definition	DH899060\|Mus musculus domesticus DNA, BAC clone: B6Ng01-085F22, 5' end.	DH899061\|Mus musculus domesticus DNA, BAC clone: B6Ng01-085F22, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaacaactcacttaaagaaatacaggagaacactgctaaagagtt acaagtccttaaagaaaaacaggaaaacactgctaaagagttacaagtcc ttaaagaaaaacaggaaaacacaaccaaacaggtagaagtccttatagaa aaacaggaaaacacatccaaacaggtgatggaaatgaacaaaaccatact agacctaaaaagggaagtagacacaataaagaaaacccaaagtgaggcga cgctggagatagaaaccctaggaaagaaatctggaaccatagatgccagc atcagcaacagaatacaagagatggaagagagaatctcaggtgcagaaga ctccatagagaacatcggcacaacaatcaaagaaaatggaaaatgcaaaa agatcctaactcaaaacatccaggaaatccaggacacaatgagaagacca aacctacggataataggagtggatgagaatgaagattttcaactcaaagg accagcaaacatcttcaacaaaattattgaagaaaacttcccaaatctaa agaaagagatgcccatgaacatacaagaagcctacagaactccaaataga ctggaccagaaaagaaattcctcccgacacataataatcagaacaccaaa tgcactaaataaagatagaatactaaaagcagtaagggaaaaaggtcaag taacatataaaggcaagcctatcagaattacaccagatttttcaccagag actatgaaagccagaagagcctggtcagatgttatacagacactaagaga acataaatgccagcccaggctactatacccagccaaactctcaattacca tagatggagaaaccaaagtattccacgacaaaactaaattcacccattat ctctccacgaatccagcccttcaaaggataataacagaaaaaaaacaata caagacggaacacgccctagaaaaacaagaagataatccatcacaaacct aaaagagacaccacaagacagatgcactttacacaaaatacaggagcaca tacttctaatatctctatatcatggactcatcccataaaagactagacta ccgactgcctaacaaagaccacattcgctgctacggatccactcagcaaa gacggacctatcctcgagagtaagggcgtgttatc	gaattctataatggctccgggaagaaattaatctaggctgaggtagattt taaatggttttctaattccactaacagcagggaaaaatatagaagcagcc agaacccaccatctaatgagaaaagaaatacaagaaagaagcaagattgt tgtaattgctcctaagaggatattgaattcccactaactaaatctagctg tgacttcttaatggtaaaagcctatgggggtgagttcttgcctttcagag agaaagaatgaaaaaaaaaacacaatactgcactcttcttcaagcataag tacataatttttggtataggatagtacctaagtatggataattttattca ttcaagaggacagtcttttattatatatcaacttctttgtttttaaatgt taggaaaagcaaattaaaacccttaggataagtaaaattaccacagcaaa accctactggagaagcctgtgagaatttattttaattgacttgaatttaa gggcaaagatatgggtctacacatgaatagatattaatgttgcctatgta gaaggaggaggaaattcaaaggttgtgtcctcaataatgtaaagatctgg ctttctgaatagattgtgtagaccttagctagaatgtagtttagataggt agagacacaaatacaggaaaagtgatccttcttgcaggacatacagattt ttgcatgcttgattttataaatgagaacttttcattgatccttcattact cattaagtacaagaaagaataaaggtgtcccaaaccaatgaatctcagca cagaaatcttatcagcaggttagtgcatgtgggttatatatatatatata tatatatatatatatatatatatatatatatatatatgt
quality values	Open. Hide. 61 47 35 43 61 38 41 55 47 47 55 61 61 35 47 61 61 61 55 55 59 61 61 59 59 49 36 59 35 28 44 37 30 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 44 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 57 57 57 57 57 53 50 57 57 57 57 57 57 57 57 57 57 57 47 57 57 57 57 47 53 47 47 47 53 57 57 57 53 53 53 57 57 57 53 57 57 57 57 53 53 57 57 57 53 45 53 57 57 52 57 53 53 38 53 57 53 57 57 52 53 57 57 57 57 50 53 50 52 57 57 57 57 50 57 57 57 42 57 52 57 53 57 47 57 53 52 50 38 53 52 57 52 57 53 57 57 57 57 52 52 57 57 53 52 53 41 35 46 53 53 57 50 53 52 53 53 57 57 53 53 57 53 53 52 38 52 50 53 39 50 52 52 52 53 57 57 57 53 50 47 53 50 53 53 34 57 53 53 46 57 57 39 38 57 17 53 37 53 53 37 53 46 39 37 53 47 53 39 41 37 53 57 34 40 53 42 53 46 39 47 47 40 40 33 46 36 40 53 27 47 29 37 45 34 37 40 31 57 57 57 45 32 29 26 44 24 40 57 24 40 37 37 44 37 41 44 57 48 39 29 44 29 34 48 48 38 48 21 31 37 28 37 44 22 31 30 32 48 24 46 29 30 31 40 38 44 30 32 44 28 29 34 29 24 34 29 48 28 41 32 29 27 30 27 51 43 29 48 18 29 33 34 37 45 23 29 29 51 37 34 25 29 29 23 33 36 29 39 32 23 31 33 41 26 51 36 29 29 29 33 33 29 33 35 26 21 25 24 30 29 29 29 35 20 26 46 28 26 32 39 29 28 30 22 46 29 31 31 35 29 28 34 39 22 23 29 36 23 26 46 46 21 28 29 25 51 32 36 29 28 30 36 36 36 30 31 29 29 29 28 33 28 29 29 30 17 29 28 25 25 16 19 29 12 33 25 36 21 26 39 31 22 51 11 14 13 22 11 33 21 38 31 17 28 26 24 26 51 51 51 51 34 32 18 18 17 26 29 28 22 13 7 10 5 5 7 7 6 4 19 4 14 28 28 32 25 26 18 12 24 35 33 34 16 16 13 16 21 12 24 23 33 9 4 17 27 15 25 15 19 10 20 8 6 30 15 20 25 28 23 36 29 12 12 29 9 16 4 5 6 9 10 19 9 14 11 31 3 5 11 15 3 3 5 4 6 18 37 17 21 11 29 11 18 42 30 6 8 25 5 5 14 18 19 10 11 21 8 4 6 8 10 4 9 19 14 13 13 10 9 20 6 4 4 20 17 6 14 24 10 20 4 10 14 7 8 14 7 13 12 11 24 18 11 7 12 29 30 20 14 7 4 3 3 4 7 12 20 20 4 7 10 19 8 9 17 3 4 16 14 4 3 2 3 3 4 3 7 11 5 4 11 12 4 6 17 7 10 18 5 12 3 2 8 4 4 1 6 13 9 4 6 5 3 4 1 4 11 18 6 9 7 4 3 11 13 19 11 4 3 10 2 8 5 3 11 9 6 5 1 4 2 6 7 16 5 4 7 7 1 1 4 1 1	Open. Hide. 61 59 59 59 44 41 36 27 28 27 27 41 59 61 59 55 55 61 59 61 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 55 59 59 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 44 55 55 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 38 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 53 61 52 53 61 61 61 61 57 53 52 57 57 52 57 57 53 57 57 57 57 53 57 57 50 57 53 47 57 53 39 47 47 57 39 36 57 53 53 53 47 47 46 30 57 57 53 57 53 53 47 53 53 45 57 53 50 53 53 53 45 53 57 57 45 52 50 53 53 57 46 53 57 57 53 53 53 53 52 53 45 53 53 41 33 57 52 32 52 50 57 45 47 38 53 57 50 53 45 57 53 52 53 57 43 38 52 34 37 38 35 57 53 53 42 57 37 52 57 57 36 53 53 57 52 50 37 40 53 38 57 53 53 36 53 30 34 52 53 57 57 53 38 48 53 38 39 41 35 20 27 42 42 52 53 37 36 28 53 33 24 37 47 37 41 44 40 43 37 57 57 57 53 42 36 24 37 53 33 46 39 45 29 24 57 57 53 31 40 33 57 37 33 53 48 29 47 35 35 32 57 57 40 32 27 32 47 33 30 35 27 32 25 18 27 21 47 30 29 39 48 32 29 38 43 23 24 32 34 30 29 13 39 28 48 46 46 29 31 33 29 28 51 47 27 46 22 48 29 29 51 37 26 46 35 25 36 24 23 29 29 28 34 29 28 41 28 27 28 38 25 29 25 27 38 51 34 29 30 36 29 29 35 34 29 26 29 27 16 46 16 31 29 28 22 29 24 28 28 46 17 17 46 19 33 33 20 28 29 29 29 28 29 26 29 26 29 32 36 41 43 28 24 29 26 29 28 28 27 29 33 31 29 24 29 26 34 33 22 26 12 9 27 23 20 26 13 13 10 25 29 13 8 9 31 7 10 8 8 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_77575009_77575897
seq2: B6Ng01-085F22.g_66_954 (reverse)

seq1  ACATATATATATATATATATATATATATATATATATATATATATATATAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATATATATATATATATATATATATATATATATATATATATATATATAT  50

seq1  ATATAAACCACATGCACTAACCTGCTGATAAGATTTCTGTGCTGAGATTC  100
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAACCCACATGCACTAACCTGCTGATAAGATTTCTGTGCTGAGATTC  100

seq1  ATTGGTTTGGGACACCTTTATTCTTTCTTGTACTTAATGAGTAATGAAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGTTTGGGACACCTTTATTCTTTCTTGTACTTAATGAGTAATGAAGG  150

seq1  ATCAATGAAAAGTTCTCATTTATAAAATCAAGCATGCAAAAATCTGTATG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAATGAAAAGTTCTCATTTATAAAATCAAGCATGCAAAAATCTGTATG  200

seq1  TCCTGCAAGAAGGATCACTTTTCCTGTATTTGTGTCTCTACCTATCTAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGCAAGAAGGATCACTTTTCCTGTATTTGTGTCTCTACCTATCTAAA  250

seq1  CTACATTCTAGCTAAGGTCTACACAATCTATTCAGAAAGCCAGATCTTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACATTCTAGCTAAGGTCTACACAATCTATTCAGAAAGCCAGATCTTTA  300

seq1  CATTATTGAGGACACAACCTTTGAATTTCCTCCTCCTTCTACATAGGCAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTATTGAGGACACAACCTTTGAATTTCCTCCTCCTTCTACATAGGCAA  350

seq1  CATTAATATCTATTCATGTGTAGACCCATATCTTTGCCCTTAAATTCAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAATATCTATTCATGTGTAGACCCATATCTTTGCCCTTAAATTCAAG  400

seq1  TCAATTAAAATAAATTCTCACAGGCTTCTCCAGTAGGGTTTTGCTGTGGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATTAAAATAAATTCTCACAGGCTTCTCCAGTAGGGTTTTGCTGTGGT  450

seq1  AATTTTACTTATCCTAAGGGTTTTAATTTGCTTTTCCTAACATTTAAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTTACTTATCCTAAGGGTTTTAATTTGCTTTTCCTAACATTTAAAAA  500

seq1  CAAAGAAGTTGATATATAATAAAAGACTGTCCTCTTGAATGAATAAAATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGAAGTTGATATATAATAAAAGACTGTCCTCTTGAATGAATAAAATT  550

seq1  ATCCATACTTAGGTACTATCCTATACCAAAAATTATGTACTTATGCTTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCATACTTAGGTACTATCCTATACCAAAAATTATGTACTTATGCTTGA  600

seq1  AGAAGAGTGCAGTATTGTGTTTTTTTTTTCATTCTTTCTCTCTGAAAGGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAGTGCAGTATTGTGTTTTTTTTTTCATTCTTTCTCTCTGAAAGGC  650

seq1  AAGAACTCACCCCCATAGGCTTTTACCATTAAGAAGTCACAGCTAGATTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAACTCACCCCCATAGGCTTTTACCATTAAGAAGTCACAGCTAGATTT  700

seq1  AGTTAGTGGGAATTCAATATCCTCTTAGGAGCAATTACAACAATCTTGCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAGTGGGAATTCAATATCCTCTTAGGAGCAATTACAACAATCTTGCT  750

seq1  TCTTTCTTGTATTTCTTTTCTCATTAGATGGTGGGTTCTGGCTGCTTCTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCTTGTATTTCTTTTCTCATTAGATGGTGGGTTCTGGCTGCTTCTA  800

seq1  TATTTTTCCCTGCTGTTAGTGGAATTAGAAAACCATTTAAAATCTACCTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTTCCCTGCTGTTAGTGGAATTAGAAAACCATTTAAAATCTACCTC  850

seq1  AGCCTAGATTAATTTCTTCCCGGAGCCATTATAGAATTC  889
      |||||||||||||||||||||||||||||||||||||||
seq2  AGCCTAGATTAATTTCTTCCCGGAGCCATTATAGAATTC  889

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information