MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-113J02
Chromosome	X (Build37)
Map Location	4,789,968 - 4,791,082
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC627187, LOC100042185, OTTMUSG00000016407, OTTMUSG00000016437, OTTMUSG00000016420, LOC547057, EG546327, EG668965, LOC546185, LOC100043933, LOC670673, LOC100042254, LOC100043934, LOC100042267, LOC100042275, LOC668967, LOC434724, LOC100043935
Downstream gene	LOC668968, LOC546182, Mycs, LOC668969, LOC668970, OTTMUSG00000016453, LOC627412, LOC436185, LOC668971, LOC100043936, LOC668972, Nudt11, LOC208428, AU022751, Nudt10
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC627187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC100042185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	OTTMUSG00000016407 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627264 MGI:3709183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 11 ESTs, 10 Proteins

name	OTTMUSG00000016437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668964 MGI:3709272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	OTTMUSG00000016420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668963 MGI:3709274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC547057 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG546327 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546327 MGI:3704140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST pseudo : _no_value

name	EG668965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668965 MGI:3646752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	LOC546185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins

name	LOC100043933 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC670673 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100042254 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100043934 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100042267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100042275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC668967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC434724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 1 Protein

name	LOC100043935 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC668968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC546182 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	Mycs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17870 MGI:1332242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668969 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	OTTMUSG00000016453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434725 MGI:3709265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC627412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 202 ESTs, 10 Proteins pseudo : _no_value

name	LOC436185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC668971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100043936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC668972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 12 Proteins pseudo : _no_value

name	Nudt11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58242 MGI:1930957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC208428 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:208428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 447 ESTs, 1 Protein

name	AU022751 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102991 MGI:2147968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102954 MGI:2147931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270909 GeneID:100042185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : similar to 4930408F14Rik protein transcript_id : XM_001474570.1

name	OTTMUSG00000016407 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406954 GeneID:627264 MGI:3709183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 11 ESTs, 10 Proteins product : predicted gene, OTTMUSG00000016407 transcript_id : XM_891923.2

name	OTTMUSG00000016437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406957 GeneID:668964 MGI:3709272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016437 transcript_id : XM_001006598.1

name	OTTMUSG00000016420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406955 GeneID:668963 MGI:3709274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016420 transcript_id : XM_001006597.1

name	EG668965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270911 GeneID:668965 MGI:3646752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : predicted gene, EG668965 transcript_id : XM_001474644.1

name	LOC100042254 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270914 GeneID:100042254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474674.1

name	LOC100042267 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270916 GeneID:100042267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001474694.1

name	LOC100042275 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270918 GeneID:100042275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : similar to RIKEN cDNA 1700017G21 gene transcript_id : XM_001474710.1

name	LOC434724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406961 GeneID:434724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 1 Protein product : similar to RIKEN cDNA 1700017G21 gene transcript_id : XM_486608.4

name	LOC546182 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270920 GeneID:546182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : similar to 4930408F14Rik protein transcript_id : XM_001487800.1

name	Mycs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754769 GeneID:17870 MGI:1332242
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myc-like oncogene, s-myc protein transcript_id : NM_010850.1

name	OTTMUSG00000016453 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406963 GeneID:434725 MGI:3709265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016453 transcript_id : XM_486609.4

name	LOC436185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82999675 GeneID:436185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to SMPTB transcript_id : XM_488311.2

name	LOC668971 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406964 GeneID:668971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to SMPTB transcript_id : XM_001006607.1

name	LOC100043936 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270925 GeneID:100043936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001481245.1

name	Nudt11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384358 GeneID:58242 MGI:1930957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 11 transcript_id : NM_021431.2

name	LOC208428 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406967 GeneID:208428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 447 ESTs, 1 Protein product : similar to Mus musculus ribosomal protein L19 transcript_id : XM_141608.7

name	AU022751 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383176 GeneID:102991 MGI:2147968
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU022751 transcript_id : NM_001033211.2

name	Nudt10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384356 GeneID:102954 MGI:2147931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 10 transcript_id : NM_001031664.1

name	LOC100042185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270910 GeneID:100042185
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001474620.1

name	OTTMUSG00000016407 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999652 GeneID:627264 MGI:3709183
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897016.1

name	OTTMUSG00000016437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406958 GeneID:668964 MGI:3709272
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006598.1

name	OTTMUSG00000016420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406956 GeneID:668963 MGI:3709274
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006597.1

name	EG668965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270912 GeneID:668965 MGI:3646752
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001474694.1

name	LOC100042254 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270915 GeneID:100042254
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474724.1

name	LOC100042267 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270917 GeneID:100042267
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001474744.1

name	LOC100042275 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270919 GeneID:100042275
definition	codon_start : 1 product : similar to RIKEN cDNA 1700017G21 gene protein_id : XP_001474760.1

name	LOC434724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51771883 GeneID:434724
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486608.1

name	LOC546182 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270921 GeneID:546182
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001487850.1

name	Mycs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754770 CCDS:CCDS29953.1 GeneID:17870 MGI:1332242
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myc-like oncogene, s-myc protein protein_id : NP_034980.1

name	OTTMUSG00000016453 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51771887 GeneID:434725 MGI:3709265
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486609.1

name	LOC436185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82999676 GeneID:436185
definition	codon_start : 1 product : similar to SMPTB protein_id : XP_488311.2

name	LOC668971 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94406965 GeneID:668971
definition	codon_start : 1 product : similar to SMPTB protein_id : XP_001006607.1

name	LOC100043936 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270926 GeneID:100043936
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481295.1

name	Nudt11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384359 CCDS:CCDS29955.1 GeneID:58242 MGI:1930957
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008486 - diphosphoinositol-polyphosphate diphosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : DIPP3 beta product : nudix-type motif 11 protein_id : NP_067406.2

name	LOC208428 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51771891 GeneID:208428
definition	codon_start : 1 product : similar to Mus musculus ribosomal protein L19 protein_id : XP_141608.4

name	AU022751 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701724 GeneID:102991 MGI:2147968
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC102991 protein_id : NP_001028383.1

name	Nudt10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384357 CCDS:CCDS29957.1 GeneID:102954 MGI:2147931
definition	GO_function : GO:0008486 - diphosphoinositol-polyphosphate diphosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : DIPP3 alpha product : nudix-type motif 10 protein_id : NP_001026834.1

name	LOC627187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627187
definition	number : 1 pseudo : _no_value

name	LOC547057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547057
definition	number : 2 pseudo : _no_value

name	LOC547057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547057
definition	number : 1 pseudo : _no_value

name	LOC100043933 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043933
definition	number : 1 pseudo : _no_value

name	LOC100043933 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043933
definition	number : 2 pseudo : _no_value

name	LOC670673 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670673
definition	number : 3 pseudo : _no_value

name	LOC670673 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670673
definition	number : 2 pseudo : _no_value

name	LOC670673 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670673
definition	number : 1 pseudo : _no_value

name	LOC100043934 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043934
definition	number : 2 pseudo : _no_value

name	LOC100043934 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043934
definition	number : 1 pseudo : _no_value

name	LOC668967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668967
definition	number : 1 pseudo : _no_value

name	LOC668967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668967
definition	number : 2 pseudo : _no_value

name	LOC668967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668967
definition	number : 3 pseudo : _no_value

name	LOC100043935 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043935
definition	number : 1 pseudo : _no_value

name	LOC100043935 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043935
definition	number : 2 pseudo : _no_value

name	LOC668968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668968
definition	number : 3 pseudo : _no_value

name	LOC668968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668968
definition	number : 2 pseudo : _no_value

name	LOC668968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668968
definition	number : 1 pseudo : _no_value

name	LOC668969 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668969
definition	number : 2 pseudo : _no_value

name	LOC668969 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668969
definition	number : 1 pseudo : _no_value

name	LOC668970 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668970
definition	number : 1 pseudo : _no_value

name	LOC668970 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668970
definition	number : 2 pseudo : _no_value

name	EG546327 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270924 GeneID:546327 MGI:3704140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG546327 pseudo : _no_value transcript_id : XR_035060.1

name	LOC546185 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270913 GeneID:546185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins product : similar to Germ cell-less protein-like 2 (mGclh) transcript_id : XR_031864.1

name	LOC627412 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270922 GeneID:627412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 202 ESTs, 10 Proteins product : hypothetical LOC627412 pseudo : _no_value transcript_id : XR_031930.1

name	LOC668972 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270923 GeneID:668972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 12 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_002276.2

clone name	MSMg01-358N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495F17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-167D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-215I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-513N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-531F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542K06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-141K01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-351M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-147B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232N21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-348L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-395A20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-538C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-152N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511E20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232F02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-340K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385P03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053O24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-122E02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132O20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313D10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335F06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-340I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362I14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-363G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-383I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-420K20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-422F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441N22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-455D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-537N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-537P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521J05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-373E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365K14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-372L07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-152F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-065I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-319E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-120D01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484P08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-403M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-072F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-331J22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413H09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504H23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-520E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-403I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-145P14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-291P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203E07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-113J02.b	B6Ng01-113J02.g
ACC	DH919330	DH919331
length	1,114	1,188
definition	DH919330\|Mus musculus domesticus DNA, BAC clone: B6Ng01-113J02, 5' end.	DH919331\|Mus musculus domesticus DNA, BAC clone: B6Ng01-113J02, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcacttgtagaatagcaactctcaactctcgaagtgtttgctcaaa ttccattgtccaattctgtaacataacgagacaaagtttttgacaaattt gctgctcttgtagaattttcaaactaaacagaagtaacacaaaggccagg catcttgtattcacagcccaactgagccaactgccaaagaatatccactt gctcttggactaggtcgatgcattgatttatcaacatcaaccctccttgt atctgtgagttggctgtggcctgtttatctaaggccattgtgactgtcat agaaagctcattaatagtttgtattgtttgaacagtagtagatagagcaa gtgccgaggccgtgatagaggcttcaaccaccgatgtggccaccagtcca actatgatagcagaaataccaaaatctcttttccctcgaaacaaattcaa tctattaggggcatctacaagaacaggaacaaatctaggcatgtgggtaa ccaaagcaaaaggatatttcttagcatcccagcataaggcataaaaacat tttttcttgtgagcaatctatctctatctgattctgatttaagcttctgt tacttaccacccacaaaaacggggaccatacacatactggggtggtggta aaatttacctctttctgttttttatatctaacattggaggtggtccattt aaaagaatttggactcttcttatcagaccaaccggtcttcaaggtacttt tccaatcaaagttcaattctcctttctcactagaacctcctccaatcatt gccatgggggcgagatcagtacagcttccattaaccccacaaagcaccca ctgatcaaagggtttagtattagttcggaggggtccatagtactaaaatc attatccagcaaagtatcatttatacttctcttactatatatggggaaaa gggaaaatatttctcctactgcccaagtataatttttagcttgggcacct gtccaggtacattacattcttccatggaccctttctgcaaaagggtgcaa tcctggtttgtgaagcggcttattttcagatctcaatctttcgggctggg ccaccatcctctta	gaattctcacctgaggcataaaaatggcagagaagcacctgaaaaaatgt tcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagatc caactcacaccagtcagaatggctaagatcaaaaattcaggtgacagcag atgctggcgtggatgtggagaaagaggaacactcctccattgttggtggg attgcaggcttgtacaaccactctggaaatcagtctggcggttcctcaga aaattggacatagtactaccggaggatccagcaatacctctcctgggcat atatccagaagatgccccaactggtaagaaggacaaatgctccactatgt tcatagcagccttatttataatagccagaagctggaaagaacccagatgc ccctcaacagaggaatggataaggaaaatgtggtacatctacacaatgga gtactactcagctattaaaaagaatgaatttatgaaattcctagccaaat ggatggacctggagggcatcatcctgagtgaggtaacacattcacaaagg aactcacacaatatgtactcactgataagtggatattagcccaaaaccta ggatacccaagatataagatacaatttgctaaacacatgaaactcaagaa aaaatgaagactgaagtgtggacactatgcccctccttaaaagtgggaac aaaacacccttggaaggagttacagagacaaagtttggagctgagatgaa aggatggtccatgtagagacttcccatatccagggatccaccccataatc agcatcaaaacgctgacaccattgcatacaccagcaagattttatcgaaa ggacccagatgtagctgtctcttgtgagactatgccgggcctacaacaca gaagtggatgctcccagtcgctaaggatggatcacaggctcccaatggag gagctagagaagtagccaggacctaaagggatctgcacctctataggcag aacacattatgaacctaaccagttccccggagcctcttgtatatagctgc atattgtatcaatagatggccctagtcgcatcccttgcaaagagaaggtc catcttgtaccgcaaactttaatttgccctgtcagggtatcgctcatggc ccaaaaatagtgggaagtgttggcgtagatggatttta
quality values	Open. Hide. 42 30 50 47 53 38 24 43 50 50 50 39 36 31 55 38 39 43 35 50 49 50 55 55 52 43 30 21 19 28 28 27 27 27 22 35 52 59 61 59 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 52 52 52 33 30 28 28 30 26 55 59 61 61 59 59 61 59 61 61 61 61 61 59 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 52 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 59 59 59 61 61 52 59 59 59 59 59 61 59 59 61 59 61 59 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 59 61 59 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 49 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 53 47 61 61 52 61 47 61 61 61 61 61 61 61 61 53 61 61 61 47 61 61 61 47 61 52 53 47 61 35 61 53 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 57 57 45 57 57 50 53 43 57 53 57 53 53 57 57 57 57 53 50 53 57 42 42 57 32 57 57 53 57 57 45 57 37 36 57 47 57 57 57 57 57 57 53 52 45 50 57 57 47 57 43 45 57 57 53 52 50 53 57 57 57 57 53 39 57 57 57 37 31 53 37 52 50 53 53 53 42 57 50 53 53 57 57 57 57 39 43 43 35 57 41 24 53 57 57 53 33 52 51 43 40 53 57 52 52 57 52 52 30 46 52 53 53 46 57 50 50 50 32 38 50 50 53 41 42 43 57 50 40 33 34 9 46 36 57 53 28 52 33 25 53 57 27 23 57 57 43 14 53 50 36 57 53 53 37 41 25 38 52 42 52 37 37 52 36 36 36 48 20 40 16 39 36 33 46 57 47 53 31 40 33 37 42 40 21 10 34 12 37 35 42 57 57 41 33 40 12 33 33 39 32 57 45 34 48 32 35 33 35 13 22 35 36 33 57 33 57 29 33 40 40 37 29 29 41 28 39 36 30 51 30 30 41 32 30 48 29 33 29 30 26 48 39 43 18 46 29 9 9 45 46 46 44 29 25 48 21 30 19 29 30 29 25 29 29 29 25 28 31 31 23 25 15 13 15 15 12 19 36 31 29 21 21 11 51 51 30 30 46 14 36 10 19 22 10 20 21 31 29 43 43 39 8 46 38 9 51 11 30 14 20 16 29 24 24 16 14 41 31 9 20 19 14 39 43 51 27 46 10 9 27 19 14 28 29 29 31 28 36 36 14 13 29 7 9 5 10 12 11 30 21 35 27 32 36 30 16 16 15 12 11 10 5 24 18 23 14 21 10 10 6 7 11 23 19 7 7 23 25 25 6 12 19 12 11 29 51 44 27 28 46 46 33 14 41 9 16 51 51 29 8 11 15 28 25 5 7 9 9 8 13 29 26 25 7 26 26 14 21 13 9 8 6 8 6 22 51 51 31 32 13 16 21 22 7 5 20 15 26 35 6 17 20 20 10 12 8 30 9 31 17 29 6 7 21 9 19 31 8 8 5 5 9 31 14 18 15 19 31 25 16 15 35 14 18 8 5 4 4 12 25 22 29 36 10 7 6 5 8 14 22 7 8 25 6 9 21 5 17 7 19 8 12 12 8 12 11 12 6 12 31 10 19 9 7 6 30 28 7 4 6 3 7 6 5 21 12 4 8 10 7 25 30 25 20 7 22 16 10 8 20 21 16 15 8 6 11 13 6 6 7 7 5 5 5 3 3	Open. Hide. 55 47 50 55 61 61 55 43 16 29 22 28 16 12 10 36 43 49 55 52 52 52 59 59 59 61 59 43 49 45 61 49 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 59 61 43 49 36 26 30 28 30 44 52 61 61 61 61 61 61 61 59 61 59 59 61 61 59 55 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 59 59 59 61 59 59 59 59 61 61 61 59 61 59 59 52 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 59 59 52 45 61 59 61 59 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 59 59 61 59 61 61 59 59 59 59 59 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 59 59 59 59 59 61 61 59 59 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 52 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 59 61 61 61 61 59 59 61 59 61 61 61 59 59 59 59 59 59 59 59 59 59 59 61 61 59 61 61 61 61 59 61 61 59 61 59 61 59 61 59 59 61 61 52 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 61 61 61 61 61 61 61 61 61 61 61 61 55 49 61 37 55 55 41 47 55 61 61 61 55 61 55 61 61 61 61 61 61 61 55 61 55 55 61 61 55 61 61 61 61 61 55 61 55 55 61 61 61 61 61 47 61 61 61 61 61 61 55 55 50 61 61 55 47 47 55 55 55 55 61 55 61 61 47 61 61 61 61 61 61 43 47 47 61 53 53 52 53 50 50 47 50 61 61 53 35 61 61 50 61 46 61 53 61 61 61 61 61 61 61 61 47 43 61 61 47 47 61 53 50 53 61 61 61 61 61 52 61 61 61 53 61 47 46 52 61 47 53 50 61 61 61 30 47 39 47 42 47 61 61 61 61 53 52 45 47 40 53 34 53 47 47 57 57 57 53 57 53 42 12 53 53 57 53 53 47 57 47 52 53 47 36 45 45 40 57 52 45 50 52 42 50 45 52 38 57 57 52 52 27 46 42 53 45 53 47 39 19 53 32 53 42 50 53 40 57 47 39 28 50 53 45 57 40 57 19 37 52 53 35 57 53 50 42 53 26 53 52 52 50 47 30 45 38 34 42 42 37 45 45 38 47 28 29 37 57 43 27 31 24 53 30 17 32 26 28 35 13 23 33 38 36 34 52 53 30 36 26 17 21 28 50 37 12 43 38 34 25 45 34 43 14 21 32 32 38 25 23 28 21 57 37 40 28 34 32 50 52 22 21 57 26 33 20 16 31 37 20 38 50 50 50 14 21 34 10 28 23 27 37 41 29 32 57 40 20 19 52 14 24 37 33 25 6 23 30 19 26 53 52 25 29 36 23 21 37 28 33 32 36 33 36 21 19 6 40 25 30 35 27 28 7 20 12 12 31 35 44 28 40 25 32 53 33 23 28 30 30 17 41 57 57 31 17 29 11 13 29 29 23 30 31 27 20 27 9 38 33 10 11 17 30 24 14 30 9 8 21 31 27 47 30 32 17 11 25 26 32 22 34 41 30 32 22 13 19 21 18 14 51 51 18 17 35 26 16 30 45 25 29 19 15 10 33 24 15 5 29 18 25 29 21 17 10 33 28 29 22 18 20 25 34 14 9 8 30 16 11 7 7 12 24 32 21 29 24 39 30 17 24 18 22 7 6 12 6 8 24 10 14 41 36 18 27 14 22 28 17 23 13 13 15 10 14 10 18 21 10 7 17 23 19 24 20 12 17 8 12 23 9 10 14 13 29 23 29 46 14 24 27 29 31 15 16 22 14 9 7 7 17 11 6 23 24 9 7 9 5 23 25 17 11 11 7 19 19 19 6 17 23 11 8 16 14 12 16 6 30 12 11 5 16 6 10 22 33 11 30 13 14 7 10 31 18 24 29 14 9 5 26 23 5 12 15 12 10 13 7 16 4 11 14 10 12 17 28 11 22 26 9 5 14 9 10 9 15 9 5 12 7 8 23 13 7 5 19 26 16 9 23 8 15 26 15 7 7 17 15 9 8 16 17 17 11 9 11 10 8 9 29 12 7 15 5 19 5 13 20 12 20 11 5 5 9 8 3 9 4 3 6 6 1 3 5 13 3 3 6 14 21 13 14 7 10 14 5 20 4 6 7 6 9 9 13 6 5 4 6 4 7 4 7 4 12 16 7 22 26 23 5 11 11 24 17 4 11 10 23 7 9 4 4 4 13 15 10 4 9 4 14 5 14 10 16 9 3 16 17 6 16 13 11 7 24 25 6 6 5 7 4 13 13 14 13 8 7 9 7 4 2 4 4 1 4 4 5 6 10 4 4 2 4 2 14 3 3 1

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_4789968_4791082
seq2: B6Ng01-113J02.b_47_1160 (reverse)

seq1  TAAGAGGATGGTGGCCCAGCCGAAAAGGTGGAAGATCTAGAAATAAGCCG  50
      |||||||||||||||||||||  |||| | | ||||||  ||||||||||
seq2  TAAGAGGATGGTGGCCCAGCCCGAAAGATTG-AGATCTGAAAATAAGCCG  49

seq1  CCTTCACAACCAAGAATGGCACCCTTTTGCAAGGAAGGGTCCATGGAAG-  99
       |||||||| | || || |||||||||||| || ||||||||||||||| 
seq2  -CTTCACAAACCAGGATTGCACCCTTTTGC-AGAAAGGGTCCATGGAAGA  97

seq1  ATGTAATGTTACCTTGGACAGGTTGCCAAGCTAAAAAATATACTTGGGCA  149
      |||||||| |||| |||||||||  |||||||||||| ||||||||||||
seq2  ATGTAATG-TACC-TGGACAGGTGCCCAAGCTAAAAATTATACTTGGGCA  145

seq1  GTA-GAGAAATATTTTTCCTTTTCCCCATATATTAGT-AGAG-AGTAT-A  195
      ||| |||||||||||| ||||||||||||||| |||| |||| ||||| |
seq2  GTAGGAGAAATATTTTCCCTTTTCCCCATATA-TAGTAAGAGAAGTATAA  194

seq1  ATGATACTTTTGCTGGAT-ATGATTTTAGTACTATGGACCCCCTCCGAAC  244
      ||||||| |||||||||| ||||||||||||||||||| |||||||||||
seq2  ATGATAC-TTTGCTGGATAATGATTTTAGTACTATGGA-CCCCTCCGAAC  242

seq1  TAATACTAACCCTTTTGATCAGTGGTTGCTTTGTGGGGTTAATGGAAGCT  294
      ||||||||| || |||||||||||| ||||||||||||||||||||||||
seq2  TAATACTAAACCCTTTGATCAGTGGGTGCTTTGTGGGGTTAATGGAAGCT  292

seq1  GTACTGATCTCGCCCCCATGGCAATGATTGGAGGAGGTTCTAGTGAGAAA  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTGATCTCGCCCCCATGGCAATGATTGGAGGAGGTTCTAGTGAGAAA  342

seq1  GGAGAATTGACCTTTGATTGGAAAAGTACCTTGAAGACCGGTTGGTCTGA  394
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  GGAGAATTGAACTTTGATTGGAAAAGTACCTTGAAGACCGGTTGGTCTGA  392

seq1  TAAGAAGAGTCCAAATTCTTTTAAAAGGACCACCTCCAATGTTAGATATA  444
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TAAGAAGAGTCCAAATTCTTTTAAATGGACCACCTCCAATGTTAGATATA  442

seq1  AAAAACAGAAAGAGGTAAATTTTACCACCACCCCGGTATGTGTATGGTTC  494
      |||||||||||||||||||||||||||||||||| ||||||||||||| |
seq2  AAAAACAGAAAGAGGTAAATTTTACCACCACCCCAGTATGTGTATGGTCC  492

seq1  CCTTTTTTGTGGGTGGTAAGTAACAGAAGCTTAAATCAGAATCAGATAGA  544
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGTTTTTGTGGGTGGTAAGTAACAGAAGCTTAAATCAGAATCAGATAGA  542

seq1  GATAGATTGCTCACAAG-AAAAATGTTTTTATGCCTTATGTTGGGATGCT  593
      ||||||||||||||||| |||||||||||||||||||||| |||||||||
seq2  GATAGATTGCTCACAAGAAAAAATGTTTTTATGCCTTATGCTGGGATGCT  592

seq1  AAGAAATATCCTTTTGCTTTGGTTACCCACATGCCTAGATTTGTTCCTGT  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAATATCCTTTTGCTTTGGTTACCCACATGCCTAGATTTGTTCCTGT  642

seq1  TCCTGTAGATGCCCCCAATAGATTGAATTTGTTTCAAGGGAAAAGAGATT  693
      || |||||||||||| ||||||||||||||||||| ||||||||||||||
seq2  TCTTGTAGATGCCCCTAATAGATTGAATTTGTTTCGAGGGAAAAGAGATT  692

seq1  TTGGTATTTCTGCTATCATAGTTGGACTGGTGTCCACATCGGTGGTTGCA  743
      |||||||||||||||||||||||||||||||| ||||||||||||||| |
seq2  TTGGTATTTCTGCTATCATAGTTGGACTGGTGGCCACATCGGTGGTTGAA  742

seq1  GCCTCTATCACGGCCTCGGCACTCACTCTATCTACTACTGTTCAAACAAT  793
      |||||||||||||||||||||||  |||||||||||||||||||||||||
seq2  GCCTCTATCACGGCCTCGGCACTTGCTCTATCTACTACTGTTCAAACAAT  792

seq1  ACAAACTATTAATGAGCTTTCTATGACAGTCACAATGGCCTTAGATAAAC  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACTATTAATGAGCTTTCTATGACAGTCACAATGGCCTTAGATAAAC  842

seq1  AGGCCACAGCCAACTCACAGATACAAGGAGGGTTGATGTTGATAAATCAA  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCACAGCCAACTCACAGATACAAGGAGGGTTGATGTTGATAAATCAA  892

seq1  TGCATCGACCTAGTCCAAGAGCAAGTGGATATTCTTTGGCAGTTGGCTCA  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATCGACCTAGTCCAAGAGCAAGTGGATATTCTTTGGCAGTTGGCTCA  942

seq1  ATTCGGCTGTGAATACAAGATACCTGGCCTTTGTGTTACTTCTGTTCAGT  993
       || ||||||||||||||||| |||||||||||||||||||||||| |||
seq2  GTTGGGCTGTGAATACAAGATGCCTGGCCTTTGTGTTACTTCTGTTTAGT  992

seq1  TTGAAAATTCTACAAGAGCAGCAAATTTGTCAAAATCTTTGTCTCGTTAT  1043
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  TTGAAAATTCTACAAGAGCAGCAAATTTGTCAAAAACTTTGTCTCGTTAT  1042

seq1  GTTACAGAATTGGACAATGGAATTTGAGCAAACGCTTCAAGAGTTGAGAG  1093
      ||||||||||||||||||||||||||||||||| |||| |||||||||||
seq2  GTTACAGAATTGGACAATGGAATTTGAGCAAACACTTCGAGAGTTGAGAG  1092

seq1  TTGCTATTCTACAAGTGAATTC  1115
      ||||||||||||||||||||||
seq2  TTGCTATTCTACAAGTGAATTC  1114

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information