MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-124A14
Chromosome	X (Build37)
Map Location	93,388,851 - 93,389,703
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC619688, LOC100042189, 2810002O09Rik, Asb12, LOC668202, AK129302, A130028J20Rik, 1700010D01Rik, Las1l, Msn, Psmb7-ps1
Downstream gene	LOC668221, Vsig4, B230358A15Rik, Heph, Gpr165, LOC675824, LOC668234, EG668236, LOC668238, Pgr15l
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC619688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042189 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	2810002O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72345 MGI:1919595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70392 MGI:1917642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668202 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	AK129302 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245522 MGI:2679294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A130028J20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547176 MGI:2442133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700010D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76386 MGI:1923636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Las1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76130 MGI:1923380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17698 MGI:97167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb7-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19178 MGI:1096396
definition	gene_synonym : Psmb7-ps note : proteasome (prosome, macropain) subunit, beta type 7, pseudogene 1 pseudo : _no_value

name	LOC668221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Vsig4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278180 MGI:2679720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230358A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245525 MGI:3045337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Heph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15203 MGI:1332240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gpr165 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76206 MGI:1923456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675824 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC668234 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG668236 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668236 MGI:3648922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein pseudo : _no_value

name	LOC668238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Pgr15l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245526 MGI:2676330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810002O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123858769 GeneID:72345 MGI:1919595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810002O09 gene transcript_id : NM_175179.3

name	Asb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370473 GeneID:70392 MGI:1917642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 12 transcript_id : NM_080858.2

name	LOC668202 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271785 GeneID:668202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Predicted gene, EG546347 transcript_id : XM_001477719.1

name	AK129302 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491857 GeneID:245522 MGI:2679294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AK129302 transcript_id : NM_001003916.1

name	A130028J20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347403 GeneID:547176 MGI:2442133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A130028J20 gene transcript_id : NM_001034907.2

name	1700010D01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364117 GeneID:76386 MGI:1923636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700010D01 gene transcript_id : NM_029590.2

name	Las1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71979674 GeneID:76130 MGI:1923380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LAS1-like (S. cerevisiae) transcript_id : NM_152822.2

name	Msn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778914 GeneID:17698 MGI:97167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : moesin transcript_id : NM_010833.2

name	Vsig4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382466 GeneID:278180 MGI:2679720
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : V-set and immunoglobulin domain containing 4 transcript_id : NM_177789.3

name	B230358A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370938 GeneID:245525 MGI:3045337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230358A15 gene transcript_id : NM_172931.2

name	Heph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754179 GeneID:15203 MGI:1332240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hephaestin transcript_id : NM_010417.1

name	Heph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349030 GeneID:15203 MGI:1332240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hephaestin transcript_id : NM_181273.3

name	Gpr165 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388875 GeneID:76206 MGI:1923456
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 165 transcript_id : NM_029536.2

name	Pgr15l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802340 GeneID:245526 MGI:2676330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 15-like transcript_id : NM_001033361.2

name	2810002O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123858770 GeneID:72345 MGI:1919595
definition	codon_start : 1 product : RIKEN cDNA 2810002O09 protein_id : NP_780388.2

name	Asb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270029 CCDS:CCDS30283.1 GeneID:70392 MGI:1917642
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : ankyrin repeat domain-containing SOCS box protein 12 protein_id : NP_543134.1

name	LOC668202 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271786 GeneID:668202
definition	codon_start : 1 product : similar to Predicted gene, EG546347 protein_id : XP_001477769.1

name	AK129302 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491858 CCDS:CCDS30284.1 GeneID:245522 MGI:2679294
definition	codon_start : 1 product : hepatocellular carcinoma-associated antigen 127 protein_id : NP_001003916.1

name	1700010D01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729782 GeneID:76386 MGI:1923636
definition	codon_start : 1 product : hypothetical protein LOC76386 protein_id : NP_083866.1

name	A130028J20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347404 GeneID:547176 MGI:2442133
definition	codon_start : 1 product : hypothetical protein LOC547176 protein_id : NP_001030079.2

name	Las1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71979675 CCDS:CCDS30287.1 GeneID:76130 MGI:1923380
definition	codon_start : 1 product : LAS1-like protein_id : NP_690035.2

name	Msn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778915 GeneID:17698 MGI:97167
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0001931 - uropod [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : moesin protein_id : NP_034963.2

name	Vsig4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244314 CCDS:CCDS30288.1 GeneID:278180 MGI:2679720
definition	codon_start : 1 product : V-set and immunoglobulin domain containing 4 protein_id : NP_808457.1

name	B230358A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370438 GeneID:245525 MGI:3045337
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245525 protein_id : NP_766519.1

name	Heph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754180 CCDS:CCDS30289.1 GeneID:15203 MGI:1332240
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006825 - copper ion transport [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; haphaestin; sex linked anemia product : hephaestin isoform 1 protein_id : NP_034547.1

name	Heph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30911107 CCDS:CCDS30290.1 GeneID:15203 MGI:1332240
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006825 - copper ion transport [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; haphaestin; sex linked anemia product : hephaestin isoform 2 protein_id : NP_851790.1

name	Gpr165 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626052 CCDS:CCDS30291.1 GeneID:76206 MGI:1923456
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 165 protein_id : NP_083812.1

name	Pgr15l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781789 CCDS:CCDS30292.1 GeneID:245526 MGI:2676330
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004983 - neuropeptide Y receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor PGR15L product : G protein-coupled receptor 15-like protein_id : NP_001028533.1

name	LOC619688 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619688
definition	number : 1 pseudo : _no_value

name	LOC100042189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042189
definition	number : 2 pseudo : _no_value

name	LOC100042189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042189
definition	number : 1 pseudo : _no_value

name	LOC668221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668221
definition	number : 2 pseudo : _no_value

name	LOC668221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668221
definition	number : 1 pseudo : _no_value

name	LOC675824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675824
definition	number : 5 pseudo : _no_value

name	LOC675824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675824
definition	number : 4 pseudo : _no_value

name	LOC675824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675824
definition	number : 3 pseudo : _no_value

name	LOC675824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675824
definition	number : 2 pseudo : _no_value

name	LOC675824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675824
definition	number : 1 pseudo : _no_value

name	LOC668234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668234
definition	number : 5 pseudo : _no_value

name	LOC668234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668234
definition	number : 4 pseudo : _no_value

name	LOC668234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668234
definition	number : 3 pseudo : _no_value

name	LOC668234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668234
definition	number : 2 pseudo : _no_value

name	LOC668234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668234
definition	number : 1 pseudo : _no_value

name	LOC668238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668238
definition	number : 3 pseudo : _no_value

name	LOC668238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668238
definition	number : 2 pseudo : _no_value

name	LOC668238 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668238
definition	number : 1 pseudo : _no_value

name	Psmb7-ps1 (CDS detail)
type	polyA_signal
link	vega ensembl
xref
definition	gene_synonym : Psmb7-ps

name	EG668236 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271831 GeneID:668236 MGI:3648922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG668236 pseudo : _no_value transcript_id : XR_033838.1

clone name	MSMg01-399F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-108J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-355E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274D10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044M09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-124A14.b	B6Ng01-124A14.g
ACC	DH927047	DH927048
length	693	998
definition	DH927047\|Mus musculus domesticus DNA, BAC clone: B6Ng01-124A14, 5' end.	DH927048\|Mus musculus domesticus DNA, BAC clone: B6Ng01-124A14, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaactgaggaaactcgaagggctgagaagcacctaaagaaatg ttcacccttaatcatcagagaaatgcaaatcaaaacaaccctgagaatcc acctcacaccagtcagaatggctaagatcaaaaattcaggtgacagcaga tgctggcgaggatgtggagaaagaggaatactcctccattgctggtggga ttgcaaacttgtacaactactctggaaatcagtctggtggttcctcagaa aattggacatagtactaccggaggatccagcagccttatttataatagcc agaagctggaaagaacccagatgttcttcaacagagaaatggatacagaa aatgtggtacatttacacagtggagtactactcagctattaaaaaagatg aattgatgaaattcttaggcaaatggatggacctagaaaatatcattctg agtgaggtaacccaatcacaaaagaacacacatggtgtgtactcactaat aagtgaatattagcccaaaagctgcgaatacccaagataaaaattcacag acagcatgaagctcaagaaggaagaacaaagtgtggatgcttcagttctt catagaaaagggaagaaaatactcatggaagcaaatatggagacaaagtg cagagcagagatggaaagaagtccatcctgggtatctaggttt	gaattcttcctcagaattcttgttggtacatagaaaggatactgattttt gtaagttaattctgtatcatgatacttttctgaaattattgatcattcct agaaattttctggtgggatttatgggttatcttatgtataatatcctact gtcttcaaatacagagagttttattgtttcagttcatattgttatccctt tgattcctttcttgtattattgctatagccagagcttcaggtattatact gtaaaagaatagggatagtggacagtcttatttcattcctgattttagta ggattgcttcaagtttttacccttttaaaatgatgttggtttggatttct cacatatagcatttattttgttgagctatattccctccaggactttcatg aagtaatgttgaatttttttcaaaggccttttctgcatatattgatatga tcatgtgattactgtctttgagtccatttataaagaaattattcaagtta taaatttccttatgttgaataaatttttgcatctgcagaataaagccaac ttgttaatgatagatgatcattttgatatgtaagcattttattgaatatt ttgaatatacattcatcataggtagtggtttctagttttcattcttaaaa aattcttgttgtggaagctggtgttctcgcacttgggggtggtggccaga agccggcaggactggaagggacaccgcatctcagaagactcttcaagaaa tcacaatgtcaaacaacacagacctttctctctcttcatacgatgaaagg tcaggggtctaagtttattcagaaagctaaagagacactgttcccccccc ccattggaatggcaggctttgcagcaattttgtgtatgggttacacacgc tgaagagtaggggaaatatggagatgtccattcacttgatcacatgcgtg tagcagccaaggctttgttgtgggggccatgactcttgggatgggcta
quality values	Open. Hide. 61 43 29 37 61 53 53 36 24 53 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 19 14 26 17 18 11 9 11 12 12 36 28 37 59 59 59 59 61 61 61 59 55 59 59 61 61 59 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 49 44 35 26 25 30 26 24 24 36 59 59 59 59 61 61 61 61 59 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 55 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 34 55 61 55 61 61 55 55 55 61 61 61 61 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 47 53 61 47 42 53 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 52 53 53 46 50 50 57 57 57 39 38 53 53 53 53 53 57 57 53 53 57 53 57 57 57 57 57 53 57 57 52 46 53 53 57 57 47 46 53 53 45 57 47 38 50 53 57 53 50 57 40 57 57 46 38 57 45 57 53 42 38 45 57 57 53 41 57 52 42 52 45 53 57 57 57 57 50 57 47 53 53 42 53 57 47 47 36 53 53 53 52 24 57 57 57 41 46 39 53 30 57 53 43 47 40 57 52 53 45 53 45 47 53 53 52 45 53 41 53 30 57 26 30 38 13 52 21 34 50 52 41 37 57 57 50 57 53 38 50 33 23 29 52 36 53 53 57 46 25 18 33 42 38 50 42 34 57 11 19 17	Open. Hide. 61 47 50 13 16 19 20 19 16 10 19 14 11 12 55 41 49 59 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 59 59 61 59 49 61 61 61 61 61 61 52 43 43 32 30 28 24 27 27 37 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 53 61 50 61 61 47 61 61 53 40 61 61 61 61 61 31 61 61 61 61 53 61 53 61 61 61 61 61 61 61 53 61 45 61 61 47 61 53 57 57 50 57 57 53 53 57 57 57 57 53 53 53 57 57 57 57 53 53 30 57 47 42 53 53 53 43 47 47 23 57 57 57 57 57 52 52 50 57 43 57 47 42 53 42 53 32 46 53 40 57 52 57 57 57 57 47 53 42 52 47 47 45 45 57 47 53 40 42 42 41 35 45 50 57 53 45 52 40 52 50 57 57 57 53 53 47 45 42 53 53 53 50 57 57 52 36 52 53 42 52 52 38 57 36 57 52 39 57 52 31 57 45 53 50 53 41 33 57 57 52 52 34 52 53 52 27 47 19 57 57 57 57 41 36 57 53 53 57 53 43 53 46 17 46 30 50 53 30 50 42 53 46 24 53 28 53 57 40 57 53 53 32 42 53 53 50 57 57 57 53 22 53 52 27 50 53 20 46 28 24 57 43 23 53 53 23 57 32 20 5 34 27 24 37 53 53 53 40 19 57 24 29 25 29 33 53 33 41 22 37 48 40 40 35 8 57 48 27 40 18 44 41 29 41 44 29 40 37 53 57 28 34 37 27 37 21 26 35 53 21 37 20 57 37 33 22 45 35 24 31 28 20 30 16 36 28 46 45 47 29 34 44 30 30 29 20 17 29 14 32 23 29 15 38 33 17 10 45 12 8 18 10 29 7 13 31 39 20 29 38 37 19 30 21 46 46 29 35 29 36 37 22 20 46 47 29 14 26 25 13 46 15 24 29 20 30 25 28 28 29 29 29 28 43 51 51 51 51 51 51 51 51 33 20 30 29 19 7 36 34 34 25 29 27 26 29 15 7 24 51 31 17 29 22 13 23 26 20 17 51 51 46 18 15 10 17 29 29 29 51 32 26 29 22 28 17 29 23 34 20 35 28 20 29 40 9 40 15 13 27 23 36 46 11 33 51 28 28 27 23 8 7 51 19 15 14 26 28 38 11 12 24 28 24 23 28 17 24 34 15 9 33 11 20 9 13 19 28 17 16 26 19 20 27 31 14 6 13 13 9 5 8 13 14 34 51 23 17 26 13 6 9 22 30 31 35 23 7 20 31 20 14 16 13 16 20 8 33 12 30 8 6 6 4 14 33 23 16 8

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_93388851_93389703
seq2: B6Ng01-124A14.g_216_1066

seq1  ACTGTCTTCAAATACAGAGAGTTTTATTGTTTCAGTTCATATTGTTATCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTCTTCAAATACAGAGAGTTTTATTGTTTCAGTTCATATTGTTATCC  50

seq1  CTTTGATTCCTTTCTTGTATTATTGCTATAGCCAGAGCTTCAGGTATTAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGATTCCTTTCTTGTATTATTGCTATAGCCAGAGCTTCAGGTATTAT  100

seq1  ACTGTAAAAGAATAGGGATAGTGGACAGTCTTATTTCATTCCTGATTTTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTAAAAGAATAGGGATAGTGGACAGTCTTATTTCATTCCTGATTTTA  150

seq1  GTAGGATTGCTTCAAGTTTTTACCCTTTTAAAATGATGTTGGTTTGGATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGATTGCTTCAAGTTTTTACCCTTTTAAAATGATGTTGGTTTGGATT  200

seq1  TCTCACATATAGCATTTATTTTGTTGAGCTATATTCCCTCCAGGACTTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCACATATAGCATTTATTTTGTTGAGCTATATTCCCTCCAGGACTTTC  250

seq1  ATGAAGTAATGTTGAATTTTTTTCAAAGGCCTTTTCTGCATATATTGATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAGTAATGTTGAATTTTTTTCAAAGGCCTTTTCTGCATATATTGATA  300

seq1  TGATCATGTGATTACTGTCTTTGAGTCCATTTATAAAGAAATTATTCAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATCATGTGATTACTGTCTTTGAGTCCATTTATAAAGAAATTATTCAAG  350

seq1  TTATAAATTTCCTTATGTTGAATAAATTTTTGCATCTGCAGAATAAAGCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAAATTTCCTTATGTTGAATAAATTTTTGCATCTGCAGAATAAAGCC  400

seq1  AACTTGTTAATGATAGATGATCATTTTGATATGTAAGCATTTTATTGAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTGTTAATGATAGATGATCATTTTGATATGTAAGCATTTTATTGAAT  450

seq1  ATTTTGAATATACATTCATCATAGGTAGTGGTTTCTAGTTTTCATTCTTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTGAATATACATTCATCATAGGTAGTGGTTTCTAGTTTTCATTCTTA  500

seq1  AAAAATTCTTGTTGTGGAAGCTGGTGTTCTCGCACTTGGGGGTGGTGGCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATTCTTGTTGTGGAAGCTGGTGTTCTCGCACTTGGGGGTGGTGGCC  550

seq1  AGAAGCCGGCAGGACTGGAAGGGACACCGCATCTCAGAAGACTCTTCAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGCCGGCAGGACTGGAAGGGACACCGCATCTCAGAAGACTCTTCAAG  600

seq1  AAATCACAATGTCAAACAACACAGACCTTTCTCTCTCTTCATACGATG-A  649
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AAATCACAATGTCAAACAACACAGACCTTTCTCTCTCTTCATACGATGAA  650

seq1  AGGTCAGGGGTCTAAGTTTATTCAGAAAGCTAAGGAGACACTGTTCCCCC  699
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  AGGTCAGGGGTCTAAGTTTATTCAGAAAGCTAAAGAGACACTGTTCCCCC  700

seq1  CCCCCATTGGAATGGCAGGCTTTGCAGCAATTTTTGTGTATGGGTTACAC  749
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  CCCCCATTGGAATGGCAGGCTTTGCAGCAA-TTTTGTGTATGGGTTACAC  749

seq1  ACGCTGAAGAGTAGGGGAAATATGAAGATGTCCATTCACTTGATCCACAT  799
      |||||||||||||||||||||||| ||||||||||||||||||| |||||
seq2  ACGCTGAAGAGTAGGGGAAATATGGAGATGTCCATTCACTTGAT-CACAT  798

seq1  GCGTGTAGCAGCCCAGGGCTTTGTTGTGGGGGCCATGACTCTTGGTATGG  849
      ||||||||||| ||| ||||||||||||||||||||||||||||| ||||
seq2  GCGTGTAGCAG-CCAAGGCTTTGTTGTGGGGGCCATGACTCTTGGGATGG  847

seq1  GCTA  853
      ||||
seq2  GCTA  851

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information