MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-125G04
Chromosome	X (Build37)
Map Location	163,281,924 - 163,282,278
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gemin8, Gpm6b, Ofd1, Trappc2, Rab9, LOC100040795, A630018P17Rik, Egfl6, LOC100041912
Downstream gene	LOC641660, LOC667791, EG667794, LOC100040850, LOC627268, Tmsb4x, Tlr8, Tlr7, Prps2, EG627311, Frmpd4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gemin8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237221 MGI:2384300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpm6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14758 MGI:107672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ofd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237222 MGI:1350328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66226 MGI:1913476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56382 MGI:1890695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040795 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	A630018P17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245695 MGI:2685236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egfl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54156 MGI:1858599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC641660 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641660
definition	note : ribosomal protein L7a pseudogene pseudo : _no_value

name	LOC667791 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	EG667794 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667794 MGI:3648637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100040850 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC627268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Tmsb4x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19241 MGI:99510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170744 MGI:2176887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170743 MGI:2176882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110639 MGI:97776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627311 MGI:3648299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Frmpd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333605 MGI:3042378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gemin8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628630 GeneID:237221 MGI:2384300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gem (nuclear organelle) associated protein 8 transcript_id : NM_146238.3

name	Gpm6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130376 GeneID:14758 MGI:107672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein m6b transcript_id : NM_023122.2

name	Ofd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342288 GeneID:237222 MGI:1350328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oral-facial-digital syndrome 1 gene homolog (human) transcript_id : NM_177429.2

name	Trappc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388246 GeneID:66226 MGI:1913476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 2 transcript_id : NM_025432.2

name	Rab9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790226 GeneID:56382 MGI:1890695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB9, member RAS oncogene family transcript_id : NM_019773.1

name	A630018P17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090649 GeneID:245695 MGI:2685236
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630018P17 gene transcript_id : NM_001007577.1

name	Egfl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377711 GeneID:54156 MGI:1858599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like-domain, multiple 6 transcript_id : NM_019397.2

name	LOC100041912 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272532 GeneID:100041912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041912 transcript_id : XM_001477511.1

name	EG667794 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408484 GeneID:667794 MGI:3648637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG667794 transcript_id : XM_992520.1

name	LOC100040850 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272511 GeneID:100040850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040850 transcript_id : XM_001475388.1

name	LOC627268 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272534 GeneID:627268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC627268 transcript_id : XM_001477546.1

name	Tmsb4x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476080 GeneID:19241 MGI:99510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymosin, beta 4, X chromosome transcript_id : NM_021278.2

name	Tlr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723494 GeneID:170744 MGI:2176887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 8 transcript_id : NM_133212.2

name	Tlr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803199 GeneID:170743 MGI:2176882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 7 transcript_id : NM_133211.3

name	Prps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802916 GeneID:110639 MGI:97776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoribosyl pyrophosphate synthetase 2 transcript_id : NM_026662.3

name	EG627311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83004720 GeneID:627311 MGI:3648299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG627311 transcript_id : XM_891970.1

name	Frmpd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131064 GeneID:333605 MGI:3042378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM and PDZ domain containing 4 transcript_id : NM_001033330.2

name	Gemin8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559907 GeneID:237221 MGI:2384300
definition	codon_start : 1 product : gem (nuclear organelle) associated protein 8 protein_id : NP_666350.2

name	Gpm6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963495 CCDS:CCDS30526.1 GeneID:14758 MGI:107672
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : glycoprotein m6b protein_id : NP_075611.1

name	Ofd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28933461 GeneID:237222 MGI:1350328
definition	GO_component : GO:0005932 - basal body [Evidence ISS]; GO:0005813 - centrosome [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0035083 - cilium axoneme biogenesis [Evidence IMP] codon_start : 1 product : oral-facial-digital syndrome 1 gene homolog protein_id : NP_803178.1

name	Trappc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384832 GeneID:66226 MGI:1913476
definition	codon_start : 1 exception : mismatches in translation note : spondyloepiphyseal dysplasia, late; spondyloepiphyseal dysplasia tarda protein product : trafficking protein particle complex 2 protein_id : NP_079708.1

name	Rab9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790227 CCDS:CCDS30527.1 GeneID:56382 MGI:1890695
definition	GO_component : GO:0005770 - late endosome [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : SID 99 product : RAB9, member RAS oncogene family protein_id : NP_062747.1

name	A630018P17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090650 GeneID:245695 MGI:2685236
definition	GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC245695 protein_id : NP_001007578.1

name	Egfl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506563 CCDS:CCDS30528.1 GeneID:54156 MGI:1858599
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : EGF-like-domain, multiple 6 protein_id : NP_062270.1

name	LOC100041912 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272533 GeneID:100041912
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477561.1

name	EG667794 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408485 GeneID:667794 MGI:3648637
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997614.1

name	LOC100040850 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272512 GeneID:100040850
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475438.1

name	LOC627268 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272535 GeneID:627268
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477596.1

name	Tmsb4x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946578 CCDS:CCDS30529.1 GeneID:19241 MGI:99510
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030334 - regulation of cell migration [Evidence IDA] codon_start : 1 note : prothymosin beta 4 product : thymosin, beta 4, X chromosome protein_id : NP_067253.1

name	Tlr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723495 GeneID:170744 MGI:2176887
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0003725 - double-stranded RNA binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003727 - single-stranded RNA binding [Evidence ISS]; GO:0005121 - Toll binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0051607 - defense response to virus [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence ISS]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045087 - innate immune response [Evidence ISS]; GO:0045089 - positive regulation of innate immune response [Evidence ISS]; GO:0045356 - positive regulation of interferon-alpha biosynthesis [Evidence ISS]; GO:0045359 - positive regulation of interferon-beta biosynthesis [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence ISS]; GO:0045416 - positive regulation of interleukin-8 biosynthesis [Evidence ISS] codon_start : 1 product : toll-like receptor 8 protein_id : NP_573475.2

name	Tlr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875360 CCDS:CCDS30531.1 GeneID:170743 MGI:2176882
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003725 - double-stranded RNA binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003727 - single-stranded RNA binding [Evidence IMP]; GO:0035197 - siRNA binding [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0051607 - defense response to virus [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045356 - positive regulation of interferon-alpha biosynthesis [Evidence ISS]; GO:0045359 - positive regulation of interferon-beta biosynthesis [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence ISS]; GO:0045416 - positive regulation of interleukin-8 biosynthesis [Evidence ISS] codon_start : 1 product : toll-like receptor 7 protein_id : NP_573474.1

name	Prps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386146 CCDS:CCDS30532.1 GeneID:110639 MGI:97776
definition	EC_number : 2.7.6.1 GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : phosphoribosyl pyrophosphate synthetase 2 protein_id : NP_080938.1

name	EG627311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004721 GeneID:627311 MGI:3648299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897063.1

name	Frmpd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362701 GeneID:333605 MGI:3042378
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : PDZ domain containing 10 protein_id : NP_001028502.1

name	LOC100040795 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040795
definition	number : 1 pseudo : _no_value

name	LOC100040795 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040795
definition	number : 2 pseudo : _no_value

name	LOC667791 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667791
definition	number : 1 pseudo : _no_value

clone name	MSMg01-544E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508J08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-129N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093B19
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-125G04.b	B6Ng01-125G04.g
ACC	DH928035	DH928036
length	355	1,157
definition	DH928035\|Mus musculus domesticus DNA, BAC clone: B6Ng01-125G04, 5' end.	DH928036\|Mus musculus domesticus DNA, BAC clone: B6Ng01-125G04, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	ttttagaatgttttatacatgcaagtctaaatgaactggagataaatgca gaattggtgctgtaactttgtaatttgcaaatatccaagtagaatgggaa atgtaccaaatagtttttgcaaaggaacatttttccagagatgagtaaag acataagagtgatccagaaaagatcatcaagtagaacattgctagtatcg tggtctgcttggttaggggatggggtgtataagtgtctggtgcctgggga aagtgttgctgattttcttgaccctttcctgaatcatccatctgtggcaa tgttgtatagcggtttcctccaaattgaaacattccctacagaagggagg gaggg	gaattctcacctgaggaataccgaatggcagagaagcacttgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgtggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaactggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaacaggtaagaaggactcatgctccactgt tcatagcagccttatttataatagccagaagctggaaagaacctagatgc ccctcaacagaggaatggatacagaaaatgtggtacatctacacaatgga gtactactcagctattaaaaagaatgaatttatgaagttcctagccaaat ggatggacctggagggcatcatcctgagtgaggtaacacattcacaaaga aactcacacaatatgtattcactgataagtggatattagccccaaaccta ggatacccaagatataagatataatttgttaaacacatgaaactcaagaa gaatgaagactgaagtgtggacactatgcccctccttagatttgggaaca aaacacccatggaaggagttacagagccaaagtttggagctgagatgaaa ggatggaccatgtagagactgccatatccagggatccaccccataatcag catccaaatgctgacaccattgcatacactagcaagattttttgaaagga cccagatgtagctgtctcttgtgagactatgcccgggcctagcaaacaca gaagtggatgctcacagtcagctaatggatggatcatagggctcccaatg gaggagctagagaagtagccaagagctaaagggatctgcaccctatagtg gacacattttgactaaccagtacccgagctcttgactctagctgcatatt atatcaaagatggctagtcgcatcactgggaaagagagccatgacttgca ccttattgccagtacaggatcaccaggtcaaagggaagttgtggcaagga atgggtg
quality values	Open. Hide. 61 61 61 61 59 59 61 59 49 44 49 61 61 61 61 61 61 61 43 61 44 39 24 27 27 30 28 39 34 39 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 59 61 61 61 61 61 61 61 59 44 59 61 61 61 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 59 55 61 61 61 59 59 59 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 44 55 59 59 61 59 55 59 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 55 61 55 61 61 61 55 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 55 25 10	Open. Hide. 55 47 39 49 43 43 31 28 22 20 26 33 35 61 59 61 61 45 59 59 59 59 59 59 59 59 61 61 52 59 59 61 59 61 61 59 59 59 59 61 61 61 61 59 59 59 59 59 59 59 52 52 43 35 49 52 59 61 59 59 59 37 44 59 61 61 59 61 59 59 52 61 59 59 59 61 61 61 61 59 59 61 61 59 59 59 61 61 61 59 59 61 61 59 61 61 44 44 59 61 59 59 61 59 59 59 59 59 59 59 59 59 59 59 52 59 59 59 52 61 59 59 61 59 59 59 59 59 41 61 61 59 52 59 59 59 59 59 59 59 41 44 61 59 61 61 59 59 59 59 59 39 61 59 59 59 59 61 61 59 59 59 61 59 61 61 61 59 59 61 61 61 61 55 55 59 61 59 61 61 61 61 59 61 61 61 61 59 59 59 59 61 61 61 59 59 61 61 59 61 61 59 61 59 61 61 59 59 59 61 59 59 61 61 61 59 61 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 59 59 52 59 61 61 59 59 59 59 61 59 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 59 59 61 59 49 59 59 59 59 59 59 59 59 59 61 59 61 59 61 59 61 59 52 59 59 59 59 59 59 59 61 55 55 55 55 55 61 55 55 55 55 61 55 61 61 61 61 61 55 52 61 55 49 61 55 61 55 55 55 55 55 55 61 55 55 61 55 55 61 55 61 61 55 61 61 55 61 55 52 55 61 55 55 55 61 55 61 61 61 55 55 55 50 61 55 50 55 55 50 61 61 61 61 61 61 61 55 50 55 50 55 55 55 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 55 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 50 50 61 50 50 61 47 61 61 61 61 61 61 61 61 61 61 53 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 42 53 57 53 53 57 53 53 53 53 57 57 53 57 57 57 57 57 57 53 53 42 47 57 53 53 57 57 53 53 57 57 46 47 57 57 57 57 47 36 57 57 45 47 57 53 53 57 53 57 57 47 57 53 53 57 53 47 42 45 53 53 53 50 53 43 47 53 52 50 53 39 53 47 52 53 47 39 53 52 52 52 53 53 53 42 47 53 45 37 57 47 30 52 57 52 45 52 53 53 37 53 37 53 43 52 53 53 52 37 28 38 46 43 33 46 46 57 52 25 57 53 52 57 53 50 35 53 39 50 37 53 57 46 28 47 37 40 37 42 48 50 52 47 52 38 38 42 30 37 37 57 46 38 29 53 39 53 57 52 42 53 36 57 46 25 15 38 40 48 52 28 53 40 43 34 20 53 38 27 52 31 46 28 38 30 37 53 30 34 34 53 48 28 57 38 37 33 31 48 44 33 35 35 30 57 57 36 40 27 33 40 35 33 20 40 25 57 31 33 53 30 40 36 34 27 45 44 30 33 36 37 57 53 34 37 33 45 30 39 18 44 31 22 25 30 27 30 30 30 44 16 29 48 27 45 44 27 30 51 32 44 30 37 21 33 32 30 45 17 29 31 38 43 45 24 26 34 25 21 29 48 18 12 37 29 29 32 24 30 28 48 29 29 29 34 39 26 29 22 34 27 29 24 29 24 27 45 34 11 20 22 36 21 29 51 51 29 21 34 22 28 30 27 21 27 29 25 29 36 20 20 51 27 28 34 26 28 32 31 17 23 28 29 20 41 28 29 23 19 29 21 31 28 29 29 31 25 28 19 21 23 26 12 17 17 8 5 8 9 17 51 26 23 25 22 26 51 36 22 14 29 23 36 27 12 10 26 33 25 17 22 26 21 19 8 25 25 27 35 16 19 13 24 18 28 21 5 36 11 29 44 20 6 12 28 30 14 24 29 51 22 21 19 22 23 20 22 36 10 10 19 31 21 10 20 27 26 30 19 24 11 29 28 35 23 25 26 33 19 16 19 25 25 12 17 26 25 13 13 26 27 31 16 6 26 28 22 27 9 39 29 10 16 27 31 21 32 23 7 19 11 27 26 21 12 19 12 32 29 6 18 23 19 27 19 27 11 33 13 16 23 34 9 35 23 10 42 16 10 12 24 19 31 17 29 7 34 13 6 14 11 9 13 10 12 14 17 8 12 6 6 27 37 37 26 11 31 17 19 18 18 19 29 16 20 29 18 33 42 25 27 5 5 9 22 23 13 30 21 16 9 6 5 5 6 24 24 23 24 23 10 9 4 4 10 9 8 6 4 5 15 35 16 11 27 9 11 12 4 4 16 6 5 6 4 4 3 17 12 8 11 13 23 16 5 18 22 6 4 5 3 2 3 4 3 9 7 5 2 3 9 13 9 4 4 1 4 19 13 7 4 6 5 17 19 5 6 11 4 13 4 6 6 5 5 6 6 16 17 8 14 6 1 6 17 19 17 14 24 5 9 4 4 6 3 4 1 15 4 5 7 6 17 14 6 14 5 6 19 3 3 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_163281924_163282278
seq2: B6Ng01-125G04.b_53_407 (reverse)

seq1  CCCTCCCTCCCTTCTGTAGGGAATGTTTCAATTTGGAGGAAACCGCTATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCCTCCCTTCTGTAGGGAATGTTTCAATTTGGAGGAAACCGCTATA  50

seq1  CAACATTGCCACAGATGGATGATTCAGGAAAGGGTCAAGAAAATCAGCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACATTGCCACAGATGGATGATTCAGGAAAGGGTCAAGAAAATCAGCAA  100

seq1  CACTTTCCCCAGGCACCAGACACTTATACACCCCATCCCCTAACCAAGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTTCCCCAGGCACCAGACACTTATACACCCCATCCCCTAACCAAGCA  150

seq1  GACCACGATACTAGCAATGTTCTACTTGATGATCTTTTCTGGATCACTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCACGATACTAGCAATGTTCTACTTGATGATCTTTTCTGGATCACTCT  200

seq1  TATGTCTTTACTCATCTCTGGAAAAATGTTCCTTTGCAAAAACTATTTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTCTTTACTCATCTCTGGAAAAATGTTCCTTTGCAAAAACTATTTGG  250

seq1  TACATTTCCCATTCTACTTGGATATTTGCAAATTACAAAGTTACAGCACC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATTTCCCATTCTACTTGGATATTTGCAAATTACAAAGTTACAGCACC  300

seq1  AATTCTGCATTTATCTCCAGTTCATTTAGACTTGCATGTATAAAACATTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCTGCATTTATCTCCAGTTCATTTAGACTTGCATGTATAAAACATTC  350

seq1  TAAAA  355
      |||||
seq2  TAAAA  355

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information