MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-125L18
Chromosome	X (Build37)
Map Location	24,862,331 - 24,863,145
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC669000, LOC629204, EG546272, LOC100043216, EG546282, LOC100040417, LOC100040428, LOC100040433, Xmr, LOC100038968
Downstream gene	LOC100038977, LOC100038997, LOC664810, EG382275, LOC100039030, LOC100039065, LOC100039078
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC669000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC629204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 5 Proteins pseudo : _no_value

name	EG546272 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546272 MGI:3643862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 11 ESTs, 5 Proteins

name	LOC100043216 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 7 ESTs, 5 Proteins

name	EG546282 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546282 MGI:3646322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040417 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040417
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins pseudo : _no_value

name	LOC100040428 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs

name	LOC100040433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins pseudo : _no_value

name	Xmr (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins pseudo : _no_value

name	LOC100038977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 3 ESTs, 5 Proteins

name	LOC100038997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins

name	LOC664810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	EG382275 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382275 MGI:3703318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039030 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs, 5 Proteins

name	LOC100039065 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 5 Proteins

name	LOC100039078 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 90 ESTs, 1 Protein

name	EG546272 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406980 GeneID:546272 MGI:3643862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 5 Proteins product : predicted gene, EG546272, transcript variant 2 transcript_id : XM_620960.3

name	EG546272 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271016 GeneID:546272 MGI:3643862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 5 Proteins product : predicted gene, EG546272, transcript variant 1 transcript_id : XM_001478430.1

name	LOC100043216 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271020 GeneID:100043216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs, 5 Proteins product : hypothetical protein LOC100043216, transcript variant 2 transcript_id : XM_001478456.1

name	LOC100043216 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271018 GeneID:100043216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 5 Proteins product : hypothetical protein LOC100043216, transcript variant 1 transcript_id : XM_001478447.1

name	EG546282 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090645 GeneID:546282 MGI:3646322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546282 transcript_id : NM_001081657.1

name	LOC100040428 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271221 GeneID:100040428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs product : hypothetical protein LOC100040428 transcript_id : XM_001474898.1

name	Xmr (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:100816606 GeneID:382277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Xmr protein transcript_id : NM_001040669.1

name	LOC100038977 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271231 GeneID:100038977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 5 Proteins product : hypothetical protein LOC100038977, transcript variant 2 transcript_id : XM_001472083.1

name	LOC100038977 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271229 GeneID:100038977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 5 Proteins product : hypothetical protein LOC100038977, transcript variant 1 transcript_id : XM_001472060.1

name	LOC100038997 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271233 GeneID:100038997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to XMR transcript_id : XM_001472117.1

name	EG382275 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801953 GeneID:382275 MGI:3703318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG382275 transcript_id : NM_001025607.2

name	LOC100039030 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271240 GeneID:100039030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs, 5 Proteins product : similar to Xmr protein, transcript variant 2 transcript_id : XM_001472195.1

name	LOC100039030 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271238 GeneID:100039030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 5 Proteins product : similar to Xmr protein, transcript variant 1 transcript_id : XM_001472174.1

name	LOC100039065 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271246 GeneID:100039065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs, 5 Proteins product : similar to Sycp3 like X-linked, transcript variant 2 transcript_id : XM_001472332.1

name	LOC100039065 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271244 GeneID:100039065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 5 Proteins product : similar to Sycp3 like X-linked, transcript variant 1 transcript_id : XM_001472304.1

name	LOC100039078 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271248 GeneID:100039078
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 90 ESTs, 1 Protein product : similar to RIKEN cDNA 1810037I17 gene transcript_id : XM_001472358.1

name	EG546272 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271017 GeneID:546272 MGI:3643862
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001478480.1

name	EG546272 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83000007 GeneID:546272 MGI:3643862
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_620960.2

name	LOC100043216 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271019 GeneID:100043216
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001478497.1

name	LOC100043216 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271021 GeneID:100043216
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001478506.1

name	EG546282 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090646 GeneID:546282 MGI:3646322
definition	codon_start : 1 note : novel protein similar to Xlr-related, meiosis regulated (Xmr) product : hypothetical protein LOC546282 protein_id : NP_001075126.1

name	LOC100040428 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271222 GeneID:100040428
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474948.1

name	Xmr (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:100816607 GeneID:382277
definition	codon_start : 1 product : Xmr protein protein_id : NP_001035759.1

name	LOC100038977 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271230 GeneID:100038977
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472110.1

name	LOC100038977 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271232 GeneID:100038977
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472133.1

name	LOC100038997 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271234 GeneID:100038997
definition	codon_start : 1 product : similar to XMR protein_id : XP_001472167.1

name	EG382275 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037366 GeneID:382275 MGI:3703318
definition	codon_start : 1 note : novel protein similar to Xlr-related, meiosis regulated (Xmr) product : similar to XMR protein_id : NP_001020778.1

name	LOC100039030 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271239 GeneID:100039030
definition	codon_start : 1 product : similar to Xmr protein isoform 1 protein_id : XP_001472224.1

name	LOC100039030 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271241 GeneID:100039030
definition	codon_start : 1 product : similar to Xmr protein isoform 2 protein_id : XP_001472245.1

name	LOC100039065 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271245 GeneID:100039065
definition	codon_start : 1 product : similar to Sycp3 like X-linked isoform 1 protein_id : XP_001472354.1

name	LOC100039065 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271247 GeneID:100039065
definition	codon_start : 1 product : similar to Sycp3 like X-linked isoform 2 protein_id : XP_001472382.1

name	LOC100039078 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271249 GeneID:100039078
definition	codon_start : 1 product : similar to RIKEN cDNA 1810037I17 gene protein_id : XP_001472408.1

name	LOC669000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669000
definition	number : 1 pseudo : _no_value

name	LOC669000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669000
definition	number : 2 pseudo : _no_value

name	LOC669000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669000
definition	number : 3 pseudo : _no_value

name	LOC669000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669000
definition	number : 4 pseudo : _no_value

name	LOC669000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669000
definition	number : 5 pseudo : _no_value

name	LOC669000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669000
definition	number : 6 pseudo : _no_value

name	LOC669000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669000
definition	number : 7 pseudo : _no_value

name	LOC669000 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669000
definition	number : 8 pseudo : _no_value

name	LOC629204 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271015 GeneID:629204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 5 Proteins product : hypothetical LOC629204 pseudo : _no_value transcript_id : XR_035701.1

name	LOC100040417 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271220 GeneID:100040417
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_031969.1

name	LOC100040433 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271223 GeneID:100040433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins product : similar to Xlr-like pseudo : _no_value transcript_id : XR_031984.1

name	LOC100038968 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271228 GeneID:100038968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : similar to Sycp3 like X-linked pseudo : _no_value transcript_id : XR_030540.1

name	LOC664810 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271237 GeneID:664810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : hypothetical LOC664810 pseudo : _no_value transcript_id : XR_001649.2

clone name	MSMg01-304I16
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-118K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227A15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-125L18.b	B6Ng01-125L18.g
ACC	DH928285	DH928286
length	1,224	893
definition	DH928285\|Mus musculus domesticus DNA, BAC clone: B6Ng01-125L18, 5' end.	DH928286\|Mus musculus domesticus DNA, BAC clone: B6Ng01-125L18, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggaataccgaatggcagagaagcacccgaaaaatgg cttagctccatttcttatttcaccccgtatagattcctctcttacagctc gagtagccttctcagttgaaccgttcatgttgcgagctgctggcgtacac aacattttggggccagaactgggacctaaaaatggcagagggatgctaag agaaacgctgctgctatggagctccacagttaaggatcttcctatcgggc atcggagcaatggacaggtacacatgctagcagtaccttaaaatttcagt tttgtaaagtgttgctgagtttgcggtaggatacgaattaagcttgaatc agtgctaacccaatgctggttctgcttgggtgagcagcgtgttaatctga actagaaacggaaataggccggtcggccacagctttttaggaagctgctt aggtggaagaagaaagggtttaaagtcatgaatcaggcggttgcccttag ttttcaggagttgtttcaggccagaggagtaaggcttgaagtacaattag taagaaattttttaggtaagatggatagctgttgcccatggttcaaggaa gaagaaacagcctcttagtttcagagtaaaaaagctaataagtggtttgt gactaatgtgtttgacaatggtaaagtgttttttattctatgattgtagc tacaaaaattaatattctctaattggtctaaaatgaactgcttcatctgg ttcctttttcttgataatgtgctccacatgtcttcacattaagttcataa gttgttggttaagattaataattgttacattgatacagatggttagtgtt aaatttgataactcaagtttagagtctttccgacacgtggcataagacag cccaagaggctgggtcttctaaagatatttctagtttaaataataattaa tgtggtccctatcctaaatagtaaaatttaaataaatttaaagcaatgct ctttattaaagcattaaagctgcttaataggtattcataggtattatgac atcaaacttcatatatgatagtatgcttctatatgatttaagaatatagt gtttgacttggttgctttccagttgtaggtttattctaacgatccagaac ttaagttaggtaactgcatgtccattgactaccgttgcatgaagccaata aattgtagtgctccgaattatgat	gaattcacgcagttgaatccttctcaacagtctgtattacgggaacactt cattaccaccgttccccagctgaagagttctgaattcacgcagttgaatc cttctcaacagtctgttttacgggaacctttatgaccgtgacccgcagtt ctggttccggaatgagggatcttccttgcgccggtgatggtaaattccgt cccggggttttctcgtcccaggatttctcgtcccaggtcttctcgtcccg ggtcttctcgtcccgggtcttctcgtcccatgtctcagcaccaactctta cccgagtttcggcaccaactcttacacgcgttctcgcgaccggccaggaa gaacacaacaaaccggaatcttctgcggcaaaactttattgcttacatct tcaggagcaagagtgcaagagagcaagaaaaagaacaagaacaagaaagc aagagaggagagagaaaaagcaagaacaagagagagacaaaagcaagaac aagagagagaaaaagcatggcaaaaccccgtcccttttaaggagaattat cctccgcctaggacgtattactccctgattggctgcagcccatcggctca gttgtcatcacgggaaaggcagaacacatggcgggaaaactgcccctgca cgtgtgcagattatgtttaccacttagaacacagctgtcagcgccatctt ataatggcaaatgtgagggcgggctcccaacagtaaaaataatgcctacg taaaccattgaaccaagagaaatcaagctggtgcttaaatagagaccaca caaaatgactagtgctgatggtactggaaggcactcctcaagctaccaag ggaggaacgtaatatcaattcagctacaaaagttttaaccttt
quality values	Open. Hide. 61 47 37 38 61 61 61 47 32 61 61 61 61 61 61 61 61 38 49 61 61 61 61 61 61 49 61 59 49 27 26 37 26 30 52 52 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 55 44 59 59 61 61 61 61 61 61 61 61 61 55 59 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 59 59 61 61 61 61 61 61 61 61 61 55 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 53 61 61 50 61 61 53 61 61 61 61 61 52 57 57 57 57 57 53 57 52 53 50 57 53 57 57 57 53 53 57 57 57 57 53 43 57 47 37 47 53 57 57 53 53 57 57 53 53 38 57 57 53 52 57 57 53 57 57 50 57 57 57 57 53 45 57 57 57 57 53 53 50 53 57 57 57 57 50 57 57 50 57 57 47 52 38 50 47 47 53 53 57 46 53 50 47 57 53 53 39 24 57 30 53 57 57 57 57 57 57 50 53 53 53 52 52 53 53 53 41 57 41 32 57 35 57 32 57 53 38 45 50 53 52 52 50 57 52 46 43 39 53 37 31 53 53 57 34 31 52 57 57 50 37 53 34 41 57 57 57 36 42 48 52 53 38 42 48 53 53 34 41 52 28 53 48 53 57 37 53 10 57 57 57 37 33 52 27 57 40 40 40 42 52 53 45 40 40 37 36 53 40 37 29 48 33 21 57 57 33 30 53 53 30 32 41 48 33 53 47 37 28 37 41 40 39 33 30 36 28 57 35 57 51 51 32 30 24 43 36 32 30 27 36 34 48 30 32 30 47 30 48 36 30 27 31 47 30 43 48 14 30 19 33 29 38 30 20 36 29 39 30 29 28 29 24 43 30 29 33 36 20 33 38 31 20 36 33 32 24 30 12 29 32 31 34 18 22 26 29 46 20 16 26 29 15 43 33 43 29 27 26 41 24 29 41 27 35 33 7 29 28 23 16 43 15 27 22 41 33 34 51 36 28 34 26 29 28 31 35 34 14 28 33 29 51 21 27 19 29 23 25 34 28 43 20 12 23 6 26 25 14 29 18 10 24 32 12 22 28 17 38 18 35 19 25 27 24 36 13 15 23 16 29 15 21 19 25 33 51 40 23 12 11 13 21 20 28 51 28 23 29 15 33 30 43 26 29 26 31 28 16 51 21 22 51 16 7 5 22 8 14 35 17 28 22 26 17 18 5 14 13 6 7 38 14 19 28 24 20 23 23 24 51 21 18 14 12 16 28 51 51 25 14 37 22 29 35 29 12 33 37 28 12 39 20 19 33 22 13 18 16 13 16 18 22 4 8 8 44 20 17 9 25 7 34 16 21 34 20 18 15 23 44 15 29 22 31 26 26 13 24 9 8 14 10 22 29 11 15 17 21 9 5 5 11 10 25 6 5 5 13 6 3 7 12 26 8 18 31 6 36 10 29 17 14 16 16 20 33 6 23 10 25 24 8 5 15 13 29 11 14 11 19 15 23 5 21 5 11 26 19 11 17 36 12 6 7 6 6 10 4 16 9 25 6 9 5 9 29 4 1 4 5 6 6 17 19 16 20 9 9 10 25 7 5 13 3 2 4 3 12 14 5 5 9 2 1 5 8 7 5 21 7 5 11 6 5 12 7 4 4 7 11 18 21 10 13 6 3 7 4 7 10 3 3 13 17 4 5 7 13 13 18 5 2 3 7 4 13 5 10 11 5 3 10 8 6 4 7 3 13 4 10 9 2 4 1 6 3 17 7 5 12 4 17 5 13 14 3 5 3 3 2 6 3 6 6 16 4 17 5 4 10 19 18 10 1 1 4 1	Open. Hide. 61 47 49 38 55 36 13 32 17 20 12 15 19 55 61 61 52 61 61 61 61 61 61 61 49 36 61 49 49 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 52 59 55 55 37 41 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 53 61 50 61 61 61 53 52 53 50 61 50 61 61 61 61 50 61 61 53 50 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 57 43 53 57 57 57 57 57 57 53 57 57 57 53 53 57 47 57 53 57 53 57 53 57 57 57 57 57 47 57 53 53 53 57 36 53 47 53 53 57 53 53 50 57 53 53 42 50 53 53 53 53 52 45 53 53 57 36 53 30 53 53 51 53 57 57 57 52 52 57 57 57 53 53 53 36 52 57 57 50 52 46 53 37 47 28 33 47 47 45 50 43 38 39 39 47 43 32 52 36 52 52 45 52 50 30 52 34 53 46 46 50 52 46 50 41 53 38 34 22 57 52 32 53 45 30 35 38 42 38 53 53 25 23 43 53 37 27 51 53 53 30 53 52 42 40 40 53 34 38 28 43 42 38 53 44 47 28 23 38 52 53 53 40 42 31 52 41 24 38 53 57 53 52 57 31 17 34 14 42 37 52 37 34 33 37 27 42 37 52 31 57 57 52 37 57 57 30 42 33 53 32 45 41 44 33 53 40 30 52 40 37 33 33 53 37 37 37 52 31 37 40 44 52 32 57 12 16 37 37 30 37 28 18 29 33 46 47 36 29 35 29 36 36 40 47 34 32 25 37 41 33 37 53 21 30 33 36 48 34 39 13 37 28 46 26 18 30 51 30 29 47 19 30 29 14 46 31 23 10 51 29 20 31 32 47 39 27 31 30 28 37 30 30 51 51 51 38 39 32 29 27 24 9 44 26 28 29 27 29 30 29 30 28 17 21 18 29 30 25 17 27 25 22 23 22 30 12 32 46 25 28 25 23 24 25 28 28 38 40 14 43 29 27 32 25 51 33 23 28 32 38 19 29 23 22 20 29 8 19 15 43 43 43 22 29 22 28 29 30 14 9 29 22 35 31 33 27 29 29 15 24 28 25 29 28 33 29 5 23 14 19 23 29 31 28 23 18 14 26 26 23 28 17 23 23 19 13 43 46 13 19 16 23 26 26 26 20 21 41 30 28 17 28 29 21 16 23 6 36 13 18 28 22 14 18 8 36 36 21 28 31 51 44 18 19 29 18 17 14 28 21

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_24862331_24863145
seq2: B6Ng01-125L18.g_69_884

seq1  GAATTCACGCAGTTGAATCCTTCTCAACAGTCTGTATTACGGGAACACTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACGCAGTTGAATCCTTCTCAACAGTCTGTATTACGGGAACACTT  50

seq1  CATTACCACCGTTCCCCAGCTGAAGAGTTCTGAATTCACGCAGTTGAATC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTACCACCGTTCCCCAGCTGAAGAGTTCTGAATTCACGCAGTTGAATC  100

seq1  CTTCTCAACAGTCTGTTTTACGGGAACCTTTATGACCGTGACCCGCAGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCAACAGTCTGTTTTACGGGAACCTTTATGACCGTGACCCGCAGTT  150

seq1  CTGGTTCCGGAATGAGGGATCTTCCTTGCGCCGGTGATGGTAAATTCCGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTTCCGGAATGAGGGATCTTCCTTGCGCCGGTGATGGTAAATTCCGT  200

seq1  CCCGGGGTTTTCTCGTCCCAGGATTTCTCGTCCCAGGTCTTCTCGTCCCG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGGGGTTTTCTCGTCCCAGGATTTCTCGTCCCAGGTCTTCTCGTCCCG  250

seq1  GGTCTTCTCGTCCCGGGTCTTCTCGTCCCATGTCTCAGCACCAACTCTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTTCTCGTCCCGGGTCTTCTCGTCCCATGTCTCAGCACCAACTCTTA  300

seq1  CCCGAGTTTCGGCACCAACTCTTACACGCGTTCTCGCGACCGGCCAGGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGAGTTTCGGCACCAACTCTTACACGCGTTCTCGCGACCGGCCAGGAA  350

seq1  GAACACAACAAACCGGAATCTTCTGCGGCAAAACTTTATTGCTTACATCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACACAACAAACCGGAATCTTCTGCGGCAAAACTTTATTGCTTACATCT  400

seq1  TCAGGAGCAAGAGTGCAAGAGAGCAAGAAAAAGAACAAGAACAAGAAAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGAGCAAGAGTGCAAGAGAGCAAGAAAAAGAACAAGAACAAGAAAGC  450

seq1  AAGAGAGGAGAGAGAAAAAGCAAGAACAAGAGAGAGACAAAAGCAAGAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAGGAGAGAGAAAAAGCAAGAACAAGAGAGAGACAAAAGCAAGAAC  500

seq1  AAGAGAGAGAAAAAGCATGGCAAAACCCCGTCCCTTTTAAGGAGAATTAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAGAGAAAAAGCATGGCAAAACCCCGTCCCTTTTAAGGAGAATTAT  550

seq1  CCTCCGCCTAGGACGTATTACTCCCTGATTGGCTGCAGCCCATCGGCTCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCGCCTAGGACGTATTACTCCCTGATTGGCTGCAGCCCATCGGCTCA  600

seq1  GTTGTCATCACGGGAAAGGCAGAACACATGGCGGGAAAACTGCCCCTGCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTCATCACGGGAAAGGCAGAACACATGGCGGGAAAACTGCCCCTGCA  650

seq1  CGTGTGCAGATTATGTTTACCACTTAGAACACAGCTGTCAGCGCCATCTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGTGCAGATTATGTTTACCACTTAGAACACAGCTGTCAGCGCCATCTT  700

seq1  ATAATGGCAAATGTGAGGGC-GGCTCCCAACAGTAAAAATAATGCCTACG  749
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  ATAATGGCAAATGTGAGGGCGGGCTCCCAACAGTAAAAATAATGCCTACG  750

seq1  TAAACCATTGAACCAAGAGAAATCAAGCTGGTGCTTAAATAGAGACCACA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACCATTGAACCAAGAGAAATCAAGCTGGTGCTTAAATAGAGACCACA  800

seq1  CAAAATGACTAGTGCT  815
      ||||||||||||||||
seq2  CAAAATGACTAGTGCT  816

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information