MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-156G10
Chromosome	X (Build37)
Map Location	30,282,537 - 30,282,972
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100042122, LOC100042135, LOC100042144, LOC664982, LOC100039212, EG664989, LOC664996, LOC100039467, LOC100039481, LOC100039224, LOC100039500, LOC100040448
Downstream gene	LOC100040458, LOC100040467, EG546176, LOC100040482, LOC629997, 1700017G21Rik, LOC665014, EG546205, LOC100040533, LOC100039328, LOC100040552, LOC100040575, LOC100040585
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100042135 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100042144 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC664982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs

name	LOC100039212 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG664989 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664989 MGI:3646492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 5 Proteins

name	LOC100039481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs

name	LOC100039224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100039500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	LOC100040448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100040458 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100040467 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins

name	EG546176 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546176 MGI:3645924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100040482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC629997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	1700017G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71847 MGI:1919097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG546205 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546205 MGI:3647272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 24 Proteins

name	LOC100040533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100039328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100040552 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	LOC100040575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins pseudo : _no_value

name	LOC100040585 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 26 Proteins

name	LOC100042135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271410 GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs product : hypothetical protein LOC100042135, transcript variant 1 transcript_id : XM_001477363.1

name	LOC100042135 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271408 GeneID:100042135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100042135, transcript variant 2 transcript_id : XM_001477384.1

name	LOC100042144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271414 GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001477423.1

name	LOC100042144 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271412 GeneID:100042144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001477404.1

name	LOC664982 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271416 GeneID:664982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs product : hypothetical LOC664982 transcript_id : XM_973856.2

name	LOC100039212 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271417 GeneID:100039212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472463.1

name	LOC664996 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271422 GeneID:664996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC664996 transcript_id : XM_973930.2

name	LOC100039467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271425 GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001473144.1

name	LOC100039467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271423 GeneID:100039467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001473126.1

name	LOC100039481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271429 GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039481, transcript variant 1 transcript_id : XM_001473156.1

name	LOC100039481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271427 GeneID:100039481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100039481, transcript variant 2 transcript_id : XM_001473178.1

name	LOC100039224 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271419 GeneID:100039224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472484.1

name	LOC100040448 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271435 GeneID:100040448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474927.1

name	LOC100040458 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271437 GeneID:100040458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474942.1

name	LOC100040467 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271439 GeneID:100040467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001474959.1

name	EG546176 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407266 GeneID:546176 MGI:3645924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : predicted gene, EG546176 transcript_id : XM_620811.3

name	LOC100040482 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271441 GeneID:100040482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474981.1

name	1700017G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803050 GeneID:71847 MGI:1919097
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700017G21 gene transcript_id : NM_027955.2

name	EG546205 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271443 GeneID:546205 MGI:3647272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 24 Proteins product : predicted gene, EG546205 transcript_id : XM_620848.4

name	LOC100040533 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271444 GeneID:100040533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001475026.1

name	LOC100040552 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271446 GeneID:100040552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : similar to 4930408F14Rik protein transcript_id : XM_001475040.1

name	LOC100040585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271451 GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001475099.1

name	LOC100040585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271449 GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001475074.1

name	LOC100042135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271409 GeneID:100042135
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477434.1

name	LOC100042135 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271411 GeneID:100042135
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477413.1

name	LOC100042144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271413 GeneID:100042144
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001477454.1

name	LOC100042144 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271415 GeneID:100042144
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001477473.1

name	LOC664982 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407259 GeneID:664982
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978950.1

name	LOC100039212 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271418 GeneID:100039212
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472513.1

name	LOC664996 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407262 GeneID:664996
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979024.1

name	LOC100039467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271424 GeneID:100039467
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473176.1

name	LOC100039467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271426 GeneID:100039467
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473194.1

name	LOC100039481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271428 GeneID:100039481
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473228.1

name	LOC100039481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271430 GeneID:100039481
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473206.1

name	LOC100039224 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271420 GeneID:100039224
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472534.1

name	LOC100040448 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271436 GeneID:100040448
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474977.1

name	LOC100040458 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271438 GeneID:100040458
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474992.1

name	LOC100040467 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271440 GeneID:100040467
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475009.1

name	EG546176 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63830935 GeneID:546176 MGI:3645924
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_620811.1

name	LOC100040482 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271442 GeneID:100040482
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475031.1

name	1700017G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313693 GeneID:71847 MGI:1919097
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC71847 protein_id : NP_082231.1

name	EG546205 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63831219 GeneID:546205 MGI:3647272
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_620848.1

name	LOC100040533 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271445 GeneID:100040533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475076.1

name	LOC100040552 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271447 GeneID:100040552
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475090.1

name	LOC100040585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271450 GeneID:100040585
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 1 protein_id : XP_001475124.1

name	LOC100040585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271452 GeneID:100040585
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 2 protein_id : XP_001475149.1

name	LOC629997 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629997
definition	number : 1 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 3 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 2 pseudo : _no_value

name	LOC665014 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665014
definition	number : 1 pseudo : _no_value

name	LOC100039328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039328
definition	number : 2 pseudo : _no_value

name	LOC100039328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039328
definition	number : 1 pseudo : _no_value

name	LOC100042122 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271407 GeneID:100042122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_033191.1

name	EG664989 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271421 GeneID:664989 MGI:3646492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664989 pseudo : _no_value transcript_id : XR_035658.1

name	LOC100039500 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271431 GeneID:100039500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated pseudo : _no_value transcript_id : XR_031082.1

name	LOC100040575 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271448 GeneID:100040575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins product : similar to mgclh pseudo : _no_value transcript_id : XR_032063.1

clone name	MSMg01-280I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-547A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-316D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-261I16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-371B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-383M18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-414F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415O13
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-198E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-156G10.b	B6Ng01-156G10.g
ACC	DH950916	DH950917
length	1,270	430
definition	DH950916\|Mus musculus domesticus DNA, BAC clone: B6Ng01-156G10, 5' end.	DH950917\|Mus musculus domesticus DNA, BAC clone: B6Ng01-156G10, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccaagaacttatagaattcaactaaagtgaagacatatcatacca aatatcatggggcacaatttaaacagcattaagtgaaaaattcatagcat taaatgcctttgtaaagaattttcaagagattctatacaagcaagttaaa agaacacctaacatctctagaacagaaagaagcaaagtacaccaaagaag agtagatgtgagaatattgtcaagctcagggctgaaatcaactggttaca aactaagagaatgattcaaaaaatcaacaaaccaagagctggtttgttaa gaaaatcaacaagatagatatgatatacccttagccaaattaactaaagg tcacagagacagtatccaaactaacaaaatcagaaatgaaaaagatacat aacaacagaatctgagaaaattcaagaaaatcatctgaagcaactacaaa accgtttagctctacaaaactgaaaaaatctagatggctttctgtactaa agtcaaatcaaggtcaggtaaactatctaaacagtcctataacacctaag acaatacagagagttatcaaaaaacctcccaaacaaaaaagtccaatgcc agactgttttagtgaagaattctaccagaccttaaataagatctaatacc attactcctcaaactattccacaaaatagaaacaaaagaaaaactaccta tttcgttctatgaagccacaattactctgatacctaaatcacacaaagac ccaactaagaaagagaacttcagaccaatcttgcctatgaatattggtgc aaaaatactcaacaaaattcttgcaaactgaatctaagaacacatcaaaa cctttatttaccatgattaagtaggcttcagcctaaaggatacagggatt gttcaatatatacaaatacttcaacataatatactatataaacaaaccca agggaaagaaaccacatgatcatctcattagatgctgaaacagccttcaa taaaatttaacacccattcatggtaaaagtcttggaaagatcaggagttc agagcacattatatacatataaggcgatataggtgcaaataaacagcaac atgaaatcatgaagaggaatttagagccattcccactattcagggacaaa gacagggtgcacctctttctatctattccatacagagtactcggaacgct agctggagcaggtggtattataaggatttcaggggatgcaaattgggaag gacctacggggcgcaggatc	acaggtttttatatttcttcactcagtttagggatgaaagctaagtcatt ttcttcctttctggaaaagcactatttaaatggcattcgtctttgtcata taccctctaaatatcagggaacattggaggctcttcttttctattttttg gtgtccaccctattattagttttccattgcatgttcattgagattagcca gctcttttcttcctgatgcttccctctgagtatgaaataatgcaaggtag tatgtttttttgcttccttgtatgtcactgtcagaacaagtttaatgtgt cctatgccctatgtttgcacgtttatagaatttaacgtgttgagaggagg agaaatgtaagcacacctttaccctcatgaaggagatgcacctagtgtgt gtgtgtgtgtgtgtgtgtgtgtgtgtgtgt
quality values	Open. Hide. 61 43 35 38 61 61 37 14 47 61 61 61 61 61 61 61 61 61 61 61 61 49 61 40 49 13 31 31 26 22 16 19 18 28 59 59 59 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 37 44 55 59 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 44 44 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 55 61 55 55 61 55 61 61 61 61 61 61 61 61 55 61 55 50 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 57 57 57 57 57 57 57 57 57 53 53 53 57 57 57 53 57 57 57 53 53 53 57 57 57 57 53 46 47 53 57 57 57 53 53 57 57 50 57 57 39 57 52 57 53 47 53 53 53 53 53 53 47 53 53 47 47 34 53 57 53 43 53 57 57 57 57 52 52 53 38 37 53 57 57 39 47 28 53 57 53 57 57 50 57 57 53 53 52 52 57 44 47 38 57 36 25 57 53 53 50 46 41 31 45 57 37 53 39 43 41 57 53 45 53 57 53 52 31 53 50 53 53 50 53 37 53 45 53 50 50 52 52 45 57 45 53 24 41 41 53 52 50 41 52 46 39 36 53 30 57 57 47 50 53 38 46 33 38 50 14 46 57 47 50 53 41 46 53 37 39 50 40 39 46 44 48 40 57 39 38 38 38 40 40 30 37 38 53 40 53 35 40 46 23 53 28 39 47 53 34 47 53 43 44 52 52 33 37 38 37 35 32 57 34 44 37 36 35 23 44 29 53 41 48 31 19 37 27 12 40 33 48 25 35 35 43 57 33 39 48 33 37 40 36 32 34 36 28 25 43 17 39 19 32 30 39 30 28 47 26 33 29 30 30 30 32 31 29 30 44 31 40 48 36 38 34 28 47 51 51 31 29 28 29 39 36 31 29 29 28 48 51 34 31 31 29 24 30 41 28 21 39 30 26 29 29 26 27 29 37 25 13 46 29 33 27 32 17 31 21 43 35 26 46 51 36 29 33 34 51 29 24 25 51 30 28 29 25 17 30 29 29 16 27 32 26 28 35 15 24 16 21 29 33 29 20 22 29 28 20 7 39 13 39 29 24 21 17 20 15 33 51 32 16 20 43 43 39 26 28 24 29 28 28 23 17 21 16 27 23 41 20 23 24 28 16 43 28 21 22 15 18 35 21 24 15 23 26 23 26 20 29 25 29 34 20 51 24 33 22 46 23 29 46 29 12 31 20 51 15 30 44 18 17 28 38 23 15 20 16 32 11 19 24 16 19 28 19 28 34 34 30 23 28 28 31 23 35 28 33 34 31 34 29 51 19 18 9 28 23 14 24 17 26 25 13 13 22 44 44 24 27 44 20 17 6 18 15 19 35 20 12 19 21 15 15 9 8 8 29 14 44 39 24 31 17 28 13 26 18 22 22 35 15 17 25 29 20 5 10 9 12 8 15 15 15 7 7 26 7 21 6 12 5 13 7 6 7 6 7 6 3 5 15 29 8 6 19 5 7 9 15 29 18 13 29 11 8 7 9 17 10 12 30 11 23 11 32 9 16 7 25 13 23 6 10 5 16 16 7 35 7 6 2 6 5 12 17 11 9 12 6 5 4 27 5 21 16 4 4 10 23 7 8 26 9 8 26 27 13 5 12 9 17 4 4 8 7 20 30 20 4 6 3 5 7 5 4 4 18 13 11 6 11 11 16 6 20 12 5 4 4 22 11 6 3 3 7 12 4 3 9 20 6 10 5 3 5 16 7 9 6 8 4 8 6 5 5 6 4 7 7 5 3 3 6 4 6 14 15 6 7 8 10 13 6 4 10 5 4 4 8 20 6 3 4 5 10 7 4 4 4 1 4 4 6 3 9 18 6 8 12 5 5 5 5 18 10 15 5 4 11 7 11 6 13 17 5 3 3 3 2 1 1 3 6 5 4 6 5 3 1 1 1 3 3	Open. Hide. 33 49 32 26 30 28 36 39 61 61 61 61 61 61 61 59 59 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 52 37 44 30 41 59 59 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 55 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 52 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 33 11

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_30282537_30282972
seq2: B6Ng01-156G10.g_68_503

seq1  GAATTCACAGGTTTTTATATTTCTTCACTCAGTTTAGGGATGAAAGCTAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACAGGTTTTTATATTTCTTCACTCAGTTTAGGGATGAAAGCTAA  50

seq1  GTCATTTTCTTCCTTTCTGGAAAAGCACTATTTAAATGGCATTCGTCTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATTTTCTTCCTTTCTGGAAAAGCACTATTTAAATGGCATTCGTCTTT  100

seq1  GTCATATACCCTCTAAATATCAGGGAACATTGGAGGCTCTTCTTTTCTAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATATACCCTCTAAATATCAGGGAACATTGGAGGCTCTTCTTTTCTAT  150

seq1  TTTTTGGTGTCCACCCTATTATCAGTTTTCCATTGCATGTTCATTGAGAT  200
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  TTTTTGGTGTCCACCCTATTATTAGTTTTCCATTGCATGTTCATTGAGAT  200

seq1  TAGCCAGCTCTTTTCTTCCTGATGCTTCCCACTGAGTATGAAATAATGCA  250
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TAGCCAGCTCTTTTCTTCCTGATGCTTCCCTCTGAGTATGAAATAATGCA  250

seq1  AGGTAGTATGTTTGTTTGCTTGCTTGTATGTCACTGTCAGAACAAGTTTA  300
      ||||||||||||| ||||||| ||||||||||||||||||||||||||||
seq2  AGGTAGTATGTTTTTTTGCTTCCTTGTATGTCACTGTCAGAACAAGTTTA  300

seq1  ATGTGTCCTATGCCCTATGTTTGCACGTTTATAGAATTTAACGTGTTGAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGTCCTATGCCCTATGTTTGCACGTTTATAGAATTTAACGTGTTGAG  350

seq1  AGGAGGAGAAATGTAAGCACACCTTTACCCTCATGAAGGAGATGCACCTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGGAGAAATGTAAGCACACCTTTACCCTCATGAAGGAGATGCACCTA  400

seq1  GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT  436
      ||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT  436

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information