MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-156P11
Chromosome	X (Build37)
Map Location	31,997,295 - 31,997,695
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100039328, LOC100040552, LOC100040575, LOC100040585, LOC100039362, LOC100040606, LOC100040612, LOC673784, LOC100040650, LOC100040662, LOC100039419, LOC100039429, LOC100040698, LOC630028, LOC100040722, LOC100040732, LOC100040743
Downstream gene	LOC385298, LOC100039460, LOC100040781, LOC100039515, LOC100039522, LOC100039473, LOC100039550, LOC100039557, LOC100039573, EG665074, LOC100039585
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039328 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039328
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100040552 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	LOC100040575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins pseudo : _no_value

name	LOC100040585 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 26 Proteins

name	LOC100039362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100040612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	LOC673784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100040650 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 26 Proteins

name	LOC100040662 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100039419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 656 ESTs, 8 Proteins

name	LOC100039429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC630028 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100040722 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC100040732 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC100040743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC385298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100039460 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100039515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039522 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100039550 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039557 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	EG665074 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665074 MGI:3648576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 ESTs

name	LOC100039585 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100040552 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271446 GeneID:100040552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : similar to 4930408F14Rik protein transcript_id : XM_001475040.1

name	LOC100040585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271451 GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001475099.1

name	LOC100040585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271449 GeneID:100040585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001475074.1

name	LOC100040606 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271453 GeneID:100040606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001475118.1

name	LOC100040612 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271455 GeneID:100040612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : similar to 4930408F14Rik protein transcript_id : XM_001475133.1

name	LOC100040650 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271457 GeneID:100040650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001475157.1

name	LOC100040650 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271459 GeneID:100040650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001475170.1

name	LOC100040662 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271461 GeneID:100040662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001475195.1

name	LOC100039419 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271433 GeneID:100039419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 656 ESTs, 8 Proteins product : similar to translation initiation factor eIF-2 gamma subunit transcript_id : XM_001472848.1

name	LOC100040698 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271463 GeneID:100040698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : similar to mgclh transcript_id : XM_001475217.1

name	LOC100040722 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271465 GeneID:100040722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : similar to mgclh transcript_id : XM_001475235.1

name	LOC100040732 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271467 GeneID:100040732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : similar to RIKEN cDNA 1700017G21 gene transcript_id : XM_001475255.1

name	LOC100040743 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271469 GeneID:100040743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001475272.1

name	LOC100040781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271471 GeneID:100040781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001475289.1

name	LOC100039515 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271476 GeneID:100039515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC100039515 transcript_id : XM_001473228.1

name	LOC100039473 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271474 GeneID:100039473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to pol protein transcript_id : XM_001472945.1

name	LOC100039550 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271482 GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : Xlr-related, meiosis regulated Xmr, transcript variant 2 transcript_id : XM_001473275.1

name	LOC100039550 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271480 GeneID:100039550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : Xlr-related, meiosis regulated Xmr, transcript variant 1 transcript_id : XM_001473259.1

name	LOC100039557 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271484 GeneID:100039557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC100039557 transcript_id : XM_001473294.1

name	EG665074 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271491 GeneID:665074 MGI:3648576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 62 ESTs product : predicted gene, EG665074 transcript_id : XM_974384.2

name	LOC100039585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271489 GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001473346.1

name	LOC100039585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271487 GeneID:100039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001473331.1

name	LOC100040552 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271447 GeneID:100040552
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475090.1

name	LOC100040585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271450 GeneID:100040585
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 1 protein_id : XP_001475124.1

name	LOC100040585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271452 GeneID:100040585
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 2 protein_id : XP_001475149.1

name	LOC100040606 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271454 GeneID:100040606
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475168.1

name	LOC100040612 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271456 GeneID:100040612
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475183.1

name	LOC100040650 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271458 GeneID:100040650
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 1 protein_id : XP_001475207.1

name	LOC100040650 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271460 GeneID:100040650
definition	codon_start : 1 product : similar to 4930408F14Rik protein isoform 2 protein_id : XP_001475220.1

name	LOC100040662 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271462 GeneID:100040662
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475245.1

name	LOC100039419 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271434 GeneID:100039419
definition	codon_start : 1 product : similar to translation initiation factor eIF-2 gamma subunit protein_id : XP_001472898.1

name	LOC100040698 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271464 GeneID:100040698
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475267.1

name	LOC100040722 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271466 GeneID:100040722
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475285.1

name	LOC100040732 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271468 GeneID:100040732
definition	codon_start : 1 product : similar to RIKEN cDNA 1700017G21 gene protein_id : XP_001475305.1

name	LOC100040743 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271470 GeneID:100040743
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001475322.1

name	LOC100040781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271472 GeneID:100040781
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475339.1

name	LOC100039515 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271477 GeneID:100039515
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473278.1

name	LOC100039473 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271475 GeneID:100039473
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472995.1

name	LOC100039550 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271481 GeneID:100039550
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473309.1

name	LOC100039550 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271483 GeneID:100039550
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473325.1

name	LOC100039557 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271485 GeneID:100039557
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473344.1

name	LOC100039585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271488 GeneID:100039585
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001473381.1

name	LOC100039585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271490 GeneID:100039585
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001473396.1

name	LOC100039328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039328
definition	number : 2 pseudo : _no_value

name	LOC100039328 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039328
definition	number : 1 pseudo : _no_value

name	LOC100039362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039362
definition	number : 1 pseudo : _no_value

name	LOC673784 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673784
definition	number : 3 pseudo : _no_value

name	LOC673784 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673784
definition	number : 2 pseudo : _no_value

name	LOC673784 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673784
definition	number : 1 pseudo : _no_value

name	LOC100039429 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039429
definition	number : 1 pseudo : _no_value

name	LOC100039429 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039429
definition	number : 2 pseudo : _no_value

name	LOC630028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630028
definition	number : 1 pseudo : _no_value

name	LOC630028 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630028
definition	number : 2 pseudo : _no_value

name	LOC385298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385298
definition	number : 1 pseudo : _no_value

name	LOC385298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385298
definition	number : 2 pseudo : _no_value

name	LOC385298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385298
definition	number : 3 pseudo : _no_value

name	LOC100039460 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039460
definition	number : 2 pseudo : _no_value

name	LOC100039460 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039460
definition	number : 1 pseudo : _no_value

name	LOC100040575 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271448 GeneID:100040575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins product : similar to mgclh pseudo : _no_value transcript_id : XR_032063.1

name	LOC100039522 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271478 GeneID:100039522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_031104.1

name	LOC100039573 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271486 GeneID:100039573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_031148.1

clone name	MSMg01-362A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-131B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-501D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539N22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313J05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-178I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-304H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093M23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-064D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140G24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-163B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-411E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494C05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410O02
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-079F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276F07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-156P11.b	B6Ng01-156P11.g
ACC	DH951326	DH951327
length	1,145	395
definition	DH951326\|Mus musculus domesticus DNA, BAC clone: B6Ng01-156P11, 5' end.	DH951327\|Mus musculus domesticus DNA, BAC clone: B6Ng01-156P11, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggcataaaaaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat ccaactcacaccagtcagaatggctaagatcaaaaattcaggtgacagca gatgctggcgtggatgtggagaaagaggaacactcctccattattggtgg gattgcaggcttgtacaaccactctggaaatcagtctggcggttcctcag aaaattggacatagtactaccggaggatccagcaatacctctcctgggca tatatccagaagatgccacaactggtaagaaggacaaatgctccactatg ttcatagcagccttatttataatagccagaagctggaaagaacccagatg tccctcaacagaggaatggataaggaaaatgtggtacatctacacaatgg agtactactcagctattaaaaagaatgaatttatgaaattcctagccaaa tggatggacctggagggcatcatcctgagtgaggtaacacattcacaaag gaactcacacaatatgtactcactgataagtggatattagcccaaaacct aggatacccaagatataagatacaatttgctaaacacatgaaactcaaga aaaatgaagactgaagtgtggacactatgcccctccttagaagtgggaac aaaacacctttggaaggagttacagagacaaagtttggagctgagatgaa aggatggtccatgtagagacttccatatccagggatccaccccataatca gcatccaaacgctaacaccattgcatacaccagcaagattttatcgaaag gatccagatgtagctgtctcttgtgagactatgccggggcctagcaaaca cagaagtggatgctcacagtcagctaatggatggatcacagggctcccaa tggaggagctagagaagtagccagagctaaagggatctgcaccctatagc agacaacatatgactacagtaccccgagctcttgaatctagctgcatatg tatcaagatgctagtcggcatcactgaagaagccactgaaacgcacttaa tgcccagtcaggactccaggcaaaggggagatgtgtggtatggga	atactaggaacttaatattggtgaacatgataggaagtgaaataaagaac acggcagatttctcctgagatgctagcaaatgaaaaagagagtagattat tgttctaattacatataggttttttactcttatatatcaaagtaaactgt gttaacttatagtaactttggccaatgactcaacaactataattcattcc tgctactagaggttttatttggtagcatttgcgtcattatatttctcatt ataaggtgatgggagaaaaggcccttggtcctgtgaaggcttgatgccct agcataggggaatgctagggcagtgagatgggagtcggtaggtgggtggg tggaggaacactctccccgaacaagcaggggggaggggggaaggg
quality values	Open. Hide. 61 43 32 39 61 61 61 38 39 61 61 61 61 61 61 47 61 55 61 61 61 61 61 55 52 49 55 36 43 27 25 44 31 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 59 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 50 61 53 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 53 61 61 61 52 61 50 57 57 57 40 57 53 57 57 57 52 57 40 57 57 53 57 57 57 53 57 57 47 57 53 57 36 57 57 57 57 57 53 53 57 57 57 52 57 57 57 47 53 53 57 53 57 57 57 57 40 53 52 53 52 52 53 57 53 38 47 47 47 34 47 53 57 37 57 52 39 50 43 43 47 34 57 53 57 50 50 53 50 57 50 52 39 52 53 38 53 52 53 47 47 53 53 53 57 57 52 53 53 53 57 57 57 57 57 52 57 50 52 46 52 53 57 57 57 47 38 53 53 46 24 57 30 46 57 47 46 37 53 35 30 53 36 37 30 32 53 40 40 50 53 30 27 27 38 50 36 52 30 50 42 33 48 53 36 47 33 15 35 47 37 37 22 53 52 47 36 36 36 46 36 52 37 38 39 33 52 19 53 42 28 37 40 30 40 36 37 57 33 31 30 22 57 46 31 37 57 47 53 47 48 23 37 44 35 28 14 37 25 33 37 57 43 32 53 29 22 32 53 26 33 37 30 37 40 34 40 35 48 29 25 24 30 38 25 39 34 39 30 31 18 25 25 27 25 25 11 22 29 37 22 30 45 47 47 22 39 28 31 33 31 25 29 29 25 39 29 31 17 48 31 30 28 39 30 27 19 29 25 29 34 21 26 29 33 34 27 29 30 29 27 29 29 29 28 33 31 27 29 33 17 51 46 46 29 34 26 28 33 46 23 33 33 25 23 21 39 15 17 35 16 34 28 29 30 29 33 29 29 29 27 28 27 25 31 21 28 29 17 29 17 29 29 29 35 28 29 19 46 41 29 11 19 23 28 16 13 22 34 29 19 10 29 20 28 23 31 20 25 24 15 23 20 25 28 28 29 19 27 29 31 25 34 31 26 25 29 16 20 27 22 33 12 15 19 22 16 25 27 19 16 19 21 51 18 19 34 9 38 32 16 19 23 24 29 35 28 9 29 8 26 29 25 26 30 13 29 39 13 18 22 23 22 7 7 5 5 10 18 22 14 44 23 17 44 14 17 23 23 31 34 14 30 8 25 17 34 15 22 6 10 4 10 17 31 13 14 7 10 10 27 6 14 15 29 8 10 9 4 4 12 13 18 20 28 18 13 10 9 8 18 25 16 8 20 21 19 29 17 13 16 13 11 23 24 23 16 8 11 11 23 24 10 12 12 6 11 10 15 24 8 15 3 7 20 11 24 12 13 8 22 5 25 19 14 19 13 3 4 2 9 7 7 3 4 4 5 5 11 13 4 5 3 3 4 3 4 4 17 10 4 8 20 19 20 19 18 6 6 4 5 4 14 15 7 3 2 4 8 6 14 12 14 6 22 18 9 27 29 16 10 6 7 4 18 4 6 3 4 18 5 15 6 17 11 7 3	Open. Hide. 19 29 26 39 36 24 20 43 59 59 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 55 59 59 59 55 55 59 59 61 59 39 30 44 44 25 18 16 12 13 16 17 24 23 12 35 24 8 24 12 11 26 14 20 19 27 30 21 19 19 18 8 13 10 10 12 10 13

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_31997295_31997695
seq2: B6Ng01-156P11.g_66_466 (reverse)

seq1  CCCTTTCCCCCTCCCCCCTGCTTCTTCTATGAGAGTGTTCCTCCACCCAC  50
      ||||| ||||||||||||||||| |||   ||||||||||||||||||||
seq2  CCCTTCCCCCCTCCCCCCTGCTTGTTCGGGGAGAGTGTTCCTCCACCCAC  50

seq1  CCACCTACCGACTCCCATCTCACTGCCCTAGCATTCCCCTATGCTAGGGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCTACCGACTCCCATCTCACTGCCCTAGCATTCCCCTATGCTAGGGC  100

seq1  ATCAAGCCTTCACAGGACCAAGGGCCTTTTCTCCCATCACCTTATAATGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAGCCTTCACAGGACCAAGGGCCTTTTCTCCCATCACCTTATAATGA  150

seq1  GAAATATAATGACGCAAATGCTACCAAATAAAACCTCTAGTAGCAGGAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATATAATGACGCAAATGCTACCAAATAAAACCTCTAGTAGCAGGAAT  200

seq1  GAATTATAGTTGTTGAGTCATTGGCCAAAGTTACTATAAGTTAACACAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTATAGTTGTTGAGTCATTGGCCAAAGTTACTATAAGTTAACACAGT  250

seq1  TTACTTTGATATATAAGAGTAAAAAACCTATATGTAATTAGAACAATAAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTTTGATATATAAGAGTAAAAAACCTATATGTAATTAGAACAATAAT  300

seq1  CTACTCTCTTTTTCATTTGCTAGCATCTCAGGAGAAATCTGCCGTGTTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTCTCTTTTTCATTTGCTAGCATCTCAGGAGAAATCTGCCGTGTTCT  350

seq1  TTATTTCACTTCCTATCATGTTCACCAATATTAAGTTCCTAGTATGAATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTCACTTCCTATCATGTTCACCAATATTAAGTTCCTAGTATGAATT  400

seq1  C  401
      |
seq2  C  401

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information