MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-162A12
Chromosome	X (Build37)
Map Location	46,575,716 - 46,576,850
singlet/doublet	singlet
Overlap gene	Enox2
Upstream gene	Utp14a, LOC637576, Bcorl1, Elf4, Aifm1, Rab33a, Suhw3, Slc25a14, Gpr119, Rbmx2, LOC665752, Gm595, EG637758, LOC100040295
Downstream gene	1100001E04Rik, LOC100041697, Olfr1320, Olfr1321, Igsf1, Olfr1322, LOC100040344, Olfr1323
Link	Open Mouse BAC browser

Click to get alignment info.

name	Utp14a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72554 MGI:1919804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC637576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Bcorl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320376 MGI:2443910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56501 MGI:1928377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aifm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26926 MGI:1349419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab33a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19337 MGI:109493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Suhw3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208968 MGI:2387585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20523 MGI:1330823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236781 MGI:2668412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbmx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209003 MGI:1919414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Gm595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209005 MGI:2685441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG637758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637758 MGI:3645144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100040295 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Enox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209224 MGI:2384799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1100001E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75404 MGI:1922654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 105 ESTs, 3 Proteins pseudo : _no_value

name	Olfr1320 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236784 MGI:3031154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236785 MGI:3031155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209268 MGI:2147913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Olfr1322 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257978 MGI:3031156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr1323 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258385 MGI:3031157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Utp14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51889715 GeneID:72554 MGI:1919804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) transcript_id : NM_028276.1

name	Bcorl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347763 GeneID:320376 MGI:2443910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL6 co-repressor-like 1 transcript_id : NM_178782.4

name	Elf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790100 GeneID:56501 MGI:1928377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E74-like factor 4 (ets domain transcription factor) transcript_id : NM_019680.1

name	Aifm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981322 GeneID:26926 MGI:1349419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 1 transcript_id : NM_012019.2

name	Rab33a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755259 GeneID:19337 MGI:109493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB33A, member of RAS oncogene family transcript_id : NM_011228.1

name	Suhw3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254196 GeneID:208968 MGI:2387585
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of hairy wing homolog 3 (Drosophila) transcript_id : NM_153532.2

name	Slc25a14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755543 GeneID:20523 MGI:1330823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, brain), member 14 transcript_id : NM_011398.1

name	Gpr119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186468 GeneID:236781 MGI:2668412
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 119 transcript_id : NM_181751.2

name	Rbmx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374001 GeneID:209003 MGI:1919414
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein, X-linked 2 transcript_id : NM_173376.2

name	Gm595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407353 GeneID:209005 MGI:2685441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : gene model 595, (NCBI) transcript_id : XM_150403.6

name	EG637758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271530 GeneID:637758 MGI:3645144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG637758 transcript_id : XM_979282.2

name	LOC100040295 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271532 GeneID:100040295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001474449.1

name	Enox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801702 GeneID:209224 MGI:2384799
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecto-NOX disulfide-thiol exchanger 2 transcript_id : NM_145951.3

name	1100001E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487452 GeneID:75404 MGI:1922654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1100001E04 gene transcript_id : NM_001081123.1

name	Olfr1320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529460 GeneID:236784 MGI:3031154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1320 transcript_id : NM_207240.2

name	Olfr1321 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421340 GeneID:236785 MGI:3031155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1321 transcript_id : NM_207631.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34330163 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_177591.3

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281998 GeneID:209268 MGI:2147913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_183336.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41282008 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_183335.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343783 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_177915.3

name	Olfr1322 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801353 GeneID:257978 MGI:3031156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1322 transcript_id : NM_001011794.1

name	Olfr1323 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239073 GeneID:258385 MGI:3031157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1323 transcript_id : NM_146390.1

name	Utp14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51889716 CCDS:CCDS30107.1 GeneID:72554 MGI:1919804
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : Jsd-like X-linked product : UTP14, U3 small nucleolar ribonucleoprotein, homolog A protein_id : NP_082552.1

name	Bcorl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347764 GeneID:320376 MGI:2443910
definition	GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 product : BCL6 co-repressor-like 1 protein_id : NP_848897.3

name	Elf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790101 CCDS:CCDS30108.1 GeneID:56501 MGI:1928377
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0016605 - PML body [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0001787 - natural killer cell proliferation [Evidence IDA]; GO:0001866 - NK T cell proliferation [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myeloid elf-1-like factor; myeloid elf-1 like factor product : E74-like factor 4 protein_id : NP_062654.1

name	Aifm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755004 CCDS:CCDS30109.1 GeneID:26926 MGI:1349419
definition	GO_component : GO:0005829 - cytosol [Evidence TAS]; GO:0005792 - microsome [Evidence IDA]; GO:0005758 - mitochondrial intermembrane space [Evidence TAS]; GO:0005741 - mitochondrial outer membrane [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004174 - electron-transferring-flavoprotein dehydrogenase activity [Evidence TAS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008637 - apoptotic mitochondrial changes [Evidence TAS]; GO:0006309 - DNA fragmentation during apoptosis [Evidence TAS]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : harlequin product : programmed cell death 8 protein_id : NP_036149.1

name	Rab33a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755260 CCDS:CCDS30110.1 GeneID:19337 MGI:109493
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAB33A, member of RAS oncogene family protein_id : NP_035358.1

name	Suhw3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254197 CCDS:CCDS30111.1 GeneID:208968 MGI:2387585
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : suppressor of hairy wing homolog 3 protein_id : NP_705760.2

name	Slc25a14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755544 CCDS:CCDS30112.1 GeneID:20523 MGI:1330823
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IDA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 25 (mitochondrial carrier, brain), member 14 protein_id : NP_035528.1

name	Gpr119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32306530 CCDS:CCDS30113.1 GeneID:236781 MGI:2668412
definition	GO_component : GO:0016021 - integral to membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 119 product : G-protein coupled receptor 119 protein_id : NP_861416.1

name	Rbmx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734072 CCDS:CCDS30114.1 GeneID:209003 MGI:1919414
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein, X-linked 2 protein_id : NP_775552.1

name	Gm595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001004 GeneID:209005 MGI:2685441
definition	codon_start : 1 product : hypothetical protein protein_id : XP_150403.5

name	EG637758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271531 GeneID:637758 MGI:3645144
definition	codon_start : 1 product : similar to hCG2001000 protein_id : XP_984376.2

name	LOC100040295 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271533 GeneID:100040295
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001474499.1

name	Enox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122383 CCDS:CCDS30115.1 GeneID:209224 MGI:2384799
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence ISS] [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007624 - ultradian rhythm [Evidence ISS] codon_start : 1 product : cytosolic ovarian carcinoma antigen 1 protein_id : NP_666063.1

name	1100001E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487453 GeneID:75404 MGI:1922654
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Novel RhoGAP domain containing protein product : hypothetical protein LOC75404 protein_id : NP_001074592.1

name	Olfr1320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529461 CCDS:CCDS30116.1 GeneID:236784 MGI:3031154
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2Q64A-11736563-11737522 product : olfactory receptor 1320 protein_id : NP_997123.2

name	Olfr1321 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421341 CCDS:CCDS30117.1 GeneID:236785 MGI:3031155
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-11768161-11767223; GA_x5J8B7W1V10-1157-554 product : olfactory receptor 1321 protein_id : NP_997514.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34330164 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : long isoform is encoded by transcript variant 1; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 long isoform protein_id : NP_808259.2

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281999 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 isoform 4 protein_id : NP_899179.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41282009 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform 3 is encoded by transcript variant 3; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 isoform 3 protein_id : NP_899178.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244558 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : short isoform is encoded by transcript variant 2; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 short isoform protein_id : NP_808583.1

name	Olfr1322 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801354 CCDS:CCDS30118.1 GeneID:257978 MGI:3031156
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-11927171-11926215; olfactory receptor MOR264-16P product : olfactory receptor 1322 protein_id : NP_001011794.1

name	Olfr1323 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239074 CCDS:CCDS30119.1 GeneID:258385 MGI:3031157
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-12051754-12050825; olfactory receptor MOR216-1 product : olfactory receptor 1323 protein_id : NP_666502.1

name	LOC637576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637576
definition	number : 4 pseudo : _no_value

name	LOC637576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637576
definition	number : 3 pseudo : _no_value

name	LOC637576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637576
definition	number : 2 pseudo : _no_value

name	LOC637576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637576
definition	number : 1 pseudo : _no_value

name	LOC665752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665752
definition	number : 1 pseudo : _no_value

name	LOC665752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665752
definition	number : 2 pseudo : _no_value

name	LOC100040344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040344
definition	number : 1 pseudo : _no_value

name	LOC100041697 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271560 GeneID:100041697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 105 ESTs, 3 Proteins product : hypothetical protein LOC100041697 pseudo : _no_value transcript_id : XR_032928.1

clone name	MSMg01-328D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-475P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-162A12.b	B6Ng01-162A12.g
ACC	DH954979	DH954980
length	1,260	1,139
definition	DH954979\|Mus musculus domesticus DNA, BAC clone: B6Ng01-162A12, 5' end.	DH954980\|Mus musculus domesticus DNA, BAC clone: B6Ng01-162A12, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctctgattaagcacccaatgacatgatccaatcacatccccctaa actccacatctcaacactactccacgggaatccaagccacgcatgactat ttgggaggatctcatatctagaccatcagaaaatgaacaaacatttccct actacatggatgacaaaaaggtacacaagaacatgttcaatgtcattatc tactagtgaaatggaaaggaaatcagaagagctaaactttttaaaaaata gtagtaataccaaaccctggaaaaactggaacactcatacattacagatg gcaaatgaaacatatggccactatggaaaagtttggtgatataaatgagc caagtacctattgtatgttggccataagttgtatatgtacttcttcacag cagtccaggatgaacttgctagcaaaaatcctgcagcatccatcttaggt ttttacatatactattgtttacaatgtagcacagaaaaggtattatcttt agcaattaagaggagaccaccccacctagggatccatcccatctgcagac accaaacccatacactactactgatgccaagaagtgcctgatatagctgt cccctgagaggctctgccagcacctgaccaatacagatgtggatgcttgc agccaactatcaagagacctaccctactgtgggctatactattccccagg caaagggtcctgaatatgagtggataaagcaagaaactaacatccaagtg agcatgtatgcattcatttatctctgctcttgactataaatatgatgtga ctagtgttcgcagttgtggcctttactctcccaagacgatgaactgttac ctggaattgtgaactaaaacaagccctttctctactaagtagctttttgt caggatattgtgtggaagtaacaaagtgaaactggggttcaggaatttgt tctggctcgggctcagagtttgaggatacatctgtgatggttggtatatg tttgaccacggaatggcacttgtagaagtgtggccctgttggagtagttg tgtcactgtgagtataggctaatacttcatcctactgctgagccagtatt tctgctagcagcctttcagatgaggtgtaaacttctcagctcctccttgc acatggctgctgatactgttatgtttacagccttgatgtactggactgga acctgacctgttaagccacccaattaaatgtattctctatagacctgtgc ctggtgctag	gaattcaaagggaaccccttttttgatagctcatggagctgccagcacag tctttgaactctccttcaccatcagccaaagagagacttcacttaatctt cactaaaattggcagtcttcaaggatcttggacctccaggtcaaggctaa gttggcaagaactaaatggagagaaaaccattttacagggtcaatgctaa gcccagaatcatgagatttctgaagaaagtgtatatgggtgactaaatca aaggcctcagttaggtcaataaaaatggctctaataatgtaaaagtctca tatactgtttctgaaatactactggtgatttaagtcaagctgaactgaga gaaaggctagctgggaaatgcaactagactatagagaattcagtttccca gggaaaacttcagcattaacttggataagacataaaatcacaaccagcat aagcagccttttgactgcacaatgcataatgttgaactgatcaatgagtc atcagaaagaatggactcactgaacaactcgaccctctataggggctcca gtcagttcaatgagcaactgttcaagtcttgagatttttcagtcatctct ctccagagcagctcctggctggcttctctctgcctgttgccttcccaggt gactacctattgtcatgtttgacatagaaacaatgataagccacactcct agctgctttgtcaaagctctaaagagcaactgagcaaaaggaggttaatg ataatgtctccttgtgtttgcctctgacagtgatggaattcccagagagc tcatttttttcctgagttactttattttattttagaaaagtcgacaaaga aaaatggatagaggctacggcagagagagaaagacttagctatttattta agttatatctctgtgttatttttctcatggcatgcttgctgttcatgatt ttaaattatatgaatcccttatgcttctagtgagtatgctatatgacttc accgatggcttttgtaactgactaataataaaaaatacaaaaggtttctg aatagtacaggaatattattgcaggactggtaatgaaagaatcattatgg cagttaatgcaagcatattaaattaaaatatgagagagt
quality values	Open. Hide. 61 43 29 43 61 47 61 61 61 61 47 47 47 55 47 47 61 61 61 61 49 55 61 55 55 61 61 18 14 13 9 14 9 8 10 11 12 23 23 37 45 59 61 61 61 61 61 59 59 61 61 61 61 61 59 59 61 61 61 61 59 44 61 61 61 61 61 61 61 61 59 52 59 38 41 28 30 28 30 49 59 59 59 59 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 59 55 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 36 61 61 59 61 59 59 59 44 55 59 59 55 59 61 61 59 59 59 59 61 61 61 61 59 59 61 59 44 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 53 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 47 50 50 38 47 50 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 57 57 57 57 57 57 57 57 57 57 57 57 47 40 57 57 57 57 47 47 51 53 57 57 57 53 43 53 53 57 57 57 57 53 57 57 57 57 57 57 57 53 52 53 43 57 45 57 57 57 53 53 53 38 53 57 53 52 57 57 57 47 38 53 50 57 57 57 53 38 53 52 47 47 50 57 53 53 37 52 53 57 47 47 45 53 50 57 43 34 53 53 53 52 57 53 53 57 52 57 43 41 31 53 53 50 53 57 57 52 53 53 53 57 40 57 57 47 50 53 50 52 45 53 47 47 52 53 53 57 41 47 42 38 43 39 52 57 53 39 38 25 22 46 57 50 53 43 37 40 38 34 50 57 31 53 57 50 42 36 31 57 53 37 44 52 43 50 41 31 26 36 44 37 53 52 35 52 57 40 31 41 52 53 53 53 37 37 29 33 53 37 37 52 53 42 17 34 47 43 31 42 57 57 37 40 48 44 48 37 41 33 27 32 33 30 40 32 28 32 33 37 29 57 41 33 40 32 43 53 22 44 20 37 33 27 40 33 39 39 46 17 38 32 29 34 35 30 25 22 40 32 48 39 20 40 29 46 26 28 29 31 31 32 30 47 33 27 45 28 33 24 20 41 21 33 39 31 29 44 43 16 47 24 23 38 29 43 27 39 10 8 46 31 29 29 29 25 26 29 28 51 51 29 29 29 25 32 19 46 29 21 51 37 34 22 34 35 33 28 28 28 43 22 28 35 28 32 33 51 51 51 25 29 24 34 14 25 18 29 20 19 20 34 29 24 29 24 31 26 26 32 22 29 21 28 25 24 51 39 28 31 29 26 51 33 26 28 41 51 46 22 17 33 27 11 24 12 25 23 25 51 33 30 18 25 34 26 23 36 19 28 23 20 44 29 28 31 33 19 19 36 15 28 51 23 22 14 17 9 25 13 20 28 21 31 26 21 29 22 22 38 25 31 32 16 25 30 32 15 27 20 26 28 34 22 51 27 18 25 8 22 10 4 10 20 22 23 14 17 6 4 4 10 12 17 19 15 21 28 15 29 14 9 11 11 19 25 18 35 21 24 33 13 33 21 15 33 11 14 12 14 9 9 13 5 5 6 3 7 14 23 24 16 22 23 18 22 6 6 18 22 15 10 7 7 5 9 7 30 8 10 11 7 11 19 26 6 7 4 12 9 16 7 4 4 5 22 25 22 30 9 11 11 22 6 12 15 25 15 23 11 10 20 24 15 22 19 14 20 4 4 7 9 25 5 5 4 3 5 9 13 15 9 4 7 8 3 4 9 11 20 20 11 10 12 27 5 10 4 4 4 5 4 4 3 3 5 5 8 4 6 2 3 15 5 4 3 1 4 7 3 4 4 10 4 4 6 6 21 7 4 3 6 5 6 12 8 21 7 7 5 6 3 4 3 5 6 8 17 15 4 15 8 5 4 5 2 3 6 7 3 7 4 14 4 8 13 10 6 13 4 12 7 30 16 5 12 7 12 9 13 17 8 5 3 3 3 3 4 3 3 3 2 4 5 5 10 1 1 3 5 4 1 1 3 4 8 8 8 7 2 1 1 2	Open. Hide. 61 61 43 47 55 49 37 12 12 12 12 9 8 12 10 12 12 28 35 59 59 59 61 61 59 61 61 61 61 61 61 59 61 61 61 55 59 61 61 59 61 61 61 61 61 61 61 61 61 61 36 36 29 31 28 26 30 31 37 30 44 55 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 59 61 61 61 59 59 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 44 55 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 34 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 53 57 57 57 47 53 57 53 53 57 52 57 57 57 53 50 57 57 53 53 57 57 57 57 53 57 53 57 53 57 57 57 57 53 45 57 57 57 57 57 57 57 57 50 53 40 57 57 57 57 53 47 53 53 53 38 57 57 53 57 57 57 53 53 57 50 50 57 32 53 53 43 47 53 53 53 53 57 53 52 53 57 47 34 53 47 53 53 57 57 57 53 47 47 57 53 57 39 53 53 39 53 45 53 57 57 53 45 42 52 42 57 38 42 43 34 47 57 47 53 53 52 57 34 53 40 53 57 32 46 46 52 50 50 36 53 43 33 53 43 33 47 24 57 53 57 53 44 38 57 53 53 52 42 47 50 52 53 53 57 50 53 37 53 53 53 44 52 57 39 50 30 52 36 57 46 37 52 53 48 48 25 57 53 37 53 33 44 23 42 52 44 53 52 17 53 38 57 57 39 27 53 38 21 46 24 45 37 42 37 53 40 30 40 44 37 53 35 48 37 41 41 37 41 47 33 41 37 57 41 35 34 53 40 41 41 41 34 28 34 36 33 53 23 21 44 23 30 29 12 20 24 51 39 33 34 46 30 48 29 29 33 30 35 30 51 51 51 46 51 31 32 34 30 30 38 19 38 30 27 30 28 46 24 28 17 51 51 30 12 10 46 51 33 37 27 29 51 46 29 28 28 33 23 33 29 26 51 39 28 48 51 47 45 29 28 29 41 28 23 32 29 30 18 46 26 28 29 23 23 16 23 28 24 39 9 31 24 30 23 29 51 36 23 32 25 33 35 29 20 41 35 28 29 51 39 23 16 41 5 13 17 29 23 27 25 23 29 28 29 28 29 28 43 23 29 19 20 28 22 51 51 51 26 33 22 28 17 21 27 39 22 33 30 34 26 20 22 15 19 30 29 14 21 29 19 21 29 31 24 51 51 11 19 44 19 23 34 22 18 15 20 31 30 33 23 22 51 31 7 17 26 15 24 14 7 31 19 23 33 27 15 29 23 19 7 7 17 28 22 11 16 14 18 15 23 36 29 20 22 33 14 16 30 25 21 11 27 26 23 32 44 44 19 29 17 24 17 28 27 33 25 26 25 31 19 25 23 31 8 9 38 44 39 44 21 6 6 14 7 39 44 25 5 5 5 7 10 25 26 20 22 17 12 12 12 20 22 16 6 11 15 18 7 6 4 13 8 4 4 22 10 14 15 12 17 17 20 9 15 6 4 4 14 6 10 19 34 13 8 7 25 8 12 6 7 4 3 3 4 10 14 6 4 4 3 8 11 16 20 14 6 7 4 1 4 4 4 12 19 10 9 11 9 9 7 32 31 11 7 5 3 7 9 5 6 5 6 4 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_46575716_46576850
seq2: B6Ng01-162A12.g_69_1207

seq1  GAATTCAAAGGGAACCCCTTTTTTGATAGCTCATGGAGCTGCCAGCACAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAAGGGAACCCCTTTTTTGATAGCTCATGGAGCTGCCAGCACAG  50

seq1  TCTTTGAACTCTCCTTCACCATCAGCCAAAGAGAGACTTCACTTAATCTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTGAACTCTCCTTCACCATCAGCCAAAGAGAGACTTCACTTAATCTT  100

seq1  CACTAAAATTGGCAGTCTTCAAGGATCTTGGACCTCCAGGTCAAGGCTAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTAAAATTGGCAGTCTTCAAGGATCTTGGACCTCCAGGTCAAGGCTAA  150

seq1  GTTGGCAAGAACTAAATGGAGAGAAAACCATTTTACAGGGTCAATGCTAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGCAAGAACTAAATGGAGAGAAAACCATTTTACAGGGTCAATGCTAA  200

seq1  GCCCAGAATCATGAGATTTCTGAAGAAAGTGTATATGGGTGACTAAATCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCAGAATCATGAGATTTCTGAAGAAAGTGTATATGGGTGACTAAATCA  250

seq1  AAGGCCTCAGTTAGGTCAATAAAAATGGCTCTAATAATGTAAAAGTCTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCCTCAGTTAGGTCAATAAAAATGGCTCTAATAATGTAAAAGTCTCA  300

seq1  TATACTGTTTCTGAAATACTACTGGTGATTTAAGTCAAGCTGAACTGAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATACTGTTTCTGAAATACTACTGGTGATTTAAGTCAAGCTGAACTGAGA  350

seq1  GAAAGGCTAGCTGGGAAATGCAACTAGACTATAGAGAATTCAGTTTCCCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGCTAGCTGGGAAATGCAACTAGACTATAGAGAATTCAGTTTCCCA  400

seq1  GGGAAAACTTCAGCATTAACTTGGATAAGACATAAAATCACAACCAGCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAAACTTCAGCATTAACTTGGATAAGACATAAAATCACAACCAGCAT  450

seq1  AAGCAGCCTTTTGACTGCACAATGCATAATGTTGAACTGATCAATGAGTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGCCTTTTGACTGCACAATGCATAATGTTGAACTGATCAATGAGTC  500

seq1  ATCAGAAAGAATGGACTCACTGAACAACTCGACCCTCTATAGGGGCTCCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGAAAGAATGGACTCACTGAACAACTCGACCCTCTATAGGGGCTCCA  550

seq1  GTCAGTTCAATGAGCAACTGTTCAAGTCTTGAGATTTTTCAGTCATCTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGTTCAATGAGCAACTGTTCAAGTCTTGAGATTTTTCAGTCATCTCT  600

seq1  CTCCAGAGCAGCTCCTGGCTGGCTTCTCTCTGCCTGTTGCCTTCCCAGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAGAGCAGCTCCTGGCTGGCTTCTCTCTGCCTGTTGCCTTCCCAGGT  650

seq1  GACTACCTATTGTCATGTTTGACATAGAAACAATGATAAGCCACACTCCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTACCTATTGTCATGTTTGACATAGAAACAATGATAAGCCACACTCCT  700

seq1  AGCTGCTTTGTCAAAGCTCTAAAGAGCAACTGAGCAAAAGGAGGTTAATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGCTTTGTCAAAGCTCTAAAGAGCAACTGAGCAAAAGGAGGTTAATG  750

seq1  ATAATGTCTCCTTGTGTTTGCCTCTGACAGTGATGGAATTCCCAGAGAGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATGTCTCCTTGTGTTTGCCTCTGACAGTGATGGAATTCCCAGAGAGC  800

seq1  TCATTTTTTTCCTGAGTTACTTTATTTTATTTTAGAAAAGTCGACAAAGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTTTTTCCTGAGTTACTTTATTTTATTTTAGAAAAGTCGACAAAGA  850

seq1  AAAATGGATAGAGGCTACGGCAGAGAGAGAAAGACTTAGCTATTTA-TTA  899
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  AAAATGGATAGAGGCTACGGCAGAGAGAGAAAGACTTAGCTATTTATTTA  900

seq1  AGTTATATCTCTGTGTTATTTTTCTCATGGCATGCTTGCTGTTCATGATT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTATATCTCTGTGTTATTTTTCTCATGGCATGCTTGCTGTTCATGATT  950

seq1  TTAAATTATATGAATCCCTTATGCTTCTAGTGAGTATGCTATATGACTTC  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATTATATGAATCCCTTATGCTTCTAGTGAGTATGCTATATGACTTC  1000

seq1  ACCGATGGCTTTTGTAACTGACTAATAAT-AAAAATACAAAA-GTATCTG  1047
      ||||||||||||||||||||||||||||| |||||||||||| || ||||
seq2  ACCGATGGCTTTTGTAACTGACTAATAATAAAAAATACAAAAGGTTTCTG  1050

seq1  AATAGTACAGG-ATATTATTGCAGGACTGGAAATGAAAGAATCA-TATGG  1095
      ||||||||||| |||||||||||||||||| ||||||||||||| |||||
seq2  AATAGTACAGGAATATTATTGCAGGACTGGTAATGAAAGAATCATTATGG  1100

seq1  CAGGTTAATGCAAGGAATTATTAA--TATAAAATGAGAGAGT  1135
      || ||||||||||| |  ||||||  || || ||||||||||
seq2  CA-GTTAATGCAAGCA--TATTAAATTAAAATATGAGAGAGT  1139

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information