MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-179P08
Chromosome	X (Build37)
Map Location	27,047,936 - 27,048,999
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100039120, LOC619914, LOC100039039, LOC619991, LOC664844, LOC100042154, EG664861, LOC664866, LOC100042175, LOC100039194, LOC100039208
Downstream gene	EG664877, LOC664881, LOC100039240, LOC100039248, LOC100039073, EG664890, LOC664898, LOC22526, EG664906, LOC664917, LOC100039324, LOC100039334
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039120 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 5 Proteins

name	LOC619914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC619991 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 5 Proteins

name	LOC664844 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 1 Protein pseudo : _no_value

name	LOC100042154 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs

name	EG664861 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664861 MGI:3646621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs

name	LOC100042175 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 5 Proteins

name	LOC100039194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039208 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	EG664877 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664877 MGI:3643741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664881 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs

name	LOC100039240 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039248 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs

name	LOC100039073 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG664890 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664890 MGI:3648359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664898 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC22526 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:22526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664906 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664906 MGI:3647496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins pseudo : _no_value

name	LOC664917 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs

name	LOC100039324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 16 ESTs, 5 Proteins

name	LOC100039334 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 65 ESTs

name	LOC100039120 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271252 GeneID:100039120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 10 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated, transcript variant 2 transcript_id : XM_001472448.1

name	LOC100039120 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271250 GeneID:100039120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 5 Proteins product : similar to Xlr-related, meiosis regulated, transcript variant 1 transcript_id : XM_001472427.1

name	LOC100039039 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271242 GeneID:100039039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to pol protein transcript_id : XM_001472138.1

name	LOC619991 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407135 GeneID:619991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 10 ESTs, 5 Proteins product : novel protein similar to Xlr-related, meiosis regulated (Xmr), transcript variant 1 transcript_id : XM_884246.2

name	LOC619991 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271255 GeneID:619991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 5 Proteins product : novel protein similar to Xlr-related, meiosis regulated (Xmr) transcript_id : XM_001472499.1

name	LOC100042154 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271335 GeneID:100042154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100042154, transcript variant 1 transcript_id : XM_001477451.1

name	LOC100042154 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271333 GeneID:100042154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100042154, transcript variant 2 transcript_id : XM_001477462.1

name	LOC664866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271338 GeneID:664866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs product : hypothetical protein LOC664866 transcript_id : XM_973129.2

name	LOC100042175 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271341 GeneID:100042175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001477530.1

name	LOC100042175 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271339 GeneID:100042175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001477510.1

name	LOC100039208 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271348 GeneID:100039208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039208, transcript variant 1 transcript_id : XM_001472587.1

name	LOC100039208 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271346 GeneID:100039208
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100039208, transcript variant 2 transcript_id : XM_001472606.1

name	LOC664881 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271351 GeneID:664881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs product : hypothetical protein LOC664881 transcript_id : XM_973240.2

name	LOC100039240 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271354 GeneID:100039240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : Xlr-related, meiosis regulated-like, transcript variant 2 transcript_id : XM_001472679.1

name	LOC100039240 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271352 GeneID:100039240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : Xlr-related, meiosis regulated-like, transcript variant 1 transcript_id : XM_001472663.1

name	LOC100039248 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271356 GeneID:100039248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100039248 transcript_id : XM_001472703.1

name	LOC100039073 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271343 GeneID:100039073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to pol protein transcript_id : XM_001472204.1

name	LOC664898 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271359 GeneID:664898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical protein LOC664898 transcript_id : XM_973320.2

name	LOC22526 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:50355988 GeneID:22526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sycp3 like X-linked-like transcript_id : NM_009529.2

name	LOC664917 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271365 GeneID:664917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 61 ESTs product : hypothetical LOC664917 transcript_id : XM_973402.2

name	LOC100039324 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271368 GeneID:100039324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : similar to XMR, transcript variant 2 transcript_id : XM_001472858.1

name	LOC100039324 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271366 GeneID:100039324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 5 Proteins product : similar to XMR, transcript variant 1 transcript_id : XM_001472834.1

name	LOC100039334 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271372 GeneID:100039334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 64 ESTs product : hypothetical protein LOC100039334, transcript variant 1 transcript_id : XM_001472878.1

name	LOC100039334 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271370 GeneID:100039334
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 64 ESTs product : hypothetical protein LOC100039334, transcript variant 2 transcript_id : XM_001472894.1

name	LOC100039120 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271251 GeneID:100039120
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472477.1

name	LOC100039120 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271253 GeneID:100039120
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472498.1

name	LOC100039039 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271243 GeneID:100039039
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472188.1

name	LOC619991 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271256 GeneID:619991
definition	codon_start : 1 product : hypothetical protein LOC619991 protein_id : XP_001472549.1

name	LOC619991 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83000366 GeneID:619991
definition	codon_start : 1 product : hypothetical protein LOC619991 isoform 1 protein_id : XP_889339.1

name	LOC100042154 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271334 GeneID:100042154
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477512.1

name	LOC100042154 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271336 GeneID:100042154
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477501.1

name	LOC664866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407235 GeneID:664866
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978223.1

name	LOC100042175 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271340 GeneID:100042175
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001477560.1

name	LOC100042175 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271342 GeneID:100042175
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001477580.1

name	LOC100039208 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271347 GeneID:100039208
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472656.1

name	LOC100039208 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271349 GeneID:100039208
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472637.1

name	LOC664881 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407238 GeneID:664881
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978334.1

name	LOC100039240 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271353 GeneID:100039240
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001472713.1

name	LOC100039240 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271355 GeneID:100039240
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001472729.1

name	LOC100039248 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271357 GeneID:100039248
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472753.1

name	LOC100039073 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271344 GeneID:100039073
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472254.1

name	LOC664898 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407241 GeneID:664898
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978414.1

name	LOC22526 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:6678607 CCDS:CCDS30055.1 GeneID:22526
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : Xlr-related, meiosis regulated protein_id : NP_033555.1

name	LOC664917 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407245 GeneID:664917
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978496.1

name	LOC100039324 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271367 GeneID:100039324
definition	codon_start : 1 product : similar to XMR isoform 1 protein_id : XP_001472884.1

name	LOC100039324 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271369 GeneID:100039324
definition	codon_start : 1 product : similar to XMR isoform 2 protein_id : XP_001472908.1

name	LOC100039334 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271371 GeneID:100039334
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472944.1

name	LOC100039334 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271373 GeneID:100039334
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472928.1

name	LOC619914 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271254 GeneID:619914
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to Sycp3 like X-linked pseudo : _no_value transcript_id : XR_030717.1

name	LOC664844 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271257 GeneID:664844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 1 Protein product : hypothetical LOC664844 pseudo : _no_value transcript_id : XR_030752.1

name	EG664861 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271337 GeneID:664861 MGI:3646621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664861 pseudo : _no_value transcript_id : XR_035688.1

name	LOC100039194 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271345 GeneID:100039194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins product : similar to XMR pseudo : _no_value transcript_id : XR_030764.1

name	EG664877 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271350 GeneID:664877 MGI:3643741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664877 pseudo : _no_value transcript_id : XR_035651.1

name	EG664890 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271358 GeneID:664890 MGI:3648359
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664890 pseudo : _no_value transcript_id : XR_035653.1

name	EG664906 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271364 GeneID:664906 MGI:3647496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : predicted gene, EG664906 pseudo : _no_value transcript_id : XR_035654.1

clone name	MSMg01-451D23
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-058C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269L14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-179P08.b	B6Ng01-179P08.g
ACC	GA006530	GA006531
length	1,075	900
definition	B6Ng01-179P08.b	B6Ng01-179P08.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcagcatgttatccaaaatcaagataaatcatagcctttaccaggg tctccatcactaataagaacagtgactccatcatgattgctgatcacagc tccagcacttacataagaatagcttcatgttttaggtagggtcacaggca tcaaattcctctccagtagcagcacatagcacttacatcattgtgattta ggcagcactactgatcatgaattacagaaaagactcctctggttcaaaga tctcacatatcaaggagctcttccaggacaacactgactttggttcttta catggggaccagtggcctcactgatgagtgacaccaatatatttccctta gcagttgggatgtggtccaaagtggcagtaaggtccaaagtggcagtaag ggtaactcatgaccttggtgcctatggcagcatttatctgggtataccat cttatctttgccaggaaatatcatgcacattcagacattttcagatacct agtaggaccttgtagagaaacctcttctctagtggtaggatgcatcatga catcaaaatggttaggctgggtgtactcttcatctaaaattgacaggaac atggataactgatgtaagtaaattttccatttgatattcagagacactca tattattatggttccacatgggagcagggataactgacatcatacctgct ggaaaaccctaaagtctaatggatatacaatggtgatagttgccactata tatgttactcaaaataacatctcagaccccaaaaataaaaatattctgag aaaactgtattgtttaattctctgtggacgttgctggcctcagggatcct tgacattaacaatctccccagaatcatcattgtactatgggttttaaacg gggtttctggatgatgattgacatcaacatagtttctgtaggcacttttg gattactgttattaaatggcttctcagtagcaccattgatcactgaacaa agtgattggccatatacatcgtgtcatggtatctgtttggcaagtataca ccttattgttgatatccgattaaga	gaattctgtaggcttcttgtatattcatgggaatctctttctttaggtat tggaagctttcttctataacattgttgaagatatttgctggccctttaag ttgagaatcttcattctcaactactattatccataggtttggtcttctca ttgtgtcctgggtttcctgaatgttttgagttgggatctttttgcatttt gcattttctttgattgttgtgttcatgttacctatggaatcttctgcatc tgagattctctttccatctcttgtattctgttgttgatgctcacatctat gtttcctgatttctttcctagggtttttatctccagagttgtttcccttt agtttttcttcattatttctacttctatttttagatcttggatttttttt tattcaattccatcacctatttggttgtgttttcctgtaattctttacgg gatttttatgtttcttctaccagtttagcagtgtttacctttagttcttt aaggacttgtacttgtttagcagtgttctcctgtaattccttgagggatt tctgtgcttcttctttaagggcttctacctgtttagcggtgttctcctgt tattcctttagggatttctgtgtttcctctttaagggcttctacctgttt agccgtgttctcctgtatttctttaagttattaatgtacttctttaaaat cttctaccacccatcaagagatatgattttaaatccgagtcttgctttgt cgggttttttggggtatccaggactttctgtggtgggctttactggattc tgatgatgccaggtgttcttggtttttgtttgaaagattttttaaccttt tctctctcaacatctggtaatctctgctgtttaatggtcaagcttgtctc
quality values	Open. Hide. 58 36 32 17 35 20 12 11 23 18 31 49 62 47 43 47 62 31 22 62 62 62 62 41 33 47 47 47 42 62 62 56 59 11 13 12 10 11 10 18 23 23 21 25 17 17 16 17 45 62 62 62 62 62 62 59 62 59 62 62 59 59 62 62 62 62 54 54 54 62 59 62 62 62 59 62 62 62 59 59 43 43 28 28 32 30 40 32 35 28 28 32 59 62 59 62 62 54 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 56 62 62 62 62 54 54 62 62 62 59 62 62 62 62 59 56 51 43 59 59 59 56 62 62 59 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 59 59 62 62 62 59 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 56 59 62 62 59 62 62 62 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 51 56 59 56 56 59 62 62 62 62 62 62 62 62 59 59 59 34 24 18 28 25 23 59 59 59 59 54 56 54 50 59 54 62 62 62 62 56 62 59 56 56 51 59 56 59 51 62 59 56 62 62 62 62 62 59 59 62 62 62 62 59 59 62 48 50 62 59 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 59 59 59 59 62 62 62 62 62 59 59 59 59 59 56 62 62 59 62 62 62 62 56 56 44 44 44 45 59 62 62 62 62 62 62 62 47 47 56 62 56 47 54 62 62 56 44 39 38 62 51 51 62 56 62 62 56 44 62 35 56 47 43 56 56 56 31 21 37 38 62 51 62 56 51 39 51 51 56 47 24 20 14 14 10 11 11 56 62 54 46 56 47 56 47 39 62 62 62 62 62 62 50 56 56 56 42 56 56 37 56 56 62 62 62 62 56 62 62 62 62 62 62 62 62 48 42 62 62 46 47 52 52 52 38 62 52 52 62 42 33 42 42 46 46 42 50 52 42 41 42 52 52 48 52 27 54 58 52 54 34 37 54 54 52 58 58 54 58 52 58 58 54 54 54 54 54 35 52 54 14 41 47 49 32 58 19 46 52 42 54 58 47 58 58 46 58 54 54 52 54 54 58 58 42 52 42 29 22 49 35 58 54 54 54 45 26 32 40 41 24 52 46 48 47 44 50 58 40 53 35 15 47 50 41 34 26 28 50 52 41 48 41 29 53 53 40 50 33 37 46 42 58 50 49 49 43 47 50 58 18 49 51 58 28 13 30 22 28 32 46 36 19 44 42 51 50 36 20 40 52 45 53 31 49 49 46 39 19 50 45 39 51 40 50 38 42 41 37 26 52 53 39 35 28 54 50 52 58 31 21 22 49 37 38 28 17 35 32 26 14 37 37 27 16 35 43 40 31 13 49 12 23 26 20 16 32 37 54 49 41 24 52 40 52 42 52 41 38 27 47 42 27 54 13 45 54 54 39 34 37 54 37 32 22 7 36 7 40 9 18 49 36 38 25 18 40 33 41 32 31 14 24 23 29 33 42 33 28 35 47 46 27 37 41 34 11 13 49 24 34 24 39 23 20 27 20 11 19 32 53 15 13 31 28 32 16 28 39 45 34 45 40 17 28 14 51 51 22 31 31 19 19 14 7 13 31 23 11 14 34 45 31 28 40 14 8 28 46 15 34 45 32 30 29 37 30 40 29 39 36 30 31 33 25 20 12 17 38 22 30 9 5 17 21 21 30 14 25 31 19 26 33 17 17 31 10 9 31 32 18 17 14 9 46 22 21 20 31 33 18 28 31 14 19 9 13 17 28 23 26 18 35 22 28 32 23 16 39 44 25 21 25 33 11 19 11 9 7 8 8 5 14 36 24 23 18 14 6 14 6 15 27 25 18 23 33 21 30 31 22 15 9 19 41 29 10 5 8 6 15 27 9 13 37 17 8 7 6 5 5 5 8 31 13 5 8 16 28 8 11 12 9 11 6 4 4 31 11 32 9 24 15 9 10 39 12 9 11 10 17 32 8 20 17 6 12 9 7 9 9 10 20 6 17 4 12 7 17 14 20 15 6 20 25 5 6 22 18 12	Open. Hide. 62 49 47 42 62 62 54 47 62 62 56 24 16 16 11 21 18 25 22 25 22 18 22 28 27 20 25 50 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 50 56 59 43 46 46 35 36 43 43 46 28 36 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 49 54 59 49 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 42 54 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 59 51 59 59 56 56 62 56 62 59 59 51 59 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 51 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 45 59 59 45 51 62 62 62 62 59 62 59 56 62 62 62 56 62 62 62 62 62 56 51 56 56 62 62 56 62 62 56 51 56 56 56 56 62 35 56 62 51 56 56 56 38 56 56 33 50 41 50 51 62 56 56 38 32 40 51 62 56 62 56 62 56 56 51 62 56 47 26 62 62 62 62 62 62 62 62 62 47 56 62 62 56 56 62 56 56 43 38 62 56 56 62 47 47 62 47 47 43 45 62 39 62 31 39 47 47 47 25 52 62 62 52 62 53 54 62 62 62 62 52 25 15 31 47 62 52 62 50 42 28 40 31 52 38 62 27 46 62 62 54 52 52 52 62 52 45 46 54 41 58 21 41 41 17 58 41 34 42 31 54 52 42 42 54 49 54 54 54 54 42 24 26 58 33 41 42 22 58 42 41 45 35 32 54 37 52 54 54 33 52 52 42 17 10 52 37 47 54 26 21 13 8 29 39 54 27 35 34 35 52 45 18 54 8 25 52 54 20 20 42 39 58 41 25 42 50 38 29 21 49 19 26 50 39 25 48 47 54 41 50 25 30 42 28 41 9 36 50 48 26 33 29 37 37 50 8 54 20 37 38 58 49 42 35 28 53 18 32 37 40 37 42 32 39 40 50 46 46 37 40 42 42 22 26 29 39 39 35 24 16 21 17 14 27 58 50 53 50 53 29 22 28 40 39 50 46 19 19 50 26 28 26 49 58 14 39 18 51 34 31 33 35 26 25 19 13 39 25 18 12 9 14 13 50 33 39 35 22 8 28 6 6 25 49 40 32 23 14 6 6 4 9 11 25 12 25 8 53 53 21 25 21 10 6 18 25 37 50 44 39 38 8 16 25 20 37 16 28 23 30 24 28 32 28 33 27 10 25 25 25 37 30 28 33 41 14 17 8 8 9 8 10 14 13 33 13 13 24 30 26 17 16 8 11 13 13 10 9 9

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_27047936_27048999
seq2: B6Ng01-179P08.b_36_1110

seq1  GAATTCAGCATGTTATCCAAAATCAAGATAAATCATAGCCTTTACCAGGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGCATGTTATCCAAAATCAAGATAAATCATAGCCTTTACCAGGG  50

seq1  TCTCCATCACTAATAAGAACAGTGACTCCATCATGATTGCTGATCACAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCATCACTAATAAGAACAGTGACTCCATCATGATTGCTGATCACAGC  100

seq1  TCCAGCACTTACATAAGAATAGCTTCATGTTTTAGGTAGGGTCACAGGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGCACTTACATAAGAATAGCTTCATGTTTTAGGTAGGGTCACAGGCA  150

seq1  TCAAATTCCTCTCCAGTAGCAGCACATAGCACTTACATCATTGTGATTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAATTCCTCTCCAGTAGCAGCACATAGCACTTACATCATTGTGATTTA  200

seq1  GGCAGCACTACTGATCATGAATTACAGAAAAGACTCCTCTGGTTCAAAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGCACTACTGATCATGAATTACAGAAAAGACTCCTCTGGTTCAAAGA  250

seq1  TCTCACATATCAAGGAGCTCTTCCAGGACAACACTGACTTTGGTTCTTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCACATATCAAGGAGCTCTTCCAGGACAACACTGACTTTGGTTCTTTA  300

seq1  CATGGGGACCAGTGGCCTCACTGATGAGTGACACCAATATATTTCCCTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGGGACCAGTGGCCTCACTGATGAGTGACACCAATATATTTCCCTTA  350

seq1  GCAGTTGGGATGTGGTCCAAAGTGGCAGTAAGGTCCAAAGTGGCAGTAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTTGGGATGTGGTCCAAAGTGGCAGTAAGGTCCAAAGTGGCAGTAAG  400

seq1  GGTAACTCATGACCTTGGTGCCTATGGCAGCATTTATCTGGGTATACCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAACTCATGACCTTGGTGCCTATGGCAGCATTTATCTGGGTATACCAT  450

seq1  CTTATCTTTGCCAGGAAATATCATGCACATTCAGACATTTTCAGATACCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATCTTTGCCAGGAAATATCATGCACATTCAGACATTTTCAGATACCT  500

seq1  AGTAGGACCTTGTAGAGAAACCTCTTCTCTAGTGGTAGGATGCATCATGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGGACCTTGTAGAGAAACCTCTTCTCTAGTGGTAGGATGCATCATGA  550

seq1  CATCAAAATGGTTAGGCTGGGTGTACTCTTCATCTAAAATTGACAGGAAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCAAAATGGTTAGGCTGGGTGTACTCTTCATCTAAAATTGACAGGAAC  600

seq1  ATGGATAACTGATGTAAGTAAA-TTTCCA-TTGATATTCAGAGACACTCA  648
      |||||||||||||||||||||| |||||| ||||||||||||||||||||
seq2  ATGGATAACTGATGTAAGTAAATTTTCCATTTGATATTCAGAGACACTCA  650

seq1  TATTATTATGGTTCCACATGGGAGCAGGGATAACTGACATCATACCTGCT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTATTATGGTTCCACATGGGAGCAGGGATAACTGACATCATACCTGCT  700

seq1  -GAAAACCCT-AAGTCTAATGGATATACAATGGTGATAGTTGCCACTATA  746
       ||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  GGAAAACCCTAAAGTCTAATGGATATACAATGGTGATAGTTGCCACTATA  750

seq1  TATGTTACTCAAAATAACATCTCAGACCCCAAAAATAAAAATATTCTGAG  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTTACTCAAAATAACATCTCAGACCCCAAAAATAAAAATATTCTGAG  800

seq1  AAAACTGTATTGTTAAATTCTCTGTGGACGTTGCTGGCCTCAGGGATCCT  846
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AAAACTGTATTGTTTAATTCTCTGTGGACGTTGCTGGCCTCAGGGATCCT  850

seq1  TGACATTAACAATCTCCCCAGAATCATCA-TGTACTATGGG-TTTAAACG  894
      ||||||||||||||||||||||||||||| ||||||||||| ||||||||
seq2  TGACATTAACAATCTCCCCAGAATCATCATTGTACTATGGGTTTTAAACG  900

seq1  GGGTTTCTGGATGATGATTGACATCAACATAGTTTCTGTAGGCAC-TTTG  943
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  GGGTTTCTGGATGATGATTGACATCAACATAGTTTCTGTAGGCACTTTTG  950

seq1  GATTACTGTTATTAAAATGGC-TCTCAGTAGCA-CAGTGATCACTG-ACA  990
      ||||||||||||| ||||||| ||||||||||| || ||||||||| |||
seq2  GATTACTGTTATT-AAATGGCTTCTCAGTAGCACCATTGATCACTGAACA  999

seq1  AAGTGGTT-GCCAATGACATCGTGTCATGGTATCTG-TTGCCAGGTATAC  1038
      ||||| || ||||   |||||||||||||||||||| ||| || ||||||
seq2  AAGTGATTGGCCATATACATCGTGTCATGGTATCTGTTTGGCAAGTATAC  1049

seq1  AACACTATGTTTAATAT-CGATTAAGA  1064
       ||  |||  || |||| |||||||||
seq2  -ACCTTATTGTTGATATCCGATTAAGA  1075

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information